Multiplex short tandem repeat profiling of immortalized hepatic stellate cell line Col-GFP HSC.

Misidentification, cross-contamination and genetic drift of continuous animal cell lines are persistent problems in biomedical research, leading to erroneous results and inconsistent or invalidated studies. The establishment of immortalized hepatic stellate cell line Col-GFP HSC was reported in PLoS One in the year 2013. In the present study a multi loci short tandem repeat signature for this cell line was established that allows for unique cell line authentication.

Introduction

In the latest version of the register of misidentified cell lines published on 8 June 2021 by the International Cell Line Authentication Committee (ICLAC) currently lists 576 misidentified cell lines [1]. In most cases, this problem results from poor and inattentive handling of cell lines combined with a lack of routine quality control. To mitigate wasted research efforts and false claims in the literature, many biomedical research funding entities, such as the NIH have announced review criteria to enhance reproducibility of research findings through increased scientific rigor and transparency. In particular, special attention is given to authentication of biological materials such as cell lines [2]. Similarly, several scientific journals have included instructions or requirements for cell line authentication in their author guidelines. PLoS One for example notes in respective guidelines “Cell line authentication is recommended–e.g., by karyotyping, isozyme analysis, or short tandem repeats (STR) analysis–and may be required during peer review or after publication” [3].

The current recommended method for cell authentication is short tandem repeat (STR) profiling [4]. A STR, also known as a microsatellite, is a non-coding, short DNA sequence composed of a number of variable repeats of two to ten nucleotides in length. In regard to human cell lines, STR profiling has been identified in 2010 as an important step to eradicate incorrectly identified cell lines [5]. Some years later, efforts were also started to develop strategies for authentication of mouse cell lines. In a landmark paper published by the National Institute of Standards and Technology (NIST), a multiplex PCR assay based on nine STR markers was established that is suitable to authenticate individual mouse cell lines [6]. Several years later, a Consortium for Mouse Cell Line Authentication consisting of 12 participating laboratories was formed representing institutions from academia, industry, biological resource centers, and government with the aim to validate an extended STR marker set [7]. In the mentioned study, the respective multiplex PCR panel of mouse STR markers consisting of 19 loci was shown to be capable of discriminating at the intra-species level between 50 commonly used mouse cell lines [7].

Nowadays, reputable cell repositories including the American Type Culture Collection (ATCC), German Collection of Microorganisms and Cell Cultures (DSMZ), RIKEN Cell Bank (RCB), and the Japanese Collection of Research Bioresources (JCRB) have established authentication guidelines and maintain cell line databases that include thousands of individual cell lines. When depositing a new cell line in one of these repositories, the cell line undergoes rigorous identity and quality controls, notably authentication by STR profiling before making them available to the scientific community. As such, cell banks should be able to provide a certified DNA STR profile for each cell line distributed.

Several years ago, we generated and characterized a novel continuous cell line termed Col-GFP HSC. This cell line was derived from primary hepatic stellate cells (HSC) that were isolated from a transgenic mouse expressing green fluorescent protein (GFP) under control of the collagen α1(I) promoter/enhancer [8]. The cells were immortalized by infection with a lentivirus vector containing the Simian virus large T antigen (SV40T) and a hygromycin resistance cassette [8]. Because these cells are responsive to pro-fibrogenic stimuli, such as PDGF or TGF-β1, and are able to activate intracellular signalling pathways including Smads and MAP kinases, this cell line is a promising tool which can be used to investigate special issues of fibrogenic signaling. We have received many requests to offer this cell line to other laboratories, however, a reference genetic profile for this new cell line was not yet established.

This study reports an STR profile for this cell line including the electropherogram images that can be used as a unique fingerprint of Col-GFP HSC. The STR profile consists of the 19 species-specific markers that were proposed by the Consortium for Mouse Cell Line Authentication for authentication of mouse cell lines. This newly established reference profile can now be included in subsequent publications or grant applications to fulfill the need for authentication of key biological resources when working with Col-GFP HSC.

