Literature DB >> 36067193

MiR-31 improves spinal cord injury in mice by promoting the migration of bone marrow mesenchymal stem cells.

Yujuan Zhang1, Lili Cao1,2,3, Ruochen Du1, Feng Tian2, Xiao Li1, Yitong Yuan1, Chunfang Wang1.   

Abstract

BACKGROUND: Stem cell transplantation therapy is a potential approach for the repair of spinal cord injuries and other neurodegenerative diseases, but its effectiveness is hampered by the low rate of targeted migration of cells to the area of injury. The aim of this study was to investigate the effects of miR-31 on the migration of bone marrow mesenchymal stem cells (BMSCs) and the regulation of MMP-2 and CXCR4 expression in vitro and in vivo.
METHODS: eGFP-expressing BMSCs were isolated and cultured for subsequent experiments. The experiments were divided into three groups: control group, miR-31agomir group, and miR-31antagomir group. Proliferation was analyzed using CCK-8 and flow cytometry; cell migration in vitro was analyzed using wound-healing and transwell assays. The mouse SCI model was prepared by the impact method, and cells were transplanted (3 groups, 12 per group). Relevant inflammatory factors were detected by ELISA. The BMS score was used to evaluate the functional recovery of the mouse spinal cord and the frozen section was used to analyze the cell migration ability in vivo. The in vitro and in vivo expression levels of MMP-2 and CXCR4 were evaluated by Western blot and immunohistochemical staining.
RESULTS: In vitro experiments showed that cells in the miR-31agomir group exhibited enhanced cell proliferation (P<0.05, P<0.001) and migration (P<0.001) and upregulated protein expression levels of CXCR4 (P<0.01) and MMP-2 (P<0.001) compared with cells in the control group. The results of in vivo experiments showed that the expression of pro-inflammatory factors was reduced after cell transplantation treatment. Cells in the miR-31agomir group showed enhanced cell-targeted migration ability (P<0.001), improved the function of damaged tissues (P<0.001), and upregulated CXCR4 and MMP-2 expression compared to the control group (P<0.001).
CONCLUSION: Our experiment demonstrated that miR-31 could promote the migration of BMSCs and miR-31 could repair and improve the function of damaged tissues in SCI.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 36067193      PMCID: PMC9447891          DOI: 10.1371/journal.pone.0272499

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Spinal cord injury (SCI) is a serious and devastating neurodegenerative disease characterized by chronic pain, sudden loss of motor sensation, and associated oxidative stress and axonal degeneration, ultimately leading to lifelong disability [1,2]. Pro-inflammatory cytokines can make spinal cord injury neurological impairment more severe, so suppression of inflammation is another important principle in the treatment of spinal cord injury [3]. Globally, spinal cord injuries have a high morbidity and mortality rate and result in serious economic and social problems [4]. Therefore, the treatment of spinal cord injury has become a focus of scientific and medical research, which has promoted the development of several methods such as drug therapy, surgery, and cell therapy [5]. However, with the development of tissue engineering in recent years, stem cell transplantation is considered the most promising method, especially for bone marrow mesenchymal stem cells (BMSCs) [6,7]. BMSCs are stem cells with self-renewal and multidirectional differentiation as well as immunomodulatory properties [8]. At the same time, mesenchymal stem cells are very sensitive to changes in inflammatory conditions, and the inflammatory environment will regulate the anti-inflammatory potential of BMSCs [9]. In spinal cord injury, BMSCs are able to migrate to the region of injury to improve behavioral responses and differentiate into neurons for functional repair due to their low immunogenicity, targeted homing, and secretion of trophic factors that enhance neuronal survival. However, the limited ability to migrate to the area of injury limits the effectiveness and application of cell transplantation therapy [8,10,11]. MicroRNAs (miRNAs) are a conserved endogenous class of small, single-stranded, non-coding RNAs of approximately 22 nucleotides that inhibit the translation or stability of mRNAs by interacting with the 3’-untranslated (3’-UTR) regions of target genes and are involved in several biological processes [12,13]. In recent years, studies have found that miRNAs play an important role in regulating apoptosis, proliferation, migration, and differentiation of BMSCs [13]. MicroRNA-31 (miR-31), one of the many reported miRNAs, plays an important regulatory role in biological processes such as cell proliferation and migration [14]. Studies have shown that miR-31, after activation, can act on RAS/MAPK, Hippo, JAK-STAT3, and other signaling pathways to regulate the proliferation and migration of the corresponding cells and thus promote the regeneration of skin tissue, intestinal epithelial tissue, skeletal muscle, and other damaged tissues [15,16]. Current studies have been focusing on the effects of miR-31 on bone regeneration in mesenchymal stem cells. For example, in 2018 Jia et al. used gene chips to predict the regulation of mRNAs and miRNAs involved in osteogenic differentiation of ADSCs and found that miR-31 was highly correlated with osteogenesis in ADSCs [17]. Similarly, Marupanthorn et al. found that ALP activity and osteogenic gene expression increased with increasing time during osteogenic differentiation in BMSCs treated with miR-31 inhibitors, a strategy that may be used to promote bone regeneration [18]. In cancer, miR-31 is an important regulator, often acting as an oncogene involved in the proliferation, migration, and invasion of cancer cells [19]. However, there are multiple overlapping mechanisms in the characteristics of stem cells and cancer cells [20]. This research mainly studies the role of miR-31 in stem cells. It has been previously shown that miR-31 promotes the differentiation of spinal cord-derived neural stem cells into neurons and miR-31 has embryonic specificity in regulating the proliferation of neural stem cells [21]. However, the effect of miR-31 on the migration of BMSCs is not clear. Therefore, it is important to investigate whether miR-31 has a facilitative effect on the migration of bone marrow MSCs to repair damaged tissues.

Materials and methods

Animals

The enhanced green fluorescent protein (eGFP) transgenic mice (6–8 weeks, 15–20 g) model has been established by our group as previously reported. Female FVB mice (8–10 weeks, 18-25g) for SCI modeling were purchased from Spelford Biotechnology Ltd (Beijing China). The entire experiment was conducted in an enclosed environment. All mice were raised under standard conditions (temperature 23–26°C, humidity 50–60%, normal 12 h light/12 h dark biorhythm) and were given free access to water and food. During the experiments, 3% sodium pentobarbital was used for anesthesia to reduce animal pain, and mice were euthanized after high-dose anesthesia at the time of sampling. All methods and operations of this experiment were performed in accordance with the regulations for the husbandry and use of laboratory animals at Shanxi Medical University, and approved by the Ethics Committee for Laboratory Animals of Shanxi Medical University (Approval No.: SYDL2021014).

