Literature DB >> 36098040

CircPTPRM accelerates malignancy of papillary thyroid cancer via miR-885-5p/DNMT3A axis.

Daping Chen1, Xijiao Jiang2, Huizhou Luo3, Qingquan Hua4, Farong Zhang2.   

Abstract

BACKGROUND: Circular RNAs (circRNAs) are implicated in carcinogenesis, including papillary thyroid cancer (PTC). Despite of previous reports regarding the high expression of circPTPRM in PTC, the role and regulatory mechanism remain to be investigated.
METHODS: CircPTPRM and miR-885-5p expression were examined, and the effects on cell proliferation, migration, and invasion were also measured. Immunoblotting was performed to evaluate DNA methyltransferase 3A (DNMT3A) and the epithelial-mesenchymal transition (EMT)-associated proteins.
RESULTS: CircPTPRM was overexpressed in PTC tissues and cell lines, which predicted poor prognosis. CircPTPRM inhibition significantly alleviated the proliferation, migration, and invasion abilities. It was subsequently confirmed that circPTPRM competed with miR-885-5p for DNMT3A binding. CircPTPRM promoted PTC progression via miR-885-5p/DNMT3A signal axis.
CONCLUSION: Our data elucidated that circPTPRM may play an oncogenic role in PTC through circPTPRM/miR-885-5p/DNMT3A axis.
© 2022 The Authors. Journal of Clinical Laboratory Analysis published by Wiley Periodicals LLC.

Entities:  

Keywords:  DNMT3A; circular RNA; miR-885-5p; papillary thyroid cancer

Mesh:

Substances:

Year:  2022        PMID: 36098040      PMCID: PMC9551131          DOI: 10.1002/jcla.24688

Source DB:  PubMed          Journal:  J Clin Lab Anal        ISSN: 0887-8013            Impact factor:   3.124


INTRODUCTION

Thyroid cancer is one of the most common malignant tumors of the endocrine system, , and papillary thyroid cancer (PTC) is the most common pathologic type. Thyroidectomy is one of the main treatment methods for PTC. Although the prognosis of patients with PTC is considerably satisfactory after surgical excision, the recurrence remains high due to distant metastasis. , PTC not only brings physical trauma to patients with surgical treatment, but also brings heavy psychological burden due to the fear of disease recurrence. Therefore, it is of great value to conduct relevant basic research and clarify the molecular mechanism of the occurrence and development of PTC. Circular RNAs (circRNAs) are widely involved in the progression of diverse malignancies. Plentiful circRNAs have demonstrated to regulate multiple biological processes of PTC cells, such as survival, apoptosis, invasion, and metastasis. , , Increasing studies report that circRNA is a crucial member of competitive endogenous RNA (ceRNA), and acts as a miRNA “sponge” to relieve the inhibitory effect on its target genes. , Lv et al. have used RNA deep sequencing to determine the expression patterns of circRNAs in PTC tumors and discovered that circPTPRM (circBase ID: hsa_circ_0007144) is highly expressed in PTC patients. However, the precise roles of circPTPRM in the development of PTC and its associated ceRNA network remain to be further clarified.

MATERIALS AND METHODS

Patients and tissues

The experimental procedures were approved by the Ethics Committee of Xianning Central Hospital, The First Affiliated Hospital of Hubei University of Science and Technology. Paired tumor and paracancerous normal tissues were obtained from 50 patients who were diagnosed with PTC and signed informed consent.

Cell lines

Human thyroid cell line Nthy‐ori 3–1 and PTC cell lines were all obtained from the Chinese Academy of Sciences (Shanghai, China). Cell culture was performed at 37°C in DMEM medium (Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS) and 1% streptomycin/penicillin.

Cell transfection

When 70%–80% confluence was achieved, cell transfection was performed with siRNA targeting circPTPRM (siRNA#1, sense 5′‐GUAAUGAAGAAAAGUCCCATT‐3′ and antisense 5′‐UGGGACUUUUCUUCAUUACTT‐3′; siRNA#2, sense 5′‐GAAAAGUCCCAGGUGCUGUTT‐3′ and antisense 5′‐ACAGCACCUGGGACUUUUCTT‐3′; 100 nM), miR‐885‐5p mimic (5′‐UCCAUUACACUACCCUGCCUCU‐3′; 50 nM), miR‐NC (5′‐UUCUCCGAACGUGUCACGUTT‐3′; 50 nM), miR‐885‐5p inhibitor (5’‐AGAGGCAGGGUAGUGUAAUGGA‐3′; 100 nM); inhibitor NC, (5’‐CAGUCUUUUGUGUGUACAA‐3′; 100 nM), pcDNA3.1‐based DNMT3A overexpression vector (100 nM) or corresponding negative controls (100 nM), purchased from Genepharma (Shanghai, China) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).

