| Literature DB >> 36072855 |
Shiyou Chen1, Yan Lin2,3, Hequn Shi4, Linghong Miao1,2, Bo Liu1,2, Xianping Ge1,2.
Abstract
The present study explored the effects of ferulic acid (FA) supplementation in cottonseed meal (CSM)-based diets on grass carp growth performance, feed utilization, liver antioxidation status, and intestinal physical barrier function. Here, four experimental diets supplemented with FA at graded levels (0, 50, 100 and 200 mg/kg) and CSM as the main protein source (384.6 g/kg feed) for an 8-week feeding trial. Our results indicated that 200 mg/kg FA supplementation in a CSM-based diet significantly improved growth performance [including final body weight (FBW), weight gain rate, and specific growth rate] and feed utilization [including feed conversion ratio and protein efficiency ratio] in grass carp (p < 0.05). The results of polynomial regression analysis based on FBW recommended that the optimal dose for FA supplementation was 204 mg/kg. Compared with that no FA supplementation, 200 mg/kg FA supplementation significantly reduced liver malondialdehyde levels and increased glutathione reductase activities (p < 0.05) and 100 mg/kg FA supplementation significantly increased liver total superoxide dismutase activities and reduced blood alanine transaminase levels (p < 0.05). Compared with the control group, 100 mg/kg FA supplementation also led to significantly increased mRNA expression of zo-1, zo-2, occludin, claudin-b, claudin-3, claudin-7a, and claudin-12, encoding intestinal tight junction proteins (p < 0.05). Notably, FA supplementation could reduce lipid deposition by regulating bile acid (BA) secretion. In this study, 100 and 200 mg/kg FA supplementation significantly increased blood and liver total BA levels, respectively (p < 0.05); 100 mg/kg FA also significantly activated mRNA expressions of fxr and cyp7a1 (p < 0.05). Furthermore, the whole-body composition results presented that FA treatment relieved lipid deposition, particularly 50 and 200 mg/kg FA supplementation (p < 0.05). Moreover, triglyceride and total cholesterol levels were significantly lower and high-density lipoprotein levels were significantly higher with 200 mg/kg FA supplementation than with no FA supplementation (p < 0.05). Taken together, the results indicated that FA may be a beneficial feed additive to boost fish growth performance and increase CSM utilization.Entities:
Keywords: antioxidation; cottonseed meal; ferulic acid; grass carp; growth performance; tight junction
Year: 2022 PMID: 36072855 PMCID: PMC9441557 DOI: 10.3389/fphys.2022.922037
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
FIGURE 1Molecular structure of ferulic acid.
Ingredient and nutrient composition of experimental diets.
| Ingredient | Diets (g dry matter) | |||
|---|---|---|---|---|
| Control | FA (50) | FA (100) | FA (200) | |
| Fish meal | 53.3 | 53.3 | 53.3 | 53.3 |
| Soybean meal | 64.8 | 64.8 | 64.8 | 64.8 |
| Cottonseed meal | 384.6 | 384.6 | 384.6 | 384.6 |
| Cottonseed protein concentrate | 84.5 | 84.5 | 84.5 | 84.5 |
| Wheat flour | 177.2 | 177.2 | 177.2 | 177.2 |
| Rice bran | 120.1 | 120.1 | 120.1 | 120.1 |
| Wheat bran | 49.5 | 49.5 | 49.5 | 49.5 |
| Soybean oil | 20 | 20 | 20 | 20 |
| Calcium dihydrogen phosphate | 10 | 10 | 10 | 10 |
| Mineral premix | 5 | 5 | 5 | 5 |
| Vitamins premix | 5 | 5 | 5 | 5 |
| Vitamin C (95%) | 5 | 5 | 5 | 5 |
| Choline chloride | 5 | 5 | 5 | 5 |
| Microcrystalline cellulose | 10 | 9.95 | 9.9 | 9.8 |
| Bentonite | 6 | 6 | 6 | 6 |
| Ferulic acid | 0 | 0.05 | 0.1 | 0.2 |
| Total | 1,000 | 1,000 | 1,000 | 1,000 |
| Nutrient contents (dry matter) | ||||
| Crude protein (%) | 39.67 | 39.52 | 39.44 | 39.65 |
| Crude lipid (%) | 7.24 | 6.97 | 6.65 | 6.83 |
| Ash (%) | 8.66 | 8.70 | 9.01 | 8.75 |
| Gross energy (MJ/kg) | 19.60 | 19.80 | 19.70 | 19.71 |
| Free gossypol (mg/kg) | 406.20 | 398.16 | 417.94 | 406.81 |
Note: The crude protein of fish meal, soybean meal, cottonseed meal, cottonseed protein concentrate used in the study was 69.5%, 46.37%, 55.6%, and 61.5%, respectively. Meanwhile, the crude lipid of these protein source was 9.46%, 4.25%, 4.49%, and 2.36%, respectively. Nearly 1,275 mg/kg free gossypol was detected in the cottonseed meal.