Isolation, culture and identification of BMSCs

BMSCs from the eGFP mice were extracted using the whole bone marrow apposition method. The eGFP mice were anesthetized intraperitoneally with 3% pentobarbital (30 mg/kg). Bilateral femurs and tibias were dissected after removing surrounding tissues and muscles, and rinsed with phosphate- buffered saline (PBS, Solarbio, China) for three times. Both ends of the bone were cut using tissue scissors, and following procedures were successively performed: (i) the bone marrow cavity was flushed three times using a 1 mL syringe; (ii) the culture medium containing bone marrow was collected; (iii) he supernatant was discard after centrifugation; (iv) the cell pellet was resuspended in DME/F-12 (Gibco, US); and (v) the resuspended cells were used to inoculate T25 culture flasks (Corning, US) to form a single cell layer. The cells were incubated at 37°C in a 5% CO2 cell incubator and then the medium was replaced with fresh medium 4 h later, and every three days thereafter. Cells would be passaged when they reached a confluency of 80%, and the 3rd to 5th passaged cells(P3-P5) were used in subsequent experiments. BMSCs were inoculated on six-well plates (Corning, US) and the expression of their important markers CD90, CD34, and CD44 (BOSTER, China) were identified by immunofluorescence techniques.

Cell transfection

P3-P5 BMSCs were inoculated into a six-well plate (1×105 cells/well) containing fetal bovine serum (FBS, Gibco, US) medium. When the cells reached a confluency of 30–50%, the mixture of miR-31agomir (RIBBIO Guangzhou, China) and transfection reagent (Polyplus, France) and transfection reagent were separately added to the wells and the cells were further cultured for 12 h before the medium was replaced with normal medium. The final concentrations for miR-31agomir and miR-31antagomir were 50ηM and 100ηM, respectively.

Transfection efficiency analysis

Since our customized miR-31 siRNA drug is modified by Cy3 fluorescent labeling, the transfection can be directly observed under a fluorescence microscope. 24 h post-transfection, the medium was discarded and the cells were then washed with PBS for three washes, fixed with 4% paraformaldehyde (Solarbio, China), and stained with HOCHEST (Germany). The experiment was repeated three times.

Real-time fluorescence quantitative PCR (RT-qPCR)

Total RNA was extracted using TRIZOL reagent (TAKARA, Japan) then reverse transcribed into cDNA using a miRNA First-Strand Synthesis Kit (TAKARA, Japan). The expression of miR-31 in cells after transfection was quantitatively determined using the TB Green kit (TAKARA, Japan) on a Real-Time PCR System. The primers used are shown in Table 1.
Table 1

Primer sequence of q RT-PCR.

PrimerSequence (5′-3′)
miR-31 AGGCAAGATGCTGGCATAGCTG
U6 Forward GGAACGATACAGAGAAGATTAGC
U6 Reverse TGGAACGCTTCACGAATTTGCG

Cell proliferation analysis

Analysis of miR-31 on the proliferation of BMSCs was performed using cell counting kit-8 (CCK-8) (Solarbio, China). Briefly, BMSCs were inoculated in 96-well plates (1.0×104cells/well) and transfected when cell reached a confluency of 30–50%. Then 10 μL of CCK-8 solution was added to each well and the plate was incubated for 4 h before the absorbance value at 450ηm was measured using an microplate reader. The OD values at day 1, day 2, and day 3 were measured respectively, and 5 replicate wells were set in each group.

Cell cycle analysis

Cell cycle was detected by flow cytometry. Briefly, 5 × 105 transfected cells were collected and analyzed using a cell cycle kit (Elabscience, China) by following the manufacturer’s instructions.

Cell migration analysis

Transwell experiment: The transfected cells were resuspended in a serum-free transwell (pore diameter: 8μm; Corning, USA) with 200μL (1 x 105cells) and 600μL of complete medium in the upper chamber and the lower chamber, respectively, and incubated for 24 h at 37°C in 5% CO2. The cells were then fixed in 4% paraformaldehyde and stained with 1% crystalline violet (Solarbio, China). Finally, images of five visual fields were collected for analysis under a microscope and the experiment was repeated three times. Wound-healing assay: The cells were seeded in a six-well plate, transfected, and let grow to 100% confluency by overnight incubation. The next day, the cells were scratched vertically on the bottom of the dish with a yellow gun tip, washed slowly with PBS to remove the scratched cells, and incubated in serum-free medium in a 37°C, 5% CO2 incubator. Photographs were taken and images were collected at 0 h, 12 h, 24 h, and 48 h, respectively. The migration area was analyzed using Image J software. The calculation formula is: %migration area = (Ai-Al)/Ai, Ai denotes the area of the initial scratch; Al denotes the area of the scratch after incubation.

Establishment of SCI model

The FVB mice were randomly divided into 3 groups with 12 mice in each group. The mice were fasted for 12 hours, anesthetized by i.p. injection with 3% sodium pentobarbital, fixed on the operating table, exposed the spinal cord, and hit to the spinal cord at T8-T10 with Impactor M-Ⅲ (New York University). The spastic tail swinging, the retraction of the lower limbs, and the body of the mouse were used as signs of successful modeling, and the wound was sutured after the operation. To prevent post-operative infection, gentamicin (8mg/kg) was administered intramuscularly for 3 consecutive days and the mice were manually urinated twice daily until they resumed urinating on their own. Tissue from the injury site was extracted for histological examination on day 1, 3, 5, and 7 after modelling.

ELISA of IL-6 and IL-17

Blood samples from mice were collected and centrifuged at room temperature to separate sera samples for the detection of IL-6 and IL-17 using ELISA kits (BOSTER, China) according to the manufacturer’s instructions.

Cell transplantation and grouping

After successful establishment of the SCI model, cells were transplanted near the injury site at a rate of 1μL/min. Mice in control group, miR-31agomir group, and miR-31antagomir group were injected with 3 μL of serum-free medium containing BMSCS, 3μL of serum-free medium containing miR-31agomir-transfected BMSCS, and 3μL of serum-free medium containing miR-31antagomir-transfected BMSCS, respectively. Consistent number of cells was used in each group (1.0×105/μL cells).

Basso Mouse Scale (BMS) score

BMS scores were used after SCI model establishment and cell transplantation to evaluate the recovery of motor function in the hind limbs of mice. The mice were scored using a double-blind method to observe ankle joint movements, hind limb support of the hindquarters and forward stepping, and hind paw position and anterior and posterior limb coordination during stepping and trunk stability. The higher the score according to the BMS scale, the better the recovery.

GFP immunofluorescence assay

Spinal cord tissue was fixed in 4% paraformaldehyde for more than 24 h and dehydrated with gradient concentration of sucrose. Sections of 8μm thickness were then prepared on a frozen section machine and finally observed under a fluorescent microscope and images were collected for analysis.