Quantitative real‐time PCR and RNase R digestion

Tissues and cultured cells were used for total RNA extraction using Trizol reagent (Invitrogen). SYBR Green RT‐qPCR kit (Takara, Shiga, Japan) was applied for RT‐PCR reactions. Total RNAs of TPC‐1 and KAT‐5 cells were incubated for 30 min with 3 U/mg of RNase R or mock at 37°C. The relative levels of circPTPRM and PTPRM mRNA were quantified by qRT‐PCR analysis. The following sequences of the primers were used for qPCR (5′‐3′): circPTPRM forward: GGGCATCTTGCTGTTCGTGA, reverse: TTCAGTGGGAACAGCACCTG; PTPRM forward: GGCGAGACGTTCTCAGGTG, reverse: AGAAGTCGGTTTAGTCAAGGTGT; miR‐885‐5p forward: GTCCATTACACTACCCTGCCTC, reverse: CGCGAGCACAGAATTAATACG; DNMT3A forward: TATTGATGAGCGCACAAGAGAGC, reverse: GGGTGTTCCAGGGTAACATTGAG; GAPDH forward: TGTGGGCATCAATGGATTTGG, reverse: ACACCATGTATTCCGGGTCAAT; U6 forward: AAAGCAAATCATCGGACGACC, reverse: GTACAACACATTGTTTCCTCGGA. Fold changes of expression levels were calculated by the 2−ΔΔCt method.

Luciferase reporter assay and RNA immunoprecipitation (RIP) assay

The wild or mutated circPTPRM or DNMT3A luciferase plasmids were co‐transfected with either the miR‐885‐5p mimic or miR‐NC. After 48 h transfection, the luciferase activity (Promega, Madison, Wisconsin, USA) was detected. RIP assay was performed using Imprint® RNA Immunoprecipitation Kit (Sigma‐Aldrich, St. Louis, MO, USA) according to the instructions. The cell extracts of TPC‐1 and KAT‐5 cells were incubated with RIP buffer containing magnetic beads coated with Ago2 (#2897; 1:50 dilution) or IgG (#8726; 1:20 dilution) antibodies (all from Cell Signaling Technology, Boston, MA, USA). After that, the co‐precipitated RNAs were subjected to qRT‐PCR analysis for the enrichments of circPTPRM and miR‐885‐5p.

Cell viability assay

Cell viability was examined with the CCK‐8 kit (Beyotime Biotechnology, Shanghai, China). At different time points (0 h, 24 h, 48 h, and 72 h), cultured cells (2000 cells/well) were mixed with 10 μl CCK‐8 solution in a 96‐well plate. After 4 h incubation, absorbance was analyzed at 450 nm using microplate reader (Bio‐Rad Laboratories, Hercules, CA, USA).

Colony formation assay

Cells were plated at 300 cells/well in 6‐well plates and incubated for 15 days when colonies were visible. Crystal violet staining was performed and the number of colonies was counted.

Flow cytometry

Cells were collected and suspended in the binding buffer (BD Biosciences, Franklin, NJ, USA). Subsequently, Annexin V‐fluorescein isothiocyanate (Annexin V‐FITC; BD Biosciences) and propidium iodide (PI; BD Biosciences) were added to simultaneously incubate with PTC cells in the dark. The apoptosis rate was analyzed by the FACS CantoII flow cytometer (BD Biosciences).

Wound healing assay

Cells were seeded in 6‐well plates at a density of 4 × 105 cells/well. Once the cells reached 90% confluence, a wound area was carefully created by scraping the cell monolayer with a sterile 200 μl pipette tip, from one end to the other end of the well. The detached cells were removed by washing with PBS. Cells migrated to the wounded region were observed by Olympus inverted microscope and photographed (100× magnification) at 0 h and 24 h.