Mineral premix (IU, g or mg/kg of diet): calcium biphosphate, 20 g; sodium chloride, 2.6 g; potassium chloride, 5 g; magnesium sulfate, 2 g; ferrous sulfate, 0.9 g; zinc sulfate, 0.06 g; cupric sulfate, 0.02 g; manganese sulfate, 0.03 g; sodium selenate, 0.02 g; cobalt chloride, 0.05 g; potassium iodide, 0.004 g
Vitamins premix (IU, g or mg/kg of diet): vitamin A, 25,000 IU; vitamin D3, 20,000 IU; vitamin E, 200 mg; vitamin K3, 20 mg; thiamin, 40 mg; riboflavin, 50 mg; calcium pantothenate, 100 mg; pyridoxine HCl, 40 mg; cyanocobalamin, 0.2 mg; biotin, 6 mg; folic acid, 20 mg; niacin, 200 mg; inositol, 1,000 mg; vitamin C, 2000 mg; choline, 2000 mg.
All are measured values.
RT-qPCR primers used for relative mRNA expression analyses.
| Gene name | Sequences (5′→3′) | GenBank no. | References |
|---|---|---|---|
|
| F: GCAGAGTGCCTGCTTACAGA | KT861862 | |
| R: GAGCAGTGCGTGTTGTCTTG | |||
|
| F: TCTATGACAATCCTCTGGCATACAA | KT831860 | |
| R: CAAAGAAACGGCCCGGACA | |||
|
| F: CGGTGTCTTCGTAGTCGG | KJ000055 |
|
| R: CAGTTGGTTTGGGTTTCAG | |||
|
| F: TACAGCGGGACTCTAAAATGG | KM112095 |
|
| R: TCACACGGTCGTTCTCAAAG | |||
|
| F: ACTGTGAGGTGCTTGGAA | KY780630 |
|
| R: CTGTTGTGACTGAAGAAGGA | |||
|
| F: TATCTGTATCACTACTGCGTCG | KF193855 |
|
| R: CATTCACCCAATCCTCCA | |||
|
| F: GAGGGAATCTGGATGAGC | KF193860 |
|
| R: ATGGCAATGATGGTGAGA | |||
|
| F: GAGGGAATCTGGATGAGC | KF193859 |
|
| R: CTGTTATGAAAGCGGCAC | |||
|
| F: ATCACTCGGGACTTCTA | KF193858 |
|
| R: CAGCAAACCCAATGTAG | |||
|
| F: ACTTACCAGGGACTGTGGATGT | KT625604 |
|
| R: CACTATCATCAAAGCACGGGT | |||
|
| F: CCCTGAAGTGCCCACAA | KF998571 |
|
| R: GCGTATGTCACGGGAGAA | |||
|
| F: TGCTTTATTTCTTGGCTTTC | KF193857 |
|
| R: CTCGTACAGGGTTGAGGTG | |||
|
| F: GGCTGTGCTGTCCCTGTA | M25013 |
|
| R: GGGCATAACCCTCGTAGAT |
Note: Reverse transcription quantitative PCR (RT-qPCR), forward primer (F), reverse primer (R), farnesoid X receptor (fxr), cholesterol 7α-hydroxylase (cyp7a1), zonula occludens-1/2 (zo-1/2), junctional adhesion molecule-A (jam-a).