Histological analysis

The tissue sections were stained with hematoxylin and eosin, and finally dehydrated and mounted. The tissue sections were placed in citric acid antigen repair buffer (pH 6.0) for antigen repair. Next, endogenous peroxidase was blocked by incubationg with 3% hydrogen peroxide. The tissue section was blocked with 3% bovine serum albumin (BSA) and then incubated with primary antibody (MMP-2, CXCR4, BOSTER, China) overnight at 4°C. The sections were washed several times and then incubated with secondary antibody (Absin, China) at room temperature for 50 min. The presence of specific antigens were developed using DAB (BOSTER, China) reagent. The nuclei were double-stained after DAB development and observed under a microscope.

Western blot analysis

Appropriate amount of RIPA (BOSTER, China) was added to the transfected cells and spinal cord tissues for 3–5 min to completely lyse the cells and tissues, and the supernatant was collected after centrifugation for the determination of total protein using the BCA protein concentration kit (BOSTER, China). The same amount of protein was separated by SDS-PAGE, and the resolved proteins were transferred to a PVDF membrane. The membrane was then blocked with 5% bovine serum albumin (BOSTER, China) for 1.5 hours, and sequentially incubated with primary antibodies overnight at 4°C (MMP2 antibody dilution ratio 1:10000, CXCR4 antibody dilution ratio 1:1000, BOSTER, China), and second antibody (goat anti-rabbit IgG labelled with HRP, dilution 1:5000, absin, China) at room temperature. Western blot analyses were repeated for three times.

Statistical analysis

We used the Student’s T test to determine whether the data were normally distributed. Continuous data were expressed as mean ± standard deviation. One-way ANOVA and t-test were used for comparison between groups. All data were analyzed using SPSS 25.0 (IBM, NY, USA). Statistical graphs were produced by GraphPad Prism8 software (GraphPad, CA, USA), and a P < 0.05 was considered statistically significant.

Result

BMSCs cultured in vitro were CD90- and CD44-positive, but CD34-negative

BMSCs are easy to obtain and passage in vitro. Under an inverted microscope, the cells were consistent in morphology, resembling fibroblast-like cells that were spindle-shaped and in colonies (Fig 1B). Under the fluorescence inverted microscope, BMSCs showed green fluorescence (Fig 1C). Cellular immunofluorescence identification of BMSCs cells showed positive expression of CD90 and CD44 (98.4%,98.66%) and negative expression of CD34 (0.14%) (Fig 1D and 1E).
Fig 1

Extraction and identification of green fluorescent protein-labeled bone marrow mesenchymal stem cells.

A Schematic diagram of cell extraction. B Cell morphology under an optical microscope (x100 magnification). Scar bar: 100μm. C Cell morphology under a fluorescent microscope (x100 magnification). Scar bar: 100μm. D The surface markers of BMSCs were identified by cellular immunofluorescence. CD90 and CD44 showed red fluorescence as antigen-positive expression; CD34 did not show red fluorescence as antigen-negative expression. Scar bar: 50μm. E Statistical results on the expression of surface markers CD90, CD44 and CD34 in BMSCs. Dates are presented as mean ± SD (n = 5).

Extraction and identification of green fluorescent protein-labeled bone marrow mesenchymal stem cells.

A Schematic diagram of cell extraction. B Cell morphology under an optical microscope (x100 magnification). Scar bar: 100μm. C Cell morphology under a fluorescent microscope (x100 magnification). Scar bar: 100μm. D The surface markers of BMSCs were identified by cellular immunofluorescence. CD90 and CD44 showed red fluorescence as antigen-positive expression; CD34 did not show red fluorescence as antigen-negative expression. Scar bar: 50μm. E Statistical results on the expression of surface markers CD90, CD44 and CD34 in BMSCs. Dates are presented as mean ± SD (n = 5).

miR-31 transfected BMSCs

We customized miR-31agomir and miR-31antagomir, which were modified by high affinity cholesterol and fluorescently labeled with Cy3. The red fluorescence was directly observed under fluorescence microscope after transfection of BMSCs (Fig 2C). The transfection efficiency was 93.27% in the miR-31agomir group and 94.44% in the miR-31antagomir group, with no statistically significant difference between the two groups (Fig 2D). The results of qRT-PCR experiments showed that after cell transfection, the expression of miR-31 was significantly increased in the miR-31agomir group compared with the control group and was more than 7-fold higher (P<0.001), however, the expression of miR-31 was restricted in the miR-31antagomir group (P<0.01) (Fig 2B). The cell morphology after transfection did not change (Fig 2E).
Fig 2

miR-31 transfection of BMSCs.

A Schematic diagram of cell transfection. B Expression of miR-31 in bone marrow mesenchymal stem cells in each group after transfection was detected by qRT-PCR. C The status of miR-31agomir and miR-31antagomir transfection is detected by immunofluorescence, and successful transfection emits red fluorescence. Scar bar: 100μm. D Statistics of the results of miR-31agomir and miR-31antagomir transfection efficiency. E Morphology of the cells under optical microscopy after transfection. Scar bar: 100μm. Dates are presented as mean ± SD (n = 9,15). Statistical analysis: compared to control, **P<0.01, ***P<0.001.

miR-31 transfection of BMSCs.

A Schematic diagram of cell transfection. B Expression of miR-31 in bone marrow mesenchymal stem cells in each group after transfection was detected by qRT-PCR. C The status of miR-31agomir and miR-31antagomir transfection is detected by immunofluorescence, and successful transfection emits red fluorescence. Scar bar: 100μm. D Statistics of the results of miR-31agomir and miR-31antagomir transfection efficiency. E Morphology of the cells under optical microscopy after transfection. Scar bar: 100μm. Dates are presented as mean ± SD (n = 9,15). Statistical analysis: compared to control, **P<0.01, ***P<0.001.

miR-31 promotes the proliferation of BMSCs

In order to study the effect of miR-31 on the proliferation of BMSCs, we performed CCK-8 and Cell-cycle assays. As shown in Fig 3A, the proliferation of BMSCs was significantly increased in the miR-31agomir group in a time-dependent manner compared with the control group (P<0.05, P<0.001). However, the proliferation of BMSCs in the miR-31antagomir group was inhibited at 72 h compared with the control group (P<0.001). Flow cytometry results showed that the percentages of cells at the S phse in the miR-31agomir group, miR-31antagomir group, and the control group were 22.45%, 16.85%, and 19.68%, respectively (Fig 3B). In summary, miR-31 can promote the proliferation of BMSCs.
Fig 3

Effect of miR-31 on BMSCs proliferation.