Transwell assays

Transwell chamber (BD Biosciences, Bedford, MA, USA) with or without Matrigel coating was used to evaluate cell migration and invasion. Serum‐free media with cultured cells was added into the upper wells, while the lower chambers were filled with conditioned media with 20% FBS. The migrated or invaded cells were fixed and stained with 0.5% crystal violet and representative images were captured under microscopy at 200× magnification.

Western blotting

TPC‐1 and KAT‐5 cells were dissolved in RIPA buffer (Beyotime Biotechnology) containing protease inhibitor for the extraction of total protein, and the protein quantification was then measured by BCA Protein Assay Kit (Beyotime Biotechnology). Proteins (50 μg) were exposed to 10% SDS‐PAGE and electroblotted onto a PVDF membrane (EMD Millipore, Bedford, MA, USA). The membranes were incubated overnight at 4°C with indicated primary antibodies (1:1000 dilution; all from Cell Signaling Technology): DNMT3A (#32578), E‐cadherin (#3195), N‐cadherin (#13116), Vimentin (#5741), and GAPDH (#5174). Secondary antibodies (#7074) diluted at 1:2000 were subsequently used for further incubation at room temperature for 1 h. The protein bands were visualized using the enhanced chemiluminescence method (Beyotime Biotechnology).

Statistical analysis

All the experiments were performed at least in triplicate, and at least repeated for three times. SPSS 19.0 statistical software (IBM, Chicago, IL, USA) was used to analyze the data presented as mean ± standard deviation (SD). Student's t‐test or analysis of variance followed by Tukey's test was used to analyze the results. Kaplan–Meier survival analysis was used to estimate the association between circPTPRM expression and survival outcomes of our patients, and differences were estimated by the log‐rank test. The correlation analysis was determined using Pearson's correlation test. Statistical significance was set at p < 0.05.

RESULTS

CircPTPRM is overexpressed in PTC tissues and cells

Of note, the relative level of circPTPRM was significantly increased in PTC tissues as compared to the normal tissues (Figure 1A). Consistently, circPTPRM was also upregulated in several human PTC cell lines (Figure 1B). As shown in Figure 1C, circPTPRM was resistant to RNase R, whereas PTPRM mRNA was degraded by RNase R digestion, revealing the stability of circPTPRM. As demonstrated by Kaplan–Meier analysis, PTC patients with high circPTPRM expression had a poor overall survival (Figure 1D).
FIGURE 1

CircPTPRM is overexpressed in PTC tissues and cells. (A) The relative expression level of circPTPRM in 50 PTC tissues and paired paracancerous normal tissues. (B) The relative expression level of circPTPRM in normal thyroid Nthy‐ori 3–1 cell line and PTC cell lines. (C) The circular structure of circPTPRM was tested by RNase R assay in TPC‐1 and KAT‐5 cells. (D) Kaplan–Meier analysis showed PTC patients with high circPTPRM expression had a poor survival. Data are expressed as the mean ± SD. ** p < 0.01; *** p < 0.001 considered as significant.

CircPTPRM is overexpressed in PTC tissues and cells. (A) The relative expression level of circPTPRM in 50 PTC tissues and paired paracancerous normal tissues. (B) The relative expression level of circPTPRM in normal thyroid Nthy‐ori 3–1 cell line and PTC cell lines. (C) The circular structure of circPTPRM was tested by RNase R assay in TPC‐1 and KAT‐5 cells. (D) Kaplan–Meier analysis showed PTC patients with high circPTPRM expression had a poor survival. Data are expressed as the mean ± SD. ** p < 0.01; *** p < 0.001 considered as significant.

CircPTPRM knockdown restrains malignant phenotypes of PTC cells

CircPTPRM knockdown cell lines (TPC‐1 and KAT‐5 cells) were constructed to further analyze the oncogenic properties of circPTPRM. The downregulation efficiency of circPTPRM was confirmed via qRT‐PCR in these two cells, which showed the highest knockdown efficiency of siRNA#1 (Figure 2A). CCK‐8 assay showed that circPTPRM deficiency inhibited the cell viability of TPC‐1 and KAT‐5 cells (Figure 2B). Colony formation assay revealed that circPTPRM silencing markedly suppressed the colony formation ability of TPC‐1 and KAT‐5 cells (Figure 2C). Flow cytometry analyses found that circPTPRM depletion contributed to significant acceleration of apoptosis rate in TPC‐1 and KAT‐5 cells (Figure 2D). Wound healing and Transwell assays uncovered that circPTPRM interference reduced the abilities of migration (Figure 2E,F) and invasion (Figure 2G) which was also evidenced by increased level of E‐cadherin and downregulated expressions of N‐cadherin and Vimentin (Figure 2H,I). The changes of EMT markers were consistent with morphological alterations. As shown in Figure 2J, circPTPRM‐silencing cells displayed cobblestone‐like cell morphology, the typical features of epithelial cells, compared with the control cells which exhibited a mesenchymal phenotype with elongated shape and reduced cell–cell contact observed by inverted microscopy.
FIGURE 2