Growth performance of juvenile grass carp fed diets containing graded levels of FA.
| Growth performance | Groups | |||
|---|---|---|---|---|
| Control | FA (50) | FA (100) | FA (200) | |
| FBW (g/fish) | 18.71 ± 0.40a | 19.95 ± 0.38ab | 19.74 ± 0.27ab | 20.51 ± 0.59b |
| WGR (%) | 274.27 ± 7.97a | 299.07 ± 7.67ab | 294.8 ± 5.47ab | 310.18 ± 11.82b |
| SGR (% day −1) | 2.27 ± 0.04a | 2.39 ± 0.03ab | 2.37 ± 0.02ab | 2.43 ± 0.05b |
| FCR | 1.66 ± 0.05b | 1.55 ± 0.03ab | 1.55 ± 0.05ab | 1.46 ± 0.05a |
| PER | 1.52 ± 0.04a | 1.63 ± 0.03ab | 1.64 ± 0.05ab | 1.73 ± 0.07b |
| SR (%) | 100.00 ± 0.00 | 98.89 ± 1.11 | 100.00 ± 0.00 | 100.00 ± 0.00 |
Note: All data presented as means of three replicates ±standard error of the means. Means in the same row with different superscripts are significantly different (p < 0.05).
FBW: final body weight.
Weight gain rate (WGR): = 100 × [(FBW (g) − initial body weight (g))/initial body weight (g)].
Specific growth rate (SGR): = 100 × [(In (FBW (g)) − In (initial body weight (g)))/days].
Feed conversion ratio (FCR): = dry feed fed (g)/(FBW (g) − initial body weight (g)).
Protein efficiency ratio (PER) = (FBW (g) − initial body weight (g))/protein consumption (g).
Survival rate (SR): = 100 × (final fish number/initial fish number).
FIGURE 2Quadratic regression analysis of dietary ferulic acid levels versus final body weight in juvenile grass carp.
Whole-body composition of juvenile grass carp fed diets containing graded levels of FA.
| Whole-body composition | Groups | |||
|---|---|---|---|---|
| Control | FA (50) | FA (100) | FA (200) | |
| Moisture (%) | 73.62 ± 0.27 | 73.86 ± 0.87 | 73.65 ± 0.46 | 73.69 ± 0.15 |
| Crude protein (%) | 14.92 ± 0.31 | 15.37 ± 0.57 | 14.66 ± 0.33 | 15.22 ± 0.16 |
| Lipid (%) | 9.14 ± 0.21b | 8.22 ± 0.40a | 8.83 ± 0.02ab | 8.26 ± 0.10a |
| Ash (%) | 2.69 ± 0.09 | 2.71 ± 0.05 | 2.76 ± 0.19 | 2.68 ± 0.12 |
Note: All data presented as means of three replicates ±standard error of the means. Means in the same row with different superscripts are significantly different (p < 0.05).
FIGURE 3Blood biochemical parameters including triglyceride (TG; (A), low-density lipoprotein (LDL; (B), total cholesterol (TC; (C), and high-density lipoprotein (HDL; (D) in grass carp fed CSM-based diets containing graded levels of ferulic acid. Control: high CSM diet; FA (50): high CSM diet +50 mg/kg ferulic acid; FA (100): high CSM diet +100 mg/kg ferulic acid; FA (200): high CSM diet +200 mg/kg ferulic acid. The results are expressed as means ± standard error of the means (n = 9). Means of the same parameter with different superscripts are significantly different (p < 0.05).