A To analyze the effect of miR-31 on the proliferation of BMSCs. The OD values of miR-31agomir, miR-31antagomir and control at 450m for 24, 48 and 72 hours were detected by CCK-8. B Detection of the cell cycle distribution of each group of cells by flow cytometry. Dates are presented as mean ± SD (n = 5). Statistical analysis: within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 24 hours miR-31agomir, #P<0.05, ###P<0.001.

Effect of miR-31 on BMSCs proliferation.

A To analyze the effect of miR-31 on the proliferation of BMSCs. The OD values of miR-31agomir, miR-31antagomir and control at 450m for 24, 48 and 72 hours were detected by CCK-8. B Detection of the cell cycle distribution of each group of cells by flow cytometry. Dates are presented as mean ± SD (n = 5). Statistical analysis: within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 24 hours miR-31agomir, #P<0.05, ###P<0.001.

miR-31 promotes the migration of BMSCs in vitro

To observe the effect of miR-31 on the horizontal migration of cells, we analyzed the migration ability by wound-healing assay after transfection of the cells, which has been widely used to detect cell migration in vitro. At 24 h, compared with the control group, cells in the miR-31agomir group migrated faster (P<0.01). At 48 h, the cell migration rate was significantly faster in the miR-31agomir group than in the control group, with a significant difference (P<0.001). And the migration speed of cells in the miR-31agomir group accelerated with incresing time (Fig 4A). Statistical analysis of the wound healing area showed that the migration ability of BMSCs was significantly enhanced after transfection with miR-31agomir (Fig 4B).
Fig 4

Analysis of the effect of miR-31 on the migration of BMSCs.

A The promoted effect of miR-31 on the horizontal migration of BMSCs tested by bidirectional wound-healing assay at 0, 12, 24 and 48 hours. Scar bar: 100μm. B Percentage cell migration area result statistics for control, miR-31agomir and miR-31antagomir at 0, 12, 24 and 48 hours. C Schematic diagram of the vertical cell migration tested by Transwell chamber assay. D Cells that passed through the polycarbonate membrane were stained with crystal violet, observed under an inverted phase contrast microscope and counted in 200× magnification field. Scar bar: 50μm. E Statistical results of the number of cells in the lower chamber of the migration value of BMSCs. Dates are presented as mean ± SD (n = 5,15). Statistical analysis: within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 12 hours miR-31agomir, ###P<0.001.

Analysis of the effect of miR-31 on the migration of BMSCs.

A The promoted effect of miR-31 on the horizontal migration of BMSCs tested by bidirectional wound-healing assay at 0, 12, 24 and 48 hours. Scar bar: 100μm. B Percentage cell migration area result statistics for control, miR-31agomir and miR-31antagomir at 0, 12, 24 and 48 hours. C Schematic diagram of the vertical cell migration tested by Transwell chamber assay. D Cells that passed through the polycarbonate membrane were stained with crystal violet, observed under an inverted phase contrast microscope and counted in 200× magnification field. Scar bar: 50μm. E Statistical results of the number of cells in the lower chamber of the migration value of BMSCs. Dates are presented as mean ± SD (n = 5,15). Statistical analysis: within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 12 hours miR-31agomir, ###P<0.001. In order to further confirm the effect of miR-31 on the vertical migration of cells, a transwell chamber assay was used. The transfected cells were seeded in the upper chamber of transwell and cultured for 24 h (Fig 4C). As shown in Fig 4D, compared to the control group, more cells in the miR-31agomir group migrated to the lower chamber of the transwell. Additionally, as shown in Fig 4E quantitative analysis indicated that miR-31agomir could significantly enhance the migration of BMSCs (p<0.001). These experimental results suggested that miR-31 could promote the migration of BMSCs, laying the foundation for repairing damaged tissue function.

In vitro, miR-31 upregulats the expression of CXCR4/MMP-2 protein

To further investigate the mechanism by which miR-31 promoted the migration of BMSCs, CXCR4 and MMP-2 were analyzed. Western blot results showed that the relative expression of CXCR4 protein was higher in the miR-31agomir group (P<0.01) and lower in the miR-31antagomir group (P<0.05) compared to the control group (Fig 5B). Similarly, the relative expression of MMP-2 protein and CXCR4 expression showed the same trend (Fig 5C).
Fig 5

In vitro, miR-31 upregulated CXCR4 and MMP-2 expression.

A Strip chart of protein expression. B The relative expression of CXCR4 protein in each group. C The relative expression of MMP-2 protein in each group. Dates are presented as mean ± SD (n = 3). Statistical analysis: compared to control, *P<0.05, **P<0.01, ***P<0.001.

In vitro, miR-31 upregulated CXCR4 and MMP-2 expression.

A Strip chart of protein expression. B The relative expression of CXCR4 protein in each group. C The relative expression of MMP-2 protein in each group. Dates are presented as mean ± SD (n = 3). Statistical analysis: compared to control, *P<0.05, **P<0.01, ***P<0.001.

Evaluation of miR-31 repair of spinal cord injury function by BMS score

To evaluate animal models of spinal cord injury, inflammatory factor assays, and hematoxylin-eosin staining experiments were performed. After the model was established, serum inflammatory factors were measured and the results showed that the relative levels of both IL-6 and IL-17 were higher in SCI mice than in normal mice (P<0.05, P<0.001) (Fig 6B). The BMS score was 0 (Fig 6C). As shown in Fig 6D, the normal spinal cord was morphologically intact with clear boundaries of gray and white matter, abundant neurons, and an intact central cord canal with no red blood cells, inflammatory cells or vacuoles. However, the morphological structure of the damaged spinal cord was missing, the boundaries of gray and white matter were blurred, the number of neurons was reduced, and erythrocytes, inflammatory cells, and vacuoles were scattered. These experiments indicated that the SCI model was successfully established.
Fig 6

Establishment of SCI model and the effect of miR-31 on BMSCs migration in vivo.

A Schematic diagram of cell transplantation. B Relative levels of IL-6 and IL-17 in normal and spinal cord injured mice. C Assessment of functional repair after spinal cord injury in mice by BMS score. D The morphology of the normal and post-injured spinal cord was observed by HE staining. The arrow in the normal spinal cord points to the central cord and neurons; the arrow in the injured tissue points to the red blood cells and vacuoles. Scar bar: 50μm. E The migration of bone marrow mesenchymal stem cells within the spinal cord was observed by frozen sections on days 5 and 7. Scar bar: 50μm. F Statistical results of the relative fluorescence intensity of migrating BMSCs within the spinal cord. Dates are presented as mean ± SD (n = 5,6,12). Statistical analysis: Within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 3,5 days miR-31agomir, ###P<0.01; a P<0.05 indicates miR-31antagomir compared to miR-31agomir.

Establishment of SCI model and the effect of miR-31 on BMSCs migration in vivo.