CircPTPRM knockdown restrains malignant phenotypes of PTC cells. (A) After circPTPRM inhibition in TPC‐1 and KAT‐5 cells, the transfection efficiency was analyzed via qRT‐PCR (A); cell viability was determined by CCK‐8 assay (B) and colony formation assay (C); cell apoptosis was analyzed by flow cytometry (D); cell migration and invasion capabilities were evaluated by wound healing (E) and Transwell assays (F,G); the protein levels of E‐cadherin, N‐cadherin and Vimentin were determined by western blot (H,I). (J) Micrographs of si‐NC‐transfected cells and circPTPRM‐silencing cells by light microscope (100× magnification). Data are expressed as the mean ± SD. ** p < 0.01; *** p < 0.001 considered as significant.

CircPTPRM knockdown restrains malignant phenotypes of PTC cells. (A) After circPTPRM inhibition in TPC‐1 and KAT‐5 cells, the transfection efficiency was analyzed via qRT‐PCR (A); cell viability was determined by CCK‐8 assay (B) and colony formation assay (C); cell apoptosis was analyzed by flow cytometry (D); cell migration and invasion capabilities were evaluated by wound healing (E) and Transwell assays (F,G); the protein levels of E‐cadherin, N‐cadherin and Vimentin were determined by western blot (H,I). (J) Micrographs of si‐NC‐transfected cells and circPTPRM‐silencing cells by light microscope (100× magnification). Data are expressed as the mean ± SD. ** p < 0.01; *** p < 0.001 considered as significant.

MiR‐885‐5p is downregulated in PTC and sponged by circPTPRM

Furthermore, predicted by CircInteractome (https://circinteractome.nia.nih.gov), circPTPRM might potentially interact with miR‐885‐5p through complementary base pairing (Figure 3A). The dual‐luciferase reporter assay showed that the luciferase activity of circPTPRM wild plasmids was notably restrained by upregulating miR‐885‐5p (Figure 3B). MiR‐885‐5p upregulation was achieved through the transfection of the miRNA mimic (Figure 3C). Additionally, the interaction of circPTPRM with miR‐885‐5p was verified by RNA pull‐down assay (Figure 3D). Figure 3E showed that miR‐885‐5p was upregulated by circPTPRM silencing. The downregulation of miR‐885‐5p was observed in tumor tissues (Figure 3F), and a negative association was shown between it and circPTPRM expression (Figure 3G).
FIGURE 3

MiR‐885‐5p is downregulated in PTC and sponged by circPTPRM. (A) Bioinformatics prediction database predicted the binding sites between circPTPRM and miR‐885‐5p; (B) MiR‐885‐5p mimic or miR‐NC was co‐transfected with the reporter vectors into TPC‐1 and KAT‐5 cells, and the relative luciferase activity was measured; (C) The transfection efficiency of miR‐885‐5p mimic was confirmed by qRT‐PCR; (D) RIP assay was performed in TPC‐1 and KAT‐5 cells to determine the binding condition between circPTPRM and miR‐885‐5p; (E) MiR‐885‐5p expression in response to circPTPRM knockdown; (F) qRT‐PCR was performed to examine miR‐885‐5p expression in 50 PTC tissues and paired adjacent normal tissues; (G) Pearson correlation analysis revealed a negative correlation between circPTPRM and miR‐885‐5p expression in PTC tissues. Data are expressed as the mean ± SD. *** p < 0.001 considered as significant.

