Phenotype, genotype, and mating type determination in oral Candida albicans isolates from pediatric patients with neutropenia.

BACKGROUND: The most frequent species of Candida to infect and colonize patients with neutropenia is still Candida albicans. This study aimed to provide detailed information on the phenotype, genotype, and mating type of oral C. albicans isolated from neutropenic pediatric patients, and to investigate how these characteristics are related.
METHODS: Two hundred fifty-four oral samples from patients under 18 years old with neutropenia and malignancies were collected from January to October 2021. Samples were cultured on CHROMagar Candida. Isolates of C. albicans were identified with the germ tube test, chlamydospore production on cornmeal agar, and PCR-RFLP. Genotyping of C. albicans isolates was carried out by amplifying the 25S rDNA gene with specific CAINT-L and CA-INT-R primers. MTLa1 and MTLα1 primers were used to identify each mating type. Yeast peptone dextrose supplemented with phloxine B was used to identify different phenotypes.
RESULTS: Ninety-two (36%) patients were positive for C. albicans. The mean age of patients was 7.85. Fifty-three (58.9%) isolates demonstrated type A, 15 (16.7%) type B, 15 (16.7%) types D/E, and 7 (7.7%) type C. Three isolates each (3.3%) were homozygous for MTLa or homozygous for MTLα. All of the MTL-homozygous isolates were genotype A. There was a significant correlation between patients' underlying disease and genotype (p = 0.036). There was a significant correlation between mating type and genotype (p = 0.000).
CONCLUSION: Most of the isolates exhibited a white phenotype, noted in the literature as the most virulent. Moreover, heterozygous strains were frequent and may play a role in Candida colonization.

INTRODUCTION

Children with neutropenia and malignancies are at an increased risk of developing oral candidiasis, which may lead to systemic infections. Candida albicans is still the most common Candida species infecting and colonizing neutropenic patients, , and has pathogenic potential for disseminated infection in immunocompetent hosts. As part of the normal human flora it is generally harmless, but in immunosuppressed individuals it can cause serious diseases. Radiation, bone marrow failure, chemotherapy, and hematopoietic cell replacement by malignant cells in the bone marrow are potential causes of neutropenia. , In patients with acute neutropenia and leukemia, the digestive tract serves as the primary entry point for Candida species. The natural anatomical barriers may be damaged, allowing Candida to enter the bloodstream. In these persons, Candida infections can manifest as esophagitis, oropharyngeal candidiasis, candidemia, and acute or chronic disseminated candidiasis. , ,

There are several methods for typing C. albicans such as microsatellite length polymorphism and multilocus sequence typing. Another approach is based on 25S ribosomal DNA (rDNA). This method is based on sequence variation of the transcribed spacer locus (25S rRNA gene) described by McCullough et al., which can be used to categorize different strains into five types (A, B, C, D, and E). Phenotypic switching and biofilm formation are one of the virulence factors of C. albicans. , The white‐opaque switch affects the morphology, configuration of gene expression, physiology, and virulence of C. albicans. Correspondingly, it has been confirmed that a variety of virulence features differ between cells in the two phases. , It was reported that strains causing deep tissue fungal infections switch at higher frequencies, on average, than strains causing superficial infections.

Most natural C. albicans isolates are heterozygous for the mating‐type locus. Heterozygous strains are not able to mate. , , , Homozygous strains can undergo mating and switch from the white to the opaque phenotype. , , Earlier studies suggested that MTL‐homozygous strains may take part in colonization. , One study demonstrated that C. albicans strains capable of mating exist naturally in patients, and the authors proposed that mating may play a role in the appearance of diversity in this lethal pathogen. Although our understanding of how these features contribute to infection has increased significantly in recent years, further studies are necessary in this area to shed light on some unanswered questions. Is there any relationship between phenotype switching and genotype, or between genotype and mating type in clinical isolates? The present study aimed to provide detailed information on the phenotype, genotype, and mating type of oral C. albicans isolated from neutropenic pediatric patients with neutropenia, and to investigate how these characteristics are related.

MATERIALS AND METHODS

The Ethics Committee of Ahvaz Jundishapur University of Medical Sciences approved this project under reference no. IR.AJUMS.MEDICINE.REC. 1399.037. Moreover, all researchers involved in the study complied with the current version of the World Medical Association's Declaration of Helsinki in accordance with the January 1997 Note for Guidance on Good Clinical Practice (CPMP/ICH/135/95).