Materials and methods

Cell culture

Col-GFP HSC cells were routinely propagated in 10 cm Petri dishes and cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1 x Penicillin/Streptomycin, 1 mM sodium pyruvate, and 2 mM L-Glutamine. Medium was exchanged every second day and detachment of cells for subculturing was completed using Accutase solution (#A6964, Sigma-Aldrich, Merck, Darmstadt, Germany). The cells were isolated at 80% density for STR profiling, which is about 8 x 106 cells per 10 cm dish.

Short tandem repeat profiling

STR profiling and interspecies contamination for Col-GFP HSC was performed by a commercial service provided (IDEXX, Kornwestheim, Germany). In the respective assay, (i.e., the CellCheck Mouse 19 panel), the cells were genotyped using a panel of 19 mouse STR markers that have been described previously [6, 7]. The respective primers that are used in this assay for individual markers are given in Table 1.

Table 1

Primers used in the mouse multiplex PCR assay.

Marker	Forward Primer (5’→3’)	Reverse Primer (5’→3’)
1–1	CCCTTCACTCCTTCATTCCA	TGAGCCTAAGGACCTGGACA
1–2	TCTTTAAAAATCAAACAGGCAAA	GGGGAGGTTGGGGTGTATAA
2–1	ACAACTTCAAACTTTGCTGGAA	TCCTGCTTAGCTTGTCATTTCC
3–2	TGAGCTACCATGTGGGTACA	CACACACACACACAAAGATGGA
4–2	AAGCTTCTCTGGCCATTTGA	TTCATAAACTTCAAGCAATGACA
5–5	CGTTTTACCTGGCTGACACA	TGGTTTAAAACTCAATACCAAACAA
6–4	TTTGCAACAGCTCAGTTTCC	AATCGCTGGCAGATCTTAGG
6–7	AGTCCACCCAGTGCATTCTC	CATGTGGCTGGTATGCTGTT
7–1	ACACCAGTTGGGGACTAGGA	AACTGGTGCTGGGTCTGAAC
8–1	AGTAATATCCTGGTCCTGGCC	GAGCTCACTATGTAGCTATTGGA
9–2*	GGATTGCCAAGAATTTGAGG	TCCTGAGTTGTGGACAGGGTTA
11–2	AAGGCAGGGGAATTCACAGT	TCTCACCATTGCAGTCCTGA
12–1	TTTCAAAATTGTCATTGAACACA	TGGTCCTTCAGTATCATCCTTG
13–1	AACTCCCACTGCTTCTTGGT	GCCAAAGTAAACCCTTCTCCC
15–3	TCTGGGCGTGTCTGTCATAA	AGGCTATCTAAACTTGACATGCT
17–2	CTCTTCTCCATCCGTCCATC	ATGGCTCTTGCCACAAATCT
18–3	TCTTTCTCCTTTTGTGTCATGC	GCTAAATAACTAAGCAAGTGAACAGA
19–2	AGGCTAGCACTGTTCCTTGT	ACTCAGCACCTTCCATCCTG
X-1	AACAAAAATGTCCCTCAATGC	AAGGTATATATCAAGATGGCATTATCA

* Information of primer pair for marker 9–2 was taken from [6], all other primer pairs were taken from [7]. Forward primers are given without fluorescent dyes at their 5’ ends and reverse primers are given without the “PIGtail” sequences (a 7-nucleotide tag with sequence GTTTCTT) that are used in this assay to promote complete adenylation. For more details of this multiplex PCR assay please refer to the original publication in which this assay was established [7].

