| Literature DB >> 36105129 |
Salwa Alshehri1,2, Ram Karan3, Sarah Ghalayini1, Kowther Kahin1, Zainab Khan1, Dominik Renn3, Sam Mathew3, Magnus Rueping3,4, Charlotte A E Hauser1,5.
Abstract
Three-dimensional (3D) bioprinting has emerged as a promising method for the engineering of tissues and organs. Still, it faces challenges in its widespread use due to issues with the development of bioink materials and the nutrient diffusion barrier inherent to these scaffold materials. Herein, we introduce a method to promote oxygen diffusion throughout the printed constructs using genetically encoded gas vesicles derived from haloarchaea. These hollow nanostructures are composed of a protein shell that allows gases to permeate freely while excluding the water flow. After printing cells with gas vesicles of various concentrations, the cells were observed to have increased activity and proliferation. These results suggest that air-filled gas vesicles can help overcome the diffusion barrier throughout the 3D bioprinted constructs by increasing oxygen availability to cells within the center of the construct. The biodegradable nature of the gas vesicle proteins combined with our promising results encourage their potential use as oxygen-promoting materials in biological samples. Copyright:Entities:
Keywords: Gas vesicles; Halobacterium; Haloferax; Three-dimensional bioprinting; Tissue engineering
Year: 2022 PMID: 36105129 PMCID: PMC9468848 DOI: 10.18063/ijb.v8i3.489
Source DB: PubMed Journal: Int J Bioprint ISSN: 2424-8002
Oligonucleotides used in this study.
| Primer | 5’-3’ sequence |
|---|---|
| pTA.1 | GGACCTATTGCGCATATGCACCACCACCACCACCACATGCGCATAATTCAATCGATACGAGTCCCG |
| pTA.2 | AATGCGATGGTCCAGAGGTGCGGCCGCTCTAGAACTAGTGGATCCGATCTGTGAGTGTACACCCC |
| TGTCTCTTCTTCCTCGTTAACGGTACCGGCGGATTCTCC | |
| GCGGAGAATCCGCCGGTACCGTTAACGAGGAAGAAGAGACAGAGCC |