Samples and identification

Two hundred fifty‐four oral samples from patients under 18 years old with neutropenia and malignancies were collected from January to October 2021. Samples were cultured on CHROMagar Candida (CHROMagar, France), and positive cultures were purified on Sabouraud dextrose agar (Liofilchem). Candida albicans isolates were identified with the germ tube test, chlamydospore production on cornmeal agar (HIMEDIA, India) supplemented with Tween 80 (Merck, Germany), growth at 43°C and PCR‐RFLP according to Mirhendi et al. using ITS1 and ITS4 primers.

DNA was extracted according to Look et al. One or two fresh purified colonies were transferred to a tube containing 100 μl 0.2 M lithium acetate (Central Drug House) and 1% SDS (CinnaGen). Each tube was incubated for 5 min in a 70°C water bath. Then absolute ethanol was added and each tube was gently vortexed. The tubes were centrifuged for 2 min at 18,000 g, after which the supernatants were discarded. Then 300 μl 70% ethanol was added to the pellet and the tubes were centrifuged at 18,000 g for 2 min. The supernatant was removed, and tubes were air‐dried at room temperature. Then 100 μl sterile distilled water was added to each tube, and the tubes were gently vortexed and centrifuged for 2 min at 18,000 g. Lastly, the supernatant containing DNA was transferred to a new tube and stored at 20°C.

ABC genotyping

Genotyping of C. albicans isolates was carried out by amplifying the 25S rDNA gene with specific primers CAINT‐L (5′‐ATAAGGGAAGTCGGCAAAATAGATCCGTAA‐3′) and CA‐INT‐R (5′‐CCTTGGCTGTGGTTTCGCTAGATAGTAGAT‐3′) 13. Briefly, Taq DNA Polymerase 2× Master Mix RED with 1.5 mM MgCl2 (Ampliqon), 0.5 μM of each primer, and 2 μl genomic DNA in a total volume of 25 μl. PCR products were amplified under the following conditions: 97°C for 7 min, 35 cycles at 94°C for 30 s, 60°C for 30 s, 72°C for 40 s, and 72°C for 5 min as the final extension. The PCR products were visualized on 1.5% agarose gel. A 450 bp band represented type A, 840 bp type B, 450 and 840 bp type C, 1040 bp type D, and 1080 bp type E. Types D and E correspond to C. dubliniensis.

Mating type

MTLa1 (forward: 5′‐TAAGAATGAAGACAACGAGG‐3′ and reverse: 5′‐CGTGTTTTTCTGCTATCAATTCC‐3′) and MTLα1 (forward: 5′‐TACATTCTGGTCGCGATGCTC and reverse: 5′‐GTAATCCAA AGCCTCGCATAA‐3′) primers were used to identify the mating type of each isolate. Multiplex PCR assays were carried out with 1× Taq DNA Polymerase 2× Master Mix RED 1.5 mM MgCl2 (Ampliqon, Denmark), 0.5 μM of each primer, and 3 μl genomic DNA in a total volume of 25 μl. PCR products were amplified under the following conditions: 94°C for 10 min, 30 cycles at 94°C for 60 s, 57°C for 45 s, 72°C for 45 s, and 72°C for 7 min as the final extension. The PCR products were visualized on 1.5% agarose gel. A 535 bp band represented type a, and a 423 bp band represented type α. Heterozygous strains exhibited both bands.

Phenotyping on phloxine B medium

Yeast peptone dextrose (YPD) agar containing 20 g glucose (PanReac), 10 g yeast extract (Merck), 20 g peptone (Difco), and 10 g agar (Conda) supplemented with 5 mg/L phloxine B was used to determine the phenotype of each isolate (Merck). Fresh yeast cells were diluted in sterile distilled water and spread at a density of 30–50 CFU/ml on YPD agar plates, which were thenincubated at 30°C for 4–5 days.

Statistical analysis

The data were analyzed with SPSS software version. Descriptive statistics and chi‐squared tests were used to summarize the results. The findings were considered statistically significant at the p < 0.05 level.