This system establishes a genetic microsatellite marker profile and allows the detection of as little as 5% interspecies cross-contaminations. Individual markers were analyzed by GeneMapper software 6. The determined STR profile of Col-GFP-HSC was deposited in the Cellosaurus database under accession no. CVCL_B7MI. An STR similarity search was performed using the CLASTR 1.4.4 matching tool, which can be found on the Cellosaurus STR database (release 41.0) [9]. The settings for the search were set to the following: Scoring algorithm: Tanabe, Mode: Non-empty markers, Score filter: 70%, and Min. Markers: 8. This scoring algorithm gauges the similarity of two samples. It is simply defined as: Percent match = (number shared alleles x 2) / (total number of alleles in the questioned profile + total number of alleles in the reference profile) [10].

Results and discussion

Cross-contamination and misidentification of mammalian cell cultures is widespread, leading to thousands of misleading and potentially erroneous published papers [5]. In 2017 a conservative estimate found that 32,755 articles reported research results with misidentified cells [11]. Moreover, the mentioned study revealed that over 92% of these ‘contaminated’ papers is cited at least once, spreading potential misleading information as a ‘secondary contamination’ to the scientific community. Therefore, establishing a cell line’s identity prior to performing experiments is essential to conduct valid and reproducible research.

The Col-GFP HSC cell line was established nearly ten years ago [8]. The cell line was derived from primary hepatic stellate cells (HSC) isolated from a Col-GFP transgenic reporter mouse model. Immortalization was achieved by infecting respective cells with a lentiviral vector containing the SV40T and a hygromycin resistance cassette. As such, the cells express green fluorescent protein, SV40T, and a characteristic set of HSC marker genes including α-smooth muscle actin (α-SMA), vimentin, desmin, and collagen type I [8]. Moreover, the cells are sensitive towards ligands involved in fibrosis and can be indirectly used to monitor the regulation of Collagen IαI expression [12]. Therefore, this cell system is an ideal experimental tool for cell-tracking experiments, co-culture systems or any other kind of studies in which cells of HSC origin should be investigated. However, the mentioned features are not necessarily specific for this cell line. The viral oncogene SV40T is a widely used agent to obtain immortalization or conditional reprogramming in primary cells [13]. Similarly, GFP and its derivatives have gained widespread use as a reliable and easily traceable reporter of gene expression or cellular structures in individual eukaryotic cells [14, 15].

Therefore, and to fulfill actual requirements and standards for authentication of a cell line, we established a genetic profile for Col-GFP HSC that is based on 19 species-specific STR markers (Fig 1, Table 2).

Fig 1

Electropherograms for Col-GFP HSC resulting from analysis of 19 consensus markers.

DNA from Col-GFP HSC cells was isolated and the genetic profile determined using the STR markers 1–1, 1–2, 2–1, 3–2, 4–2, 5–5, 6–4, 6–7, 7–1, 8–1, 9–2, 11–2, 12–1, 13–1, 15–3, 17–2, 18–3, 19–2, and X-1, respectively. In this assay, the threshold of the assay was set to 100 relative fluorescence units (RFU).

Table 2

Short tandem repeat (STR) marker profile of Col-GFP HSC.

SN	STR Marker	Known Allele Range*	Chromosomal Location	Allele
1	1–1	10–19	1	16
2	1–2	12–30.1	1	19
3	2–1	8–17.1	2	15
4	3–2	9–25	3	14
5	4–2	13–23.3	4	20.3
6	5–5	11–22	5	17
7	6–4	12.2–21	6	18
8	6–7	11–26	6	17
9	7–1	19.2–33.2	7	26.2,27.2
10	8–1	6–19	8	16
11	9–2	7.1–19	9	18
12	11–2	12–26.2	11	16
13	12–1	15–24.1	12	17
14	13–1	11–20.1	13	17
15	15–3	12–31.3	15	22.3
16	17–2	11–22	17	15
17	18–3	13–28	18	16,17
18	19–2	10–16	19	13
19	X-1	15.2–37	X	27

* The term “known allele range” corresponds to the number of repeats that might exist at the analyzed polymorphic marker sites. The allele range for STR marker 9–2 was taken from [6], all other allele ranges were taken from [7].