MiR‐885‐5p is downregulated in PTC and sponged by circPTPRM. (A) Bioinformatics prediction database predicted the binding sites between circPTPRM and miR‐885‐5p; (B) MiR‐885‐5p mimic or miR‐NC was co‐transfected with the reporter vectors into TPC‐1 and KAT‐5 cells, and the relative luciferase activity was measured; (C) The transfection efficiency of miR‐885‐5p mimic was confirmed by qRT‐PCR; (D) RIP assay was performed in TPC‐1 and KAT‐5 cells to determine the binding condition between circPTPRM and miR‐885‐5p; (E) MiR‐885‐5p expression in response to circPTPRM knockdown; (F) qRT‐PCR was performed to examine miR‐885‐5p expression in 50 PTC tissues and paired adjacent normal tissues; (G) Pearson correlation analysis revealed a negative correlation between circPTPRM and miR‐885‐5p expression in PTC tissues. Data are expressed as the mean ± SD. *** p < 0.001 considered as significant.

CircPTPRM regulates DNMT3A expression by targeting miR‐885‐5p

The schematic illustration of miR‐885‐5p binding sites in DNMT3A 3′UTR was predicted by starBase V3.0 (https://starbase.sysu.edu.cn/; Figure 4A). The results of luciferase assay illustrated that miR‐885‐5p mimic led to the reduction of the luciferase activities of wt‐DNMT3A 3′‐UTR (Figure 4B). The DNMT3A mRNA and protein levels were declined upon miR‐885‐5p overexpression (Figure 4C,D). As demonstrated by qRT‐PCR, miR‐885‐5p could be silenced by the inhibitor of miR‐885‐5p (Figure 4E). DNMT3A expression at protein levels was inhibited by circPTPRM knockdown, which was restored by miR‐885‐5p inhibition (Figure 4F). The upregulated DNMT3A level was observed in PTC tissues (Figure 4G). DNMT3A mRNA was positively correlated with circPTPRM expression (Figure 4H), while negatively correlating with miR‐885‐5p expression in PTC tissues (Figure 4I).
FIGURE 4

CircPTPRM regulates DNMT3A expression by targeting miR‐885‐5p. (A) Bioinformatics prediction database predicted the binding sites between DNMT3A 3′UTR and miR‐885‐5p; (B) MiR‐885‐5p mimic or miR‐NC was co‐transfected with wild type and mutant type DNMT3A luciferase reporter plasmids into TPC‐1 and KAT‐5 cells, and the relative luciferase activity was measured; (C,D) The mRNA and protein levels of DNMT3A after miR‐885‐5p overexpression; (E) The transfection efficiency of miR‐885‐5p inhibitor was confirmed by qRT‐PCR; (F) DNMT3A protein levels after co‐knockdown of circPTPRM and miR‐885‐5p; (G) qRT‐PCR was performed to examine DNMT3A mRNA expression in 50 PTC tissues and paired adjacent normal tissues; (H) Pearson correlation analysis revealed a positive correlation between DNMT3A mRNA and circPTPRM expression in PTC tissues; (I) Pearson correlation analysis revealed a negative correlation between DNMT3A mRNA and miR‐885‐5p expression in PTC tissues. Data are expressed as the mean ± SD. **;## p < 0.01, ***;### p < 0.001 considered as significant.

CircPTPRM regulates DNMT3A expression by targeting miR‐885‐5p. (A) Bioinformatics prediction database predicted the binding sites between DNMT3A 3′UTR and miR‐885‐5p; (B) MiR‐885‐5p mimic or miR‐NC was co‐transfected with wild type and mutant type DNMT3A luciferase reporter plasmids into TPC‐1 and KAT‐5 cells, and the relative luciferase activity was measured; (C,D) The mRNA and protein levels of DNMT3A after miR‐885‐5p overexpression; (E) The transfection efficiency of miR‐885‐5p inhibitor was confirmed by qRT‐PCR; (F) DNMT3A protein levels after co‐knockdown of circPTPRM and miR‐885‐5p; (G) qRT‐PCR was performed to examine DNMT3A mRNA expression in 50 PTC tissues and paired adjacent normal tissues; (H) Pearson correlation analysis revealed a positive correlation between DNMT3A mRNA and circPTPRM expression in PTC tissues; (I) Pearson correlation analysis revealed a negative correlation between DNMT3A mRNA and miR‐885‐5p expression in PTC tissues. Data are expressed as the mean ± SD. **;## p < 0.01, ***;### p < 0.001 considered as significant.