RESULTS

A total of 254 oral samples were collected, and 92 (36%) patients were positive for C. albicans. Also, 52 non‐Candida albicans isolates were identified including 10 C. glabrata, 10 C. parapsilosis complex, 8 C. kefyr, 7 C. tropicalis, 7 C. krusei and 10 isolates of other species. The mean age of patients was 7.85 years, and the age range was 1–18 years. Also, 56.5% of patients were male and 40% were female. The most common underlying conditions among patients with positive culture for C. albicans were acute lymphoblastic leukemia (30.93%), brain tumor (8.25%), Ewing sarcoma (6.19%), anemia (6.19%), rhabdomyosarcoma (5.15%), immune thrombocytopenia (ITP) (4.12%), Burkitt lymphoma (4.12%), Wilms tumor (4.12%), acute myeloid leukemia (4.12%), neuroblastoma (3.09%), lymphoma (3.09%), Hodgkin's lymphoma (3.09%), sarcoma (3.09%), tumor (3.09%), medulloblastoma (2.07%), abdominal mass (2.07%), osteosarcoma (2.07%), germcell tumor (1.03%), lymphoblastic lymphoma (1.03%), thrombocytopenia (1.03%), pancytopenia (1.03%) and paroxysmal nocturnal hemoglobinuria (PNH) (1.03%).

Ninety‐two positive cultures for C. albicans complex were detected. Fifty‐three isolates demonstrated type A, 15 type B, 15 types D/E, and 7 type C (Table 1 and Figure 1). In two isolates amplification was not successful, and these samples were excluded from the study. The frequency of each phenotype according to color (Figure 2) and shape (Figure 3) among different genotypes is shown in Tables 2 and 3. Most of the C. albicans isolates were MTL‐heterozygous (69, 92%). Three isolates (4%) were homozygous for MTLa and 3 isolates (4%) were homozygous for MTLα. All MTL‐ homozygous isolates were genotype A. There was no significant correlation between the mating type and phenotype (p = 0.310). Also, there was no significant correlation between patients' underlying disease and mating type (p = 0.452). There was a significant correlation between patients' underlying disease and genotype (p = 0.036). There was a significant correlation between mating type and genotype (p = 0.000).

TABLE 1

Phenotypic characteristics of each genotype

Genotype	Color in CHROMagar	Germ tube test	Chlamydospore production	Growth at 43°C
A (53/58.9%)	Green	Positive	Positive	Positive
B (15/16.7%)	Green	Positive	Positive	Positive
C (7/7.7%)	Green	Positive	Positive	Positive
D/E (15/16.7%)	Green	Positive	Positive	Negative

FIGURE 1

Genotyping of Candida albicans isolates. Lane 1: type A (450 bp), lane 2: type B (840 bp), lane 3: type C (450 and 840 bp), lane 4: type D/E (1040 bp)

FIGURE 2

Different phenotypes observed according to colony color

FIGURE 3

Different phenotypes observed according to colony shape. (A) Smooth colonies, (B) Irregular colonies, (C) Stippled colonies, (D) Fuzzy colonies

TABLE 2

Incidence of each phenotype according to colony color in different genotypes

Colony color	ABC genotype				Total
	A	B	C	D/E
White & Gray	24	6	3	4	37
Gray	8	4	1	6	19
White	10	2	2	1	15
White & Gray & Pink	6	2	1	2	11
White & Pink	3	1	0	0	4
Pink & Gray	2	0	0	2	4
Total	53	15	7	15	90

TABLE 3

Incidence of each phenotype according to colony shape in different genotypes

Colony shape	ABC genotype				Total
	A	B	C	D/E
Smooth	32	10	4	11	57
Stippled	0	0	0	1	1
Fuzzy	0	0	0	1	1
Smooth & Irregular	21	5	3	2	31
Total	53	15	7	15	90

DISCUSSION

Children are more likely than adults to develop oral difficulties such as dry mouth, bleeding, oral mucositis, and infections due to chemotherapy and radiotherapy. Oral health is severely impaired by cancer and cancer therapy. Oral candidiasis is a problem because it can lead to systemic infection, which may be life‐threatening in pediatric patients. , Preventative prophylaxis before starting chemotherapy can help to reduce the incidence of oral candidiasis in children with cancer. In the present study, we examined 254 oral swabs and 36% of them were positive for C. albicans. Badiee et al. examined 118 patients and found a prevalence of C. albicans in oral samples of 44.9%. González et al. reported 69.35% of their patients were positive for oral candidiasis with C. albicans. Also, Aslani et al. isolated 162 yeasts and yeast‐like fungi from oral samples of adult patients with cancer, and C. albicans was reported as the most frequent isolate (50.6%). Candida albicans is still the most common yeast isolated in the oral cavity of patients with cancer, and may lead to more serious infections.