A Schematic diagram of cell transplantation. B Relative levels of IL-6 and IL-17 in normal and spinal cord injured mice. C Assessment of functional repair after spinal cord injury in mice by BMS score. D The morphology of the normal and post-injured spinal cord was observed by HE staining. The arrow in the normal spinal cord points to the central cord and neurons; the arrow in the injured tissue points to the red blood cells and vacuoles. Scar bar: 50μm. E The migration of bone marrow mesenchymal stem cells within the spinal cord was observed by frozen sections on days 5 and 7. Scar bar: 50μm. F Statistical results of the relative fluorescence intensity of migrating BMSCs within the spinal cord. Dates are presented as mean ± SD (n = 5,6,12). Statistical analysis: Within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 3,5 days miR-31agomir, ###P<0.01; a P<0.05 indicates miR-31antagomir compared to miR-31agomir. After cell transplantation, the BMS scores were significantly higher in the miR-31agomir group compared to the control and miR-31antagomir groups, and the greatest significant differences were observed on day 5 and 7 (P<0.001) (Fig 6C). This result indicated that miR-31 could promote the recovery of function in mice with SCI.

In vivo, miR-31 can promote the migration of BMSCs

To evaluate the effect of miR-31 on the migration of BMSCs in vivo, spinal cord tissues were selected for frozen sections on day 5 and day 7 after cell transplantation. As shown in Fig 6E and 6F, the mean fluorescence intensity in the tissue was higher in the miR-31 group compared to the control group and miR-31antagomir group, and the fluorescence intensity was enhanced in a time-dependent manner (P<0.001). The results suggested that in vivo, miR-31 had a facilitative effect on the migration of BMSCs.

Cell therapy improves inflammation in SCI

To assess the expression of inflammatory factors after cell transplantation, we measured the relative levels of IL-6 and IL-17 on day 5 and 7. Compared with the control group, the relative expression levels of both IL-6 and IL-17 were reduced in the miR-31agomir group (P<0.05, P<0.001), with a decreasing trend with time (Fig 7E and 7F). The results indicated that pretreatment of BMSCs before transplantation would enhanced the anti-inflammatory effect in SCI.
Fig 7

miR-31 upregulated the expression of CXCR4 and MMP-2.

A After cell transplantation, CXCR4 expression in tissues was detected by immunohistochemistry assays on days 5 and 7. Scar bar: 25μm. B Statistical results of CXCR4 expression in tissues. C After cell transplantation, MMP-2 expression in tissues was detected by immunohistochemistry assays on days 5 and 7. Scar bar: 25μm. D Statistical results of MMP-2 expression in tissues. E IL-17 expression in vivo after cell transplantation. F IL-6 expression in vivo after cell transplantation. G After cell transplantation, CXCR4/MMP-2 protein expression was assessed in vivo by Western blot. Compared to control, *P<0.05. Dates are presented as mean ± SD (n = 3,5,12). Statistical analysis: within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 5 days miR-31agomir, ###P<0.001.

miR-31 upregulated the expression of CXCR4 and MMP-2.

A After cell transplantation, CXCR4 expression in tissues was detected by immunohistochemistry assays on days 5 and 7. Scar bar: 25μm. B Statistical results of CXCR4 expression in tissues. C After cell transplantation, MMP-2 expression in tissues was detected by immunohistochemistry assays on days 5 and 7. Scar bar: 25μm. D Statistical results of MMP-2 expression in tissues. E IL-17 expression in vivo after cell transplantation. F IL-6 expression in vivo after cell transplantation. G After cell transplantation, CXCR4/MMP-2 protein expression was assessed in vivo by Western blot. Compared to control, *P<0.05. Dates are presented as mean ± SD (n = 3,5,12). Statistical analysis: within group compared to control, *P<0.05, **P<0.01, ***P<0.001; between groups compared to 5 days miR-31agomir, ###P<0.001.

The in vivo effect of miR-31 on the protein levels of CXCR4 and MMP-2

To further investigate the mechanism of miR-31 on the migration of BMSCs in vivo, we analyzed the expression of CXCR4 and MMP-2. Immunohistochemical results showed a higher number of CXCR4-positive cells in the miR-31agomir group (P<0.001) compared to the control group, in a time-dependent manner (P<0.001) (Fig 7A and 7B). Similarly, the expression of MMP-2 was consistent with the trend of CXCR4. Western blot results showed that the relative expression levels of CXCR4 and MMP-2 were higher in the miR-31agomir group (P<0.05) compared with the control group (Fig 7G). These experiments showed that miR-31 upregulated the expression of CXCR4 and MMP-2 proteins.