To determine if the genetic profile for Col-GFP HSC was unique, the CLASTR search tool in the Cellosaurus database was utilized. The profile search using the Cellosaurus STR database (release 41.0) containing 77 mouse cell lines revealed that Col-GFP HSC has the highest homology to cell lines AT-3 (CVCL_VR89; 82.93%), YUMMER1.7-H2B-GFP5 (CVL_A2AY, 80.00%), DC2.4 (CVCL_I409, 78.05%), MS1 (CVCL_6502, 78.05%), YUMM1.7 (CVCL_JK16, 76.92%), MCA-205 (CVCL_VR90, 76.19%), and MLTC-1 (CVCL_3544, 73.17%), respectively (Table 3).

Table 3

CLASTR matching algorithm results for mouse STR profiles most similar to Col-GFP HSC to known STR profiles listed in Cellosaurus database*.

STR Marker	Col-GFP HSC	AT-3	YUMMER1.7-H2B-GFP5	DC2.4	MS1	YUMM1.7	MCA-205	MLTC-1
1–1	16	16	16,17	17	17	16,17	16	16
1–2	19	19	19	19	19	19	19	19,20
2–1	15	16	16,17	16	16	16	16	16
3–2	14	14	14	14	14	14	13,14	14,15
4–2	20.3	20.3	20.3	21.3	20.3	20.3	20.3	20.3,21.3
5–5	17	17	17	17	17	17	17	17
6–4	18	18,19	18	18	18	18	18	18
6–7	17	15	17	17	16,17	17	14,15	16
7–1	26.2,27.2	26.2,27.2	27.2	26.2,27.2	26.2	27	26.2	26.2
8–1	16	16	16	16	16	16	16	16
11–2	16	16	16	16	16	16	16	16
12–1	17	17,18	17	17	17	17	17,18	17
13–1	17	17	17	17	17	17	17	17
15–3	22.3	22.3	22.3	22.3,23.3	22.3	22.3	22.3	22.3
17–2	15	15	16	16	15,16,17	16	15	15
18–3	16,17	16	16	16	16	16	16	16
19–2	13	13	13	13	13	13	13,14	13
X-1	27	27	27	27	27	27	27	28

* The search was done on April 15, 2022 at the Cellosaurus STR database (release 41.0) that contains 77 mouse cell line profiles. Given values correspond to the number of repeats that are found at the analyzed STR marker sites. When the two alleles have the same number of repeats at a specific variant site, only one number is given, while two numbers indicate that the two alleles of this STR marker are different in regard to repeat length. In the case that three numbers are listed, it is most likely that the respective variant region is amplified in the respective cell line.

The determined STR profile provides the power to discriminate Col-GFP HSC from other cell lines of mouse origin and is also suitable to detect interspecies contamination [6, 7, 16]. In the future, this STR profile should be used as a reference for authentication of this line. As such, it is another small step to implement the efforts to enhance reproducibility of research findings through increased scientific rigor and transparency by authenticating key biological materials, including cell lines.

We have not performed a karyotype analysis for this cell line yet, which would be an additional alternate that could be used for cell authentication. Such analysis has been done previously in our laboratory for two other hepatic stellate cell lines from mouse and rat [17, 18]. The observed numerical and structural chromosomal abnormalities in these cell lines were proposed as an alternate strategy that could be used for cell authentication. In addition, there are many other methods for cell authentication available including isoenzyme analysis, next generation-based single nucleotide profiling, and DNA fingerprinting, but STR profiling has become accepted as the simplest method to identify cross-contamination and cell misidentification [19].

14 Jun 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Pankaj Bhardwaj, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"The laboratory of R.W. is supported by the German Research Foundation (grants WE2554/13-1, WE2554/15-1, and WE2554/17-1)."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The research article entitled ‘Multiplex Short Tandem Repeat Profiling of Immortalized Hepatic Stellate Cell line Col-GFP HSC’ by Steffen K. Meurer et al provides STR profile for identification of mouse cell line termed as-Hepatic Stellate Cell line Col-GFP HSC. This cell line is an important tool to investigate fibrogenic signalling especially using PDGF, TGF-β1 etc. The reported information in this paper is useful to wider researcher community working with the different mouse/human cell lines. Therefore, I recommend the paper for publication, however following issues need to be addressed.