Kinifar and coworkers studied C. albicans strains isolated from healthy individuals. In consonance with our results, genotype A was the frequent genotype (41.7%) but the frequency rate was higher in children with neutropenia (57.6%). These results were also in line with our previous study in patients with esophageal candidiasis. However, genotype A was the most prevalent type in oral isolates or strains related to the gastrointestinal tract. Regarding other genotypes, Kinifar et al. found higher frequencies of genotypes C (34%) and B (20.4%). In contrast, the frequency of genotype D was higher in the present study (16.7%). Sardi et al. reported genotype B (51.6%) as the major genotype, and Gharaghani et al. reported genotype C (83.5%) as the predominant genotype in vulvovaginal samples. Also, about 16% of isolates in the present study were genotype B. Chaves et al. stated that C. albicans isolates with genotype B have a high propensity to cause invasive infections. These infections may increase the mortality rate in immunocompromised children. Rosca et al. studied isolates from various clinical samples and did not find any significant correlation between the genotype and the site of infection. We observed a significant correlation between patients' underlying disease and genotype (p = 0.036). This finding may be related to the specific treatment procedure or the disease, but due to the low frequency of some underlying diseases and genotypes, additional studies are required.

Candida albicans is one of the most adaptable organisms, with the ability to switch between morphological phenotypes in response to environmental stimuli, which is critical for its survival as a commensal or pathogenic organism. , It is a diploid organism. Homozygosity and heterozygosity were investigated in genes like hyphal wall protein 1 gene locus (hwp1) previously and no significant statistical differences in virulence factors between the homozygous and heterozygous strains were reported. In the present study, 70% of isolates exhibited the white phenotype (pure or in combination with other colonies), which may be more virulent according to research by Tao et al. They reported white colonies to be more virulent than gray and opaque phenotypes. Moreover, switching between the white phenotype and the opaque phenotype is required for the yeast to mate. Previously, it was assumed that only MTL‐homozygous strains could switch to the opaque phenotype. Xie et al. demonstrated that about one‐third of heterozygous strains isolated from hosts underwent white‐opaque switching at low frequencies when cultured on medium containing N‐acetylglucosamine (25°C and 5% CO2). These strains play an important role in colonization. Most of the strains isolated in the present study were heterozygous, although it should be recalled that harmless colonized isolates can turn into dangerous pathogens in susceptible hosts. In this connection, Kvaal et al. showed that homozygous strains that switched to the opaque form can affect the ability to colonize skin; this change may play a role in transmission from patients' skin to healthcare workers, and subsequently to immunocompromised patients. Norma et al. reported that mating rarely occurred during oropharyngeal candidiasis in immunosuppressed mice. Ramirez‐Zavala et al. found that white‐opaque switching can be induced in the mouse gastrointestinal tract. In a related outcome, we found a significant correlation between mating type and genotype (p = 0.000). This relationship may be due to the lower frequency of some types, and further research is thus needed.

In summary, we observed a significant correlation between patients' underlying disease and C. albicans genotype. A higher frequency of genotype D was observed in pediatric patients with neutropenia. Most of the isolates exhibited the white phenotype, which has been suggested to be the most virulent phenotype in earlier research. Moreover, heterozygous strains were highly frequent, and may play a role in Candida colonization and transmission.

We note important limitations in this study arising from the Covid‐19 pandemic. Nonetheless, we recommend further research into the relationships between mating type and virulence factors in C. albicans isolates.

AUTHOR CONTRIBUTIONS

AZM, AAA, AKH: Study design, supervision, data interpretation, and manuscript editing. HJ: Experimentation, data collection, analysis, literature search, and manuscript writing. MG: Experimentation, data collection, analysis.

CONFLICT OF INTEREST

The authors state that there is no competitive concern of any nature with this manuscript.

INFORMED CONSENT

Informed consent was obtained from all individual participants included in the study.