Discussion

Currently, BMSCs transplants are widely used in the treatment of SCI [22]. BMSCs promote functional repair after SCI by secreting various trophic factors and functionally useful growth factors, the biggest shortcoming of BMSCs transplantation is that they do not effectively migrate to the target tissues [23,24]. Hypoxia or trophic factors (stromal cell-derived factor-1 and monocyte chemotactic protein-1) have been shown to promote the migration of BMSCs in vitro [25,26]. However, there are few studies on the effect of miR-31 on the migration of BMSCs. Therefore, in our study, cells were pretreated with miR-31 siRNA to enhance the migration potential of BMSCs. MicroRNAs (miRNAs) are small, non-coding RNA molecules that target mRNAs to silence gene expression at the post-transcriptional level and play an important role in a variety of cellular biological processes [12,27]. Research has shown that miRNAs used in the study of stem cells, tumor cells, and developmental regulation can regulate the expression of a wide range of genes and play a key role in the biological processes of stem cells [28-30]. For example, Satoshi et al. found that miR-720 promoted differentiation and reduced proliferation of dental pulp stem/progenitor cells by inhibiting the Nanog homologous frame (Nanog) [31]; Xiao et al. found that miR-146 played an important role in the regulation of stem cell proliferation, differentiation, and apoptosis [32]; Kong et al. found that microRNA-126 promoted proliferation and migration of bone marrow mesenchymal stem cells [33]. Studies have found that miR-31 is involved in the biological process of cells, especially the invasion and migration of tumor cells [34]. However, there are limited studies that explore its effect on the migration of bone marrow mesenchymal stem cells. MiR-31 is highly conserved among species and it can be speculated that miR-31 may play an important role in the proliferation and migration of BMSCs. In our study, miR-31 siRNA was successfully transfected in BMSCs and the upregulation of miR-31 expression in cells was confirmed by RT-qPCR. After comparing the migration ability of each group of BMSCs by transwell and cell scratch assays, miR-31 was found to promote the migration of BMSCs. This result lays the foundation for efficient migration of BMSCs to target tissues. The migration process of BMSCs requires the synergistic action of several chemokines, adhesion factors, and proteases, and the most important of them are matrix metalloproteinase2 (MMP-2) and CXC chemokine receptor type 4 (CXCR4) [35]. Matrix metalloproteinases (MMPs) are a family of proteases that use zinc metal ions as cofactors and their main function is to degrade and maintain the homeostasis of the extracellular matrix [36]. Among them, MMP-2 is the most important protein in the matrix metalloproteinase family and is also an important protein involved in cell migration. It plays a specific role in cell migration and proliferation by degrading collagen of the basement membrane [37]. The chemokine receptor family is the most tissue-specific and subpopulation-selective family of cell homing receptors, and of them, CXCR4 has been shown to have a key role in injury-induced stem cell recruitment and a strong chemotactic role in regulating bone marrow MSC migration [38,39]. In this study, the results of Western blot experiments showed that the up-regulation of miR-31 in BMSCs up-regulated the expression of MMP-2 and CXCR4 proteins, which is a prerequisite for efficient targeted migration after cell transplantation. In recent years, it has been found that pretreatment of BMSCs prior to cell transplantation can promote the migration of BMSCs. Li-Ki et al. found that lithium preparations promoted the migration of BMSCs to restore neurological function in cerebral ischemia by inducing the expression of CXCR4 in BMSCs [40]. However, current stem cell experiments do not give us information about the migration of transplanted cells in the target tissue [1]. Therefore, in this experiment, we chose to use green fluorescent protein expressing BMSCs pretreated with miR-31 SiRNA for in vivo experiments. After the SCI model was successfully established, the migration of BMSCs in the damaged tissues and the expression of the associated migrating proteins were observed by collecting tissues for frozen sections and immunohistochemistry as well as Western blot detection. And the results showed that more BMSCs migrated into damaged tissues after pretreatment with miR-31agomir compared with those without pretreatment (P<0.01); the number of MMP-2 and CXCR4 positive cells and expression level of proteins in the miR-31agomir group were higher than in the control group (P<0.001). The results of in vivo experiments indicated that upregulation of MMP-2 and CXCR4 expression after cell transplantation was an important factor in improving the migration and homing of transplanted cells. Studies have shown that mesenchymal stem cells injected into mice can be located in the area of SCI. These cells can protect neurons, promote axon regeneration, and restore function to a certain extent [11]. Previous studies by our group have found that miR-31 promotes functional improvement and repair after SCI in mice [21,41]. The prognosis of SCI and inflammation are closely related, and IL-6 and IL-17 are two important pro-inflammatory factors. IL-6 can cause early inflammatory response in SCI and enhance the expression of other inflammatory factors, and inhibition of IL-6 expression has a protective effect on SCI. Activated neutrophils after SCI are able to secrete IL-17, which greatly hinders the treatment of the disease, and the reduction of IL-17 levels can reduce the severity of SCI in the later stages. Therefore, we examined the relative levels of the two factors after animal model establishment and cell transplantation treatment, and the results showed that the levels of IL-6 and IL-17 were increased after injury and decreased after pretreatment transplantation of BMSCs, which suggested that pretreatment was more useful for disease recovery after cell transplantation. In this experiment, the results of BMS scores reconfirmed that cells modified by miR-31 could promote functional repair of damaged tissues. It may be that miR-31 can inhibit the proliferation of glial cells after SCI. In conclusion, miR-31 promoted the migration of BMSCs and upregulated the expression of MMP-2 and CXCR4, which in turn promoted the repair after nerve injury. This study specifies the effect of miR-31 on the migration of BMSCs by in vivo and in vitro experiments. The strength of the current study lies in the in vivo experiments performed as well as the use of siRNA small molecule nucleic acid drugs. RNA interference (RNAi) is a natural cellular process that silences gene expression by promoting the degradation of mRNA [42]. The RNAi mechanism was discovered in 1998 by Fire and Mello in caenorhabditis elegans, but this mechanism was not further developed until 2006 [43]. Currently, siRNAs have become an important tool for RNAi to achieve gene silencing and can be used to regulate the expression of target genes by transfecting them into cells [44]. siRNA has also emerged as a potential and promising therapeutic platform and has been applied in many research areas. Conventional microRNA mimics or microRNA inhibitor is cumbersome to use and toxic to cells, which is not suitable for in vivo study and use in animals. Therefore, we attached a cholesterol moiety to the 3’ end of miR-31 small nucleic acid molecule, which can enhance its ability to cross the cell membrane and enter the cell to play a regulatory role, and has higher stability in animal experiments and cellular experiments [45]. Shu M et al. demonstrated that miR-335 transfected in glioma cells could be stably expressed in cells by PCR assay [46]. Hu JZ et al. showed that the efficacy of miR-21 on SCI was still detectable 4 weeks after direct injection at SCI, indicating that it could be stably expressed in animals [47]. Previous studies by our group have demonstrated that transfection of neural stem cells cultured in vitro with miR-31 verified its stable expression in neural stem cells by PCR and effectively restored motor function after SCI within 21 days after injection into mice with spinal cord injury [47]. Due to the addition of a Cy3 light-emitting group, red fluorescence could be detected after transfection into the cells. Through this experiment, it was demonstrated that a large number of cells could emit red fluorescence after transfection with small nucleic acid molecules, and the results of fluorescence quantitative PCR showed that the expression of miR-31 was significantly upregulated in the miR-31agomir group (P<0.001) and downregulated in the miR-31antagomir group compared with the control group (P<0.01), indicating that the synthesized small nucleic acid molecules could effectively regulate the expression of miR-31 in BMSCs and thus determine the cell fate. And it was demonstrated that it could effectively restore the motor function of mice after SCI when injected with pretreated cells. Through the study, we found that the customized miR-31 siRNA drugs exerted the same effects as common siRNA inhibitors and had a wide range of clinical applications. Thus, promoting the migration of BMSCs by miR-31 provides a new therapeutic strategy for the treatment of neurodegenerative diseases such as SCI. It also lays a preliminary foundation for us to effectively use miR-31-related siRNA drugs for clinical treatment of SCI and motor neuron diseases.