1. It is difficult to read the figure1 therefore use better resolution of figure 1.

2. It may be advised to rephrase the sentence ‘In this study… cell line authentication (line 15-16)’. It gives impression that this sentence is refering to PLoS One paper in the year 2013.

3. Line 58 check spelling of ‘stimuli’.

4. Table 1- What does the ‘allele range mean’? It may be mentioned in the table legends or may be inserted in the text somewhere.

5. Table 1- if the information on the primers and PCR size is available/ or in the public domain then it may be inserted.

6. Insert some statement on the significance of STR profile homologies. Refer line 123-127.

7. Provide the information on what the different numbers in the table 2 refer to? and what they signify?

Reviewer #2: This is a nice efforts by authors to authenticate their own cell line. However, there are serious lapses in introduction and discussion part.

1. Authors may discuss pros and cons of various cell line characterization methods, perhaps a tabular comparison will be nice.

2. there is no karyotyping or any other supporting data regarding the cell line. How does the karyotypes look in low passage versus high passage cells, specially focusing on any major abnormalities. it would be very nice if authors could include 2 karyotypes.

3. There is no discussion about the results. please elaborate. Also readers would like to know if you have/planned to develop any PCR multiplex for the characterization of your cell line.

Reviewer #3: Major comments

The authors have profiled the cell line using STR markers which will help to identify the cell line in future. However, this information alone is not sufficient enough to be published as an independent article. This needs to be clubbed with some additional data such as comparison between cell lines of same origin or other related cell lines used by researchers and the identification of any unique marker(s) that will help to differentiate these cell line from one another.

Minor comments

Repetition of text at several places.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Dr. Ram Gopal Nitharwal

Reviewer #2: Yes: sandeep singh

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: review_comments.docx

Click here for additional data file.

15 Jul 2022

Reviewer #1

The research article entitled ‘Multiplex Short Tandem Repeat Profiling of Immortalized Hepatic Stellate Cell line Col-GFP HSC’ by Steffen K. Meurer et al provides STR profile for identification of mouse cell line termed as-Hepatic Stellate Cell line Col-GFP HSC. This cell line is an important tool to investigate fibrogenic signalling especially using PDGF, TGF-β1 etc. The reported information in this paper is useful to wider researcher community working with the different mouse/human cell lines. Therefore, I recommend the paper for publication, however following issues need to be addressed.

Dear Dr. Nitharwal,

Many thanks for the thoughtful review of our work and your critique. We have addressed your comments as stated in the point-to-point response. In the revised version we have marked all changes in red letters.

1. It is difficult to read the figure1 therefore use better resolution of figure 1.

We fully agree with your concern. In the pdf file that you reviewed the overall quality of figure 1 was insufficient. As suggested, we have increased the resolution of respective figure and hope that it now looks better in the pdf file that is manually produced by the online submission system. However, please note that the resolution in the pdf file generated by the online system is set to low resolution. For final quality refer to the TIF file of the image.

2. It may be advised to rephrase the sentence ‘In this study… cell line authentication (line 15-16)’. It gives impression that this sentence is referring to PLoS One paper in the year 2013.

Thanks for this suggestion. We have rephrased the mentioned sentence to “In the present study …..”.

3. Line 58 check spelling of ‘stimuli’.

We are sorry for this spelling error and corrected the term in the revised version.

4. Table 1- What does the ‘allele range mean’? It may be mentioned in the table legends or may be inserted in the text somewhere.

That is a great suggestion. We have now explained the term “allele range” in the footnote of table 1 (now table 2).

5. Table 1- if the information on the primers and PCR size is available/ or in the public domain then it may be inserted.