Indicators reflecting liver antioxidant capacities and liver health in juvenile grass carp fed diets containing graded levels of FA.
| Items | Groups | |||
|---|---|---|---|---|
| Control | FA (50) | FA (100) | FA (200) | |
| In liver | ||||
| MDA (nmol/mgprot) | 1.15 ± 0.15b | 0.62 ± 0.06a | 1.14 ± 0.29b | 0.58 ± 0.11a |
| T-AOC (mmol/gprot) | 0.13 ± 0.02 | 0.10 ± 0.01 | 0.12 ± 0.02 | 0.12 ± 0.02 |
| GR (U/gprot) | 3.06 ± 0.84a | 3.91 ± 1.05ab | 5.80 ± 1.42ab | 6.86 ± 1.36b |
| GSH (mg/mgprot) | 8.60 ± 0.82 | 8.47 ± 0.90 | 8.95 ± 1.37 | 9.52 ± 2.68 |
| CAT (U/mgprot) | 43.54 ± 4.38 | 42.8 ± 4.56 | 55.09 ± 5.75 | 42.84 ± 3.10 |
| GST (U/mgprot) | 15.74 ± 3.89 | 17.83 ± 4.55 | 9.62 ± 1.48 | 14.34 ± 3.37 |
| T-SOD (U/mgprot) | 121.18 ± 7.27a | 141.32 ± 14.3ab | 181.67 ± 17.79b | 146.32 ± 10.47ab |
| In blood | ||||
| AST (U/L) | 5.15 ± 0.38 | 4.66 ± 0.16 | 5.37 ± 0.54 | 4.67 ± 0.34 |
| ALT (U/L) | 154.50 ± 11.22b | 116.53 ± 1.74a | 124.88 ± 2.57a | 137.66 ± 5.54ab |
Note: All data presented as means ± standard error of the means (n = 9). Means in the same row with different superscripts are significantly different (p < 0.05). Malondialdehyde (MDA), total antioxidant capacity (T-AOC), glutathione reductase (GR), glutathione (GSH), catalase (CAT), glutathione S-transferase (GST), total superoxide dismutase (T-SOD), aspartate transaminase (AST), and alanine transaminase (ALT).
FIGURE 4Total bile acid levels in blood (A) and liver (B) and relative mRNA expression of farnesoid X receptor (fxr; (C) and cholesterol 7α-hydroxylase (cyp7a1; (D) in the liver of grass carp fed CSM-based diets containing graded levels of ferulic acid. Control: high CSM diet; FA (50): high CSM diet +50 mg/kg ferulic acid; FA (100): high CSM diet +100 mg/kg ferulic acid; FA (200): high CSM diet +200 mg/kg ferulic acid. The results are expressed as means ± standard error of the means (n = 9). Means of the same parameter with different superscripts are significantly different (p < 0.05).
FIGURE 5Relative mRNA expression of tight junction protein genes the zonula occludens-1 gene (zo-1; (A), zo-2 (B), junctional adhesion molecule-A (jam-a; (C), occludin (D), claudin-b (E), claudin-c (F), claudin-3 (G), claudin-7a (H), claudin-12 (I), and claudin-15a (J) in the intestine of juvenile grass carp fed CSM-based diets containing graded levels of ferulic acid. Control: high CSM diet; FA (50): high CSM diet +50 mg/kg ferulic acid; FA (100): high CSM diet +100 mg/kg ferulic acid; FA (200): high CSM diet +200 mg/kg ferulic acid. The results are expressed as means ± standard error of the means (n = 9). Means of the same parameter with different superscripts are significantly different (p < 0.05).
FIGURE 6Schematic of the beneficial effects of optimal FA supplementation in CSM-based diets on lipid metabolism, antioxidant status, and growth performance of juvenile grass carp. Abbreviations: cottonseed meal (CSM), malondialdehyde (MDA), glutathione reductase (GR), glutathione (GSH), total superoxide dismutase (T-SOD), farnesoid X receptor (fxr); cholesterol 7α-hydroxylase (cyp7a1), total bile acid (TBA), zonula occludens-1/2 (zo-1/2), triglyceride (TG), low-density lipoprotein (LDL), total cholesterol (TC), tight junction (TJ), and high-density lipoprotein (HDL).