Conclusions

In this study, in vitro experiments demonstrated that at 48 h, 50ηM miR-31agomir significantly promoted the proliferation of BMSCs, showing a time-dependent increase compared to 24 h, and its effect was verified by cell cycle analysis. The time-dependent promotion of miR-31 on the migration of BMSCs was demonstrated by migration assays. Thus, miR-31 was shown to promote the proliferation and migration of BMSCs. In the in vitro experiments, the relative fluorescence intensity of cells in mice demonstrated that the cells had the strongest migration ability at day 5 and 7, and the efficacy of miR-31 on the repair of motor function in SCI mice was demonstrated by BMS score. Therefore, this experiment demonstrated that miR-31 promoted the migration and proliferation of BMSCs by upregulating the expression of MMP-2 and CXCR4 to repair and improve the motor function of damaged tissues in SCI. However, whether it acts on CXCR4/AKT requires further studies to understand its detailed mechanism of action. (ZIP) Click here for additional data file. (ZIP) Click here for additional data file. 25 Mar 2022
PONE-D-21-40503
MiR-31 improves spinal cord injury in mice by promoting the migration of bone marrow mesenchymal stem cells
PLOS ONE Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We have struggled to attain reviews for this article. The single review we have suggests major revision, as below. As editor, I have read the manuscript and also have suggestions on improvement. Should you decide to progress with all suggestions, we will look at a revised article. 1. The filed of miR-31 and MSCs is evidence for bone regeneration, however you do not refer to any of this research. Please widen your literature review of the activities of miR-31. 2. Is the stability of miR-31 and the antagomiR verified in culture? 3. All images/figures are of a low resolution, this must be improved. 4. the conclusion is too short and abrupt, this needs expansion and justification. Please submit your revised manuscript by May 9, 2022. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Catherine Berry, PhD, MSc, BSc Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.  If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free. Upon resubmission, please provide the following: The name of the colleague or the details of the professional service that edited your manuscript A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file) A clean copy of the edited manuscript (uploaded as the new *manuscript* file) 3. To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering. 4. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 5. Thank you for stating the following in the Acknowledgments Section of your manuscript: "The authors would like to thank the funders listed in the funding section for their support. The authors would like to thank Professor Chunfang Wang for helpful discussions. Funding National Natural Science Foundation of China(81371384, 82001326); Applied Basic Research Project of Shanxi Province (201901D211319); Key Laboratory Opening Project of Shanxi Province (KF2020-02)." We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "The author(s) received no specific funding for this work." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 6. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 7. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 8. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ 9. Your ethics statement should only appear in the Methods section of your manuscript. If your ethics statement is written in any section besides the Methods, please delete it from any other section. Additional Editor Comments (if provided): Thank you for your submission. Apologies regarding the delay in returning your paper to you, we have struggled to find sufficient reviewers for the article. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In general, the paper theme is interesting and the methods are acceptable. However, The manuscript has several problems involving the space between the words that I indicated in the attached file with yellow color and with comments. Moreover, the statistical analyses and conclusions must be revised. I do not download the .tiff images, in the pdf, the quality of the images is poor. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Submitted filename: Reviewer KE_PONE-D-21-40503.pdf Click here for additional data file. 30 Apr 2022 1、The filed of miR-31 and MSCs is evidence for bone regeneration, however you do not refer to any of this research. Please widen your literature review of the activities of miR-31. Thanks to the editors and reviewers for the questions I have answered as follows: MicroRNA-31 (miR-31), one of the many reported miRNAs, plays an important regulatory role in biological processes such as cell proliferation and migration. Studies have shown that miR-31, after activation, can act on RAS/MAPK, Hippo, JAK-STAT3, and other signaling pathways to regulate the proliferation and migration of the corresponding cells and thus promote the regeneration of skin tissue, intestinal epithelial tissue, skeletal muscle, and other damaged tissues. Current studies have been focusing on the effects of miR-31 on bone regeneration in mesenchymal stem cells. For example, in 2018 Jia et al. used gene chips to predict the regulation of mRNAs and miRNAs involved in osteogenic differentiation of ADSCs and found that miR-31 was highly correlated with osteogenesis in ADSCs. Similarly, Marupanthorn et al. found that ALP activity and osteogenic gene expression increased with increasing time during osteogenic differentiation in BMSCs treated with miR-31 inhibitors, a strategy that may be used to promote bone regeneration. The revised section is on lines 70-83 of the article. 2、Is the stability of miR-31 and the antagomiR verified in culture? Thanks to the editors and reviewers for the questions I have answered as follows: RNA interference (RNAi) is a natural cellular process that silences gene expression by promoting the degradation of mRNA. The RNAi mechanism was discovered in 1998 by Fire and Mello in caenorhabditis elegans, but this mechanism was not further developed until 2006. Currently, siRNAs have become an important tool for RNAi to achieve gene silencing and can be used to regulate the expression of target genes by transfecting them into cells. siRNA has also emerged as a potential and promising therapeutic platform and has been applied in many research areas. Conventional microRNA mimics or microRNA inhibitor is cumbersome to use and toxic to cells, which is not suitable for in vivo study and use in animals. Therefore, we attached a cholesterol moiety to the 3' end of miR-31 small nucleic acid molecule, which can enhance its ability to cross the cell membrane and enter the cell to play a regulatory role, and has higher stability in animal experiments and cellular experiments. Shu M et al. demonstrated that miR-335 transfected in glioma cells could be stably expressed in cells by PCR assay. Hu JZ et al. showed that the efficacy of miR-21 on SCI was still detectable 4 weeks after direct injection at SCI, indicating that it could be stably expressed in animals. Previous studies by our group have demonstrated that transfection of neural stem cells cultured in vitro with miR-31 verified its stable expression in neural stem cells by PCR and effectively restored motor function after SCI within 21 days after injection into mice with spinal cord injury. Due to the addition of a Cy3 light-emitting group, red fluorescence could be detected after transfection into the cells. Through this experiment, it was demonstrated that a large number of cells could emit red fluorescence after transfection with small nucleic acid molecules, and the results of fluorescence quantitative PCR showed that the expression of miR-31 was significantly upregulated in the miR-31agomir group (P�  0.001) and downregulated in the miR-31antagomir group compared with the control group (P�  0.01), indicating that the synthesized small nucleic acid molecules could effectively regulate the expression of miR-31 in BMSCs and thus determine the cell fate. And it was demonstrated that it could effectively restore the motor function of mice after SCI when injected with pretreated cells. The revised section is on lines 482-511 of the article. 3、All images/figures are of a low resolution, this must be improved. Thanks to the editors and reviewers for the questions I have answered as follows: All figures in the text have been revised and increased in resolution. The revised figure has been submitted separately. 4、the conclusion is too short and abrupt, this needs expansion and justification. Thanks to the editors and reviewers for the questions I have answered as follows: In this study, in vitro experiments demonstrated that at 48 h, 50�  M miR-31agomir significantly promoted the proliferation of BMSCs, showing a time-dependent increase compared to 24 h, and its effect was verified by cell cycle analysis. The time-dependent promotion of miR-31 on the migration of BMSCs was demonstrated by migration assays. Thus, miR-31 was shown to promote the proliferation and migration of BMSCs. In the in vitro experiments, the relative fluorescence intensity of cells in mice demonstrated that the cells had the strongest migration ability at day 5 and 7, and the efficacy of miR-31 on the repair of motor function in SCI mice was demonstrated by BMS score.Therefore, this experiment demonstrated that miR-31 promoted the migration and proliferation of BMSCs by upregulating the expression of MMP-2 and CXCR4 to repair and improve the motor function of damaged tissues in SCI. However, whether it acts on CXCR4/AKT requires further studies to understand its detailed mechanism of action. The revised section is on lines 518-530 of the article. 5、Avoid keywords with the words used in the title, this method decreases a future search by your paper. Use keywords related to the theme. Thanks to the editors and reviewers for the questions I have answered as follows: Key words: Marrow mesenchymal stem cells (MSCs); Anti-inflammation; miR-31; Cell migration; Spinal cord injury (SCI) The revised section is on lines 41-42 of the article. 6、Let your text easy to the reader, for example: " (i) 1 mL syringe, (ii) aspirate the medium, (iii) collect the buffer, (iv) centrifuge and discard the supernatant, and (v) mix the precipitate". Thanks to the editors and reviewers for the questions I have answered as followsAnswer: Both ends of the bone were cut using tissue scissors, and following procedures were successively performed: (i) the bone marrow cavity was flushed three times using a 1 mL syringe; (ii) the culture medium containing bone marrow was collected; (iii) he supernatant was discard after centrifugation; (iv) the cell pellet was resuspended in DME/F-12 (Gibco, US); and (v) the resuspended cells were used to inoculate T25 culture flasks (Corning, US) to form a single cell layer. The revised section is on lines 112-117 of the article. 7、You applied parametric tests, however, your data are parametric? Shapiro-Wilk was tested ? Thanks to the editors and reviewers for the questions I have answered as follows: We used the Student's T test to determine whether the data were normally distributed. Continuous data were expressed as mean ± standard deviation. One-way ANOVA and t-test were used for comparison between groups. All data were analyzed using SPSS 25.0 (IBM, NY, USA). Statistical graphs were produced by GraphPad Prism8 software (GraphPad,CA,USA), and a P < 0.05 was considered statistically significant. The revised section is on lines 231-236 of the article. 8、To comply with PLOS ONE submissions requirements, in your Methods section, please provide additional information on the animal research and ensure you have included details on (1) methods of sacrifice, (2) methods of anesthesia and/or analgesia, and (3) efforts to alleviate suffering. Thanks to the editors and reviewers for the questions I have answered as follows: During the experiments, 3% sodium pentobarbital was used for anesthesia to reduce animal pain, and mice were euthanized after high-dose anesthesia at the time of sampling. The revised section is on lines 101-103 of the article. Submitted filename: Response to Reviewers.docx Click here for additional data file. 21 Jul 2022 MiR-31 improves spinal cord injury in mice by promoting the migration of bone marrow mesenchymal stem cells PONE-D-21-40503R1 Dear Dr. Chunfang Wang, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Catherine Berry, PhD, MSc, BSc Academic Editor PLOS ONE Additional Editor Comments (optional): The revised manuscript did take on board the suggestions given following the original submission by both the reviewer and the editor. All corrections were included and outlined clearly in the author's letter. 26 Aug 2022 PONE-D-21-40503R1 MiR-31 improves spinal cord injury in mice by promoting the migration of bone marrow mesenchymal stem cells Dear Dr. Wang: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Catherine Berry Academic Editor PLOS ONE
  47 in total