We have now compiled a new table in which we have added the primer information. In the new Table 1 we have added a footnote about the sources of primer sequences. All other tables were lined up.

6. Insert some statement on the significance of STR profile homologies. Refer line 123-127.

This is an important comment. For computation of the significance of a STR profile, we used the Tanabe score, which is also known as the Sørensen-Dice coefficient (see Capes-Davis et al., 2012). This score is used to gauge the similarity of two samples and is defined as follows:

Percent match = (number shared alleles x 2) / (total number of alleles in the questioned profile + total number of alleles in the reference profile)

The similarity can range between 0 (completely different) and 1 (identical).

The highest homology of Col-GFP HSC was found to cell line AT-3 (score= 0.8293).

To clarify this issue we have added a short sentence explaining the Tanabe score in the Material and method section and added the respective reference (new reference 10).

7. Provide the information on what the different numbers in the table 2 refer to? and what they signify?

The different numbers refer to the allele constellation at respective loci in the mentioned cell lines. We have added a short comment on that issue in the footnote of respective table (now table 3).

Reviewer #2

This is a nice efforts by authors to authenticate their own cell line. However, there are serious lapses in introduction and discussion part.

Dear Dr. Singh,

Many thanks for the thoughtful review of our work and your critique. We have addressed your comments as stated in the point-to-point response. In the revised version we have marked all changes in red letters.

1. Authors may discuss pros and cons of various cell line characterization methods, perhaps a tabular comparison will be nice.

We not attempt to provide a review about cell line characterization methods. However, to address your comment, we have added some brief comments at the end of the discussion section. In addition, we have added a reference in which pros and cons of various cell line characterization methods are discussed.

2. there is no karyotyping or any other supporting data regarding the cell line. How does the karyotypes look in low passage versus high passage cells, specially focusing on any major abnormalities. it would be very nice if authors could include 2 karyotypes.

We have recently published two other papers in which we provide karyotypes for the murine cell line GRX (Schröder et al., Cells 2022;11(9):1504) and the rat cell line HSC-T6 (Nanda et al., Cells 2022;11(11):1783). We have not made any attempt to provide a karyotype analysis in this paper because we have now deposited this cell line in a nonprofit cell repository (DSMZ, https://www.dsmz.de/). They will now further characterize this cell line before sending them out to laboratories who request this cell line. However, they requested from us to provide a STR profile that can be used as a reference for this cell lines. This was done in our paper without providing information about the karyotype. However, to address your concern we have added a short comment on the necessity of a karyotype analysis at the end of the discussion section.

3. There is no discussion about the results. please elaborate. Also readers would like to know if you have/planned to develop any PCR multiplex for the characterization of your cell line.

The assay that was used for genotyping is a PCR multiplex assay. We have added the respective primers used in this assay in new table 1. All other tables were lined up.

Reviewer #3

Major comments

The authors have profiled the cell line using STR markers which will help to identify the cell line in future. However, this information alone is not sufficient enough to be published as an independent article. This needs to be clubbed with some additional data such as comparison between cell lines of same origin or other related cell lines used by researchers and the identification of any unique marker(s) that will help to differentiate these cell line from one another.

Many thanks for the thoughtful review of our work and your critique. It is a pity that you are not as enthusiastic as the other two reviewers. We hope that we can convince you with the following presentations that our paper is worth to be published.

As you might know, the animal welfare law has dramatically changed in the EU. Therefore, there is an urgent need to have well-characterized cell lines for biomedical research. This is the reason why we recently established the genetic characteristics of murine hepatic stellate cell line GRX (Schröder et al., Cells 2022;11(9):1504) and rat hepatic stellate line HSC-T6 (Nanda et al., Cells 2022;11(11):1783). As we discuss in our short report, the cell line Col-GFP HSC was established in our lab several years ago. After all these years, we now receive many requests for this cell line. In particular, several scientists will use this cell line in cell tracking experiments, which is very simple with our cells because they carry a GFP reporter cassette.