CircPTPRM aggravates PTC cell malignant phenotypes by regulating miR‐885‐5p/DNMT3A signaling axis

DNMT3A was successfully overexpressed using the overexpression vector, as confirmed by western blotting (Figure 5A). The downregulation of circPTPRM resulted in the knockdown of DNMT3A protein levels, while DNMT3A overexpression overturned this effect (Figure 5B). Moreover, circPTPRM siRNA‐induced suppressive effects on cell viability (Figure 5C), migratory ability (Figure 5D) and invasive capability (Figure 5E) could be effectively relieved by the enforced expression of DNMT3A. Besides, DNMT3A overexpression abrogated the impact of circPTPRM siRNA on the changes of EMT markers (Figure 5F,G).
FIGURE 5

CircPTPRM aggravates PTC cell malignant phenotypes by regulating miR‐885‐5p/DNMT3A signaling axis. (A) The transfection efficiency of DNMT3A overexpression vector was confirmed by western blotting; After circPTPRM knockdown and/or DNMT3A overexpression, DNMT3A protein levels were determined by western blot (B); cell viability was determined by CCK‐8 assay (C); the migratory and invasion capabilities of TPC‐1 and KTC‐1 cells were evaluated by Transwell assays (D and E); the protein levels of E‐cadherin, N‐cadherin, and Vimentin were determined by western blot (F,G). Data are expressed as the mean ± SD. # p < 0.05, **;## p < 0.01, ***;### p < 0.001 considered as significant.

CircPTPRM aggravates PTC cell malignant phenotypes by regulating miR‐885‐5p/DNMT3A signaling axis. (A) The transfection efficiency of DNMT3A overexpression vector was confirmed by western blotting; After circPTPRM knockdown and/or DNMT3A overexpression, DNMT3A protein levels were determined by western blot (B); cell viability was determined by CCK‐8 assay (C); the migratory and invasion capabilities of TPC‐1 and KTC‐1 cells were evaluated by Transwell assays (D and E); the protein levels of E‐cadherin, N‐cadherin, and Vimentin were determined by western blot (F,G). Data are expressed as the mean ± SD. # p < 0.05, **;## p < 0.01, ***;### p < 0.001 considered as significant.

DISCUSSION

The implication of circRNAs has been clarified in the development of diverse malignancies, including PTC. For instance, circ_0039411 is overexpressed in PTC tissues, and circ_0039411 decoys miR‐423‐5p, upregulates the expression of SOX4, and promotes CRC cell proliferation, migration, invasion, and glycolysis. Circ_0067934 expression is augmented in PTC tissues, and circ_0067934 works as an oncogene in CRC by modulating miR‐1301‐3p/HMGB1 axis. CircNRIP1 expedites the proliferation, invasion, and tumor growth in PTC by sponging miR‐195‐5p and regulating p38 MAPK and JAK/STAT signaling pathways. Luo et al found aberrant overexpression of circPTPRM in HCC tissues and cells, and its expression was associated with the pathological metastasis, recurrence, and survival; circPTPRM may function as an oncogene during the tumorigenesis of HCC. However, there are few reports on the role of circPTPRM in other malignant tumors. Corresponding to the previous study, circPTPRM was uncovered to be an overexpressed circRNA in PTC. In our work, high expression of circPTPRM indicated the unfavorable prognosis. Additionally, functional assays revealed that circPTPRM silencing impeded PTC cell malignant phenotypes. These findings suggest that circPTPRM exerted oncogenic properties in PTC, which might be a potential therapeutic target for PTC. Multiple miRNAs have been reported to participate in PTC progression. For example, miR‐181a was upregulated in PTC tissues, which could upregulate S100A2 expression by targeting KDM5C to facilitate PTC progression. MiR‐613 was underexpressed in PTC tissues and cells, and the inhibition of PTC progression was associated with miR‐613 overexpression by directly targeting TAGLN2. In this work, circPTPRM was validated to have binding sites with miR‐885‐5p. Given that circRNA could act as miRNAs sponge to promote the development of cancers, , , we presumed that circPTPRM might contribute to PTC progression by interacting with miR‐885‐5p that has been reported to restrain the progression of hepatocellular carcinoma (HCC), cholangiocarcinoma, and gastric cancer. The anti‐tumor role of miR‐885‐5p was also verified in PTC development. Further functional studies showed that circPTPRM serves as a miR‐885‐5p sponge to promote PTC progression. DNMT3A is a widely reported DNA methyltransferase and plays a pivotal role in DNA methylation modification and epigenetic regulation. , In recent years, studies have shown that DNMT3A is ubiquitously underexpressed in various normal tissues, but abnormally upregulated in various tumor tissues, including PTC tumor tissues, participating in the malignant process of PTC. , In the current work, DNMT3A was identified the direct target of miR‐885‐5p, and their expression was negatively correlated in PTC tissues. Furthermore, a novel integrated circPTPRM/miR‐885‐5p pathway showed the regulatory effects on DNMT3A. Meanwhile, circPTPRM may aggravate PTC carcinogenesis via the regulation of miR‐885‐5p/DNMT3A signal axis. Taken together, we concluded that circPTPRM may exert as a novel oncogenic circRNA in PTC cells in vitro by regulating the miR‐885‐5p/DNMT3A pathway and thus affecting the proliferation, migration, and invasion. However, the lack of larger cohort is one of the limitation of the present study. Furthermore, the in vivo pro‐tumor effect of circPTPRM deserves further investigation.