1.  Aberrant expression of LncRNA-MIR31HG regulates cell migration and proliferation by affecting miR-31 and miR-31* in Hirschsprung's disease.

Authors:  Peng Cai; Hongxing Li; Weiwei Huo; Hairong Zhu; Chao Xu; Rujin Zang; Wei Lv; Yankai Xia; Weibing Tang
Journal:  J Cell Biochem       Date:  2018-04-06       Impact factor: 4.429

Review 2.  Metazoan MicroRNAs.

Authors:  David P Bartel
Journal:  Cell       Date:  2018-03-22       Impact factor: 41.582

Review 3.  Matrix metalloproteinase functions in hepatic injury and fibrosis.

Authors:  Martin Roderfeld
Journal:  Matrix Biol       Date:  2017-12-06       Impact factor: 11.583

4.  Fate decision of satellite cell differentiation and self-renewal by miR-31-IL34 axis.

Authors:  Yang Su; Yingying Yu; Zhengquan Yu; Qingyong Meng; Chuncheng Liu; Yuying Zhang; Chang Liu; Mengxu Ge; Lei Li; Miaomiao Lan; Tongtong Wang; Min Li; Fan Liu; Lei Xiong; Kun Wang; Ting He; Jianyun Shi; Yongli Song; Yaofeng Zhao; Ning Li
Journal:  Cell Death Differ       Date:  2019-07-22       Impact factor: 15.828

Review 5.  MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.

Authors:  Rajesha Rupaimoole; Frank J Slack
Journal:  Nat Rev Drug Discov       Date:  2017-02-17       Impact factor: 84.694

6.  Anti-apoptotic effect of microRNA-21 after contusion spinal cord injury in rats.

Authors:  Jian-Zhong Hu; Jiang-Hu Huang; Lei Zeng; Guan Wang; Min Cao; Hong-Bin Lu
Journal:  J Neurotrauma       Date:  2013-07-17       Impact factor: 5.269

7.  Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs.

Authors:  Kun-Hung Shen; Jui-Hsiang Hung; Yi-Ching Liao; Shu-Ting Tsai; Ming-Jiuan Wu; Pin-Shern Chen
Journal:  Int J Mol Sci       Date:  2020-04-27       Impact factor: 5.923

8.  MicroRNA-126 promotes proliferation, migration, invasion and endothelial differentiation while inhibits apoptosis and osteogenic differentiation of bone marrow-derived mesenchymal stem cells.

Authors:  Ruina Kong; Jie Gao; Lianmei Ji; Dongbao Zhao
Journal:  Cell Cycle       Date:  2020-08-13       Impact factor: 4.534

9.  Repairing and Analgesic Effects of Umbilical Cord Mesenchymal Stem Cell Transplantation in Mice with Spinal Cord Injury.

Authors:  Ling-Ling Wu; Xiao-Ming Pan; Hao-Hao Chen; Xiao-Yan Fu; Jinzhan Jiang; Ming-Xing Ding
Journal:  Biomed Res Int       Date:  2020-04-04       Impact factor: 3.411

10.  MicroRNA-31-5p Exacerbates Lipopolysaccharide-Induced Acute Lung Injury via Inactivating Cab39/AMPKα Pathway.

Authors:  Wan-Li Jiang; Kao-Chang Zhao; Wen Yuan; Fang Zhou; Heng-Ya Song; Gao-Li Liu; Jie Huang; Jin-Jing Zou; Bo Zhao; Song-Ping Xie
Journal:  Oxid Med Cell Longev       Date:  2020-10-08       Impact factor: 6.543

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.