| Literature DB >> 36105211 |
Rui Zeng1, Tian-Cheng Ke2, Mao-Ta Ou2, Li-Liang Duan2, Yi Li3, Zhi-Jing Chen4, Zhi-Bin Xing2, Xiao-Chen Fu2, Cheng-Yu Huang2, Jing Wang2.
Abstract
Purpose: We aimed to establish the transcriptome diagnostic signature of postmenopausal osteoporosis (PMOP) to identify diagnostic biomarkers and score patient risk to prevent and treat PMOP.Entities:
Keywords: WGCNA; biomarkers; diagnostic signature; network pharmacology; postmenopausal osteoporosis (PMOP)
Year: 2022 PMID: 36105211 PMCID: PMC9464864 DOI: 10.3389/fphar.2022.944735
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
Patient characteristics (n = 28).
| Mean ± SD (Range) | ||
|---|---|---|
| Characteristic | High bone density | Low bone density |
| Patients (n) | 14 | 14 |
| Age (years) | 61.9 ± 9.5 | 66.2 ± 8.4 |
| Height (cm) | 156.8 ± 6,7 | 158.6 ± 5.6 |
| Weight (kg) | 58.4 ± 6.3 | 61.1 ± 7.6 |
| T-score | 0.7 ± 0.9 | -2.4 ± 0.8 |
| Menstrual condition | ||
| Menopause | 14 | 14 |
| Premenopausal | 0 | 0 |
| Smoking status | ||
| Smoking | 0 | 0 |
| No history of smoking | 14 | 14 |
| Surgery situation | ||
| Have vertebroplasty | 0 | 0 |
| No vertebroplasty | 14 | 14 |
mRNA-specific primer sequences.
| Gene | Primer sequence | Tm |
|---|---|---|
|
| F: GCTGTTCATAAAGAATGCCAGCAA | 57 |
| R: CAGCTCCCTGATCTTTGTATGGT | 56 | |
|
| F: TCCATCACAAGGTCGTATTACAGA | 55 |
| R: TGGTTGAATGTATCTCTCCGTGTA | 55 | |
|
| F: ACAGTTGCCATGTAGACC | 56 |
| R: TTTTTGGTTGAGCACAGG | 60 |
FIGURE 1(A) Cell abundance of the pilot cohort. (B) Volcano plot of DEGs between the individuals with a high BMD and a low BMD in the pilot cohort.
FIGURE 2(A) Fitting index of the scale-free topology module under different soft thresholds (left) and network connectivity under different soft thresholds (right). (B) Cluster diagram of genes and the corresponding gene modules. (C) Correlation between module eigengenes and BMD. (D) Selection of the optimal parameter (λ) of LASSO regression through cross-validation. (E) LASSO coefficient profiles of the 15 genes that comprise the diagnostic signature selected by λ.
Genes and their coefficients that constitute the diagnostic signature.
| Gene | Coefficient |
|---|---|
|
| −0.69559 |
|
| 0.005073 |
|
| 0.014223 |
|
| 0.018658 |
|
| 0.031496 |
|
| 0.050969 |
|
| 0.088715 |
|
| 0.100,972 |
|
| 0.13443 |
|
| 0.144,549 |
|
| 0.208,241 |
|
| 0.231,434 |
|
| 0.338,636 |
|
| 0.394,242 |
|
| 1.089913 |
FIGURE 3(A) Risk plot and (B) PCA of the pilot cohort. (C) The heatmap shows the different expression patterns of 15 genes. (D) ROC curves of the pilot cohort and the validation cohort. (E) The heatmap shows the different expression patterns between the high- and low-risk groups. (F) Correlations among the 15 genes.
FIGURE 4(A) Result of KEGG enrichment analysis. (B) Result of DO analysis. (C) Result of GO analysis. (D) Results of the GSEA.
FIGURE 5(A) miRNA-gene-molecule interaction network. (B) KEGG enrichment analysis of the potential interacting miRNAs.
FIGURE 6DXA images of the lumbar spine L1-L4 of women with a normal BMD (A) and low BMD (B). The overall expression of METTL4 (C)and RAB2A (D) in PBMCs from 14 low BMD patients and healthy controls.
Genes and their AUCs that constitute the diagnostic signature.
| Gene | AUC |
|---|---|
|
| 0.8638 |
|
| 0.7431 |
|
| 0.7219 |
|
| 0.72 |
|
| 0.725 |
|
| 0.6444 |
|
| 0.6444 |
|
| 0.7375 |
|
| 0.7141 |
|
| 0.7338 |
|
| 0.7075 |
|
| 0.7819 |
|
| 0.6481 |
|
| 0.7038 |
|
| 0.8306 |