The STR profile established in the present study is unique and allows rapid authentication of this cell line. We want to prevent that somebody use unauthenticated cells from our laboratory. As you might know the actual Register of Misidentified Cell Lines currently lists already 576 cell lines that are misidentified (https://iclac.org/databases/cross-contaminations/). It is well accepted that misidentified or contaminated cell lines will waste valuable time and resources on experiments and provide the basis for flawed publication. With the STR profile that we have established everybody working with this cell line will be now able to provide the required cell authentication that is requested by many journals and funding agencies. This is the intention of our short communication.

We hope you can follow us in our argumentation.

Minor comments: Repetition of text at several places.

We have tried to remove unnecessary redundancies.

Submitted filename: Rebutal letter.docx

Click here for additional data file.

22 Aug 2022

23 Aug 2022

Reviewer #1:

The revised version of the manuscript 'Multiplex Short Tandem Repeat Profiling of Immortalised Hepatic Stellate Cell line Col-GFP HSC' addresses all the specific concerns/points that were raised. The manuscript is recommended for publication.

Thanks again for all your input.

Reviewer #3:

It was quite unprofessional to use such a language. There is no need to take pity on anyone. My comments were professional and I stand by my comments. I have not questioned the quality of this study but didn't find the study enough to be published as an independent article. If others have recommend your article for publication as such it is completely their choice.

Dear reviewer #3,

We fully understand your displeasure. However, we had not the intension of taking pity on anyone. Quite the opposite, we are really grateful that you and the other reviewers helped to improve the quality of our work. We respect your opinion that you think that our study does not provide significant data to allow its publication. We agree that we only show a STR profile for the cell line that we established several years ago. In this regard our study is a small “add-on” to the previous paper that was published already nearly a decade ago (Meurer et al., PLoS ONE 2013;8(2):e56116). I guess everybody will realize that our paper is not a classical full paper but just a kind of addition. Nevertheless, this addition is very important because we have now deposited this cell line in a nonprofit cell repository (DSMZ, https://www.dsmz.de/). This will allow every researcher to obtain this cell line for research purposes. However, it is now well-accepted that a defined STR profile that allows easy cell authentication is mandatory when working with a cell line. This is the reason why we would like to publish our addition in the journal in which we originally described the generation of this continuous growing cell line.

We hope you understand our argumentation and are sorry if you think that we wanted to tackle you.

Reviewer #4:

Steffen Meurer and colleagues improved their manuscript entitled “Multiplex Short Tandem Repeat Profiling of Immortalized Hepatic Stellate Cell line Col-GFP HSC” (PONE-D-22-11946R1) and addressed major points raised by the reviewers. There are only a few minor aspects that the authors should address to further improve their manuscript:

Dear reviewer #4,

Many thanks for the time you spent in reading our short article. We are grateful for your thoughtful comments. In the revised version, we have addressed your minor comments and marked all changes in red letters.

General remark: An own analysis of the STR by the authors would have been better for this paper, because then a detailed protocol for the STR analysis would be available for the readers in the section "Material and Methods".

Yes we initially thought about doing that. However, we then realized that the customized 19 STR markers enclosed in the CellCheck Mouse 19 panel that were used in our study are essentially those that were proposed by the Consortium for Mouse Cell Line Authentication to validate STR markers for intraspecies identification of mouse cell lines (Almeida et al., PLoS ONE 2019;14(6):e0218412). This panel is nowadays widely applied in many laboratories and provides information on all markers that are necessary to allow a quick comparison with STR profiles form other cell lines at the Cellosaurus STR database (https://web.expasy.org/cellosaurus-str-search/). In our view, offering a protocol of our own would be rather confusion that purposeful.

A) Line 64: “for the cell line” (was used twice in one sentence)

We have rephrased the mentioned sentence in line 64.

B) Line 78: A 100 mm² culture dish does not exist and is certainly too small for 8 million cells. Probably a 10 cm (diameter) is meant here(