CONFLICT OF INTEREST

The authors state that there are no conflicts of interest to disclose.
  31 in total

Review 1.  Evolving Understanding of the Epidemiology of Thyroid Cancer.

Authors:  Carolyn Dacey Seib; Julie Ann Sosa
Journal:  Endocrinol Metab Clin North Am       Date:  2018-12-23       Impact factor: 4.741

2.  MiR-146b-5p Regulates the Expression of Long Noncoding RNA MALAT1 and Its Effect on the Invasion and Proliferation of Papillary Thyroid Cancer.

Authors:  You Peng; Xiang Fang; Hongli Yao; Yu Zhang; Jingjing Shi
Journal:  Cancer Biother Radiopharm       Date:  2020-04-24       Impact factor: 3.099

3.  CircRNA in cancer: Fundamental mechanism and clinical potential.

Authors:  Liang Chen; Ge Shan
Journal:  Cancer Lett       Date:  2021-02-18       Impact factor: 8.679

4.  miR-885-5p Inhibits Invasion and Metastasis in Gastric Cancer by Targeting Malic Enzyme 1.

Authors:  Zhaoyu Jiang; Huaiping Cui; Shujie Zeng; Leping Li
Journal:  DNA Cell Biol       Date:  2021-03-22       Impact factor: 3.311

Review 5.  Updates on the Management of Thyroid Cancer.

Authors:  Katherine A Araque; Sriram Gubbi; Joanna Klubo-Gwiezdzinska
Journal:  Horm Metab Res       Date:  2020-02-10       Impact factor: 2.936

6.  CircPTPRM accelerates malignancy of papillary thyroid cancer via miR-885-5p/DNMT3A axis.

Authors:  Daping Chen; Xijiao Jiang; Huizhou Luo; Qingquan Hua; Farong Zhang
Journal:  J Clin Lab Anal       Date:  2022-09-13       Impact factor: 3.124

7.  Structural basis for DNMT3A-mediated de novo DNA methylation.

Authors:  Zhi-Min Zhang; Rui Lu; Pengcheng Wang; Yang Yu; Dongliang Chen; Linfeng Gao; Shuo Liu; Debin Ji; Scott B Rothbart; Yinsheng Wang; Gang Greg Wang; Jikui Song
Journal:  Nature       Date:  2018-02-07       Impact factor: 49.962

8.  Hsa_circRNA_102002 facilitates metastasis of papillary thyroid cancer through regulating miR-488-3p/HAS2 axis.

Authors:  Wei Zhang; Ting Liu; Tianshu Li; Xudong Zhao
Journal:  Cancer Gene Ther       Date:  2020-08-29       Impact factor: 5.987

9.  Construction of circRNA-based ceRNA network and its prognosis-associated subnet of clear cell renal cell carcinoma.

Authors:  Yuwei Zhang; Yuchen Zhang; Yangkun Feng; Nan Zhang; Saisai Chen; Chaoqun Gu; Lei Hu; Jiayi Sheng; Bin Xu; Ninghan Feng
Journal:  Cancer Med       Date:  2021-09-27       Impact factor: 4.452

View more
  1 in total

1.  CircPTPRM accelerates malignancy of papillary thyroid cancer via miR-885-5p/DNMT3A axis.

Authors:  Daping Chen; Xijiao Jiang; Huizhou Luo; Qingquan Hua; Farong Zhang
Journal:  J Clin Lab Anal       Date:  2022-09-13       Impact factor: 3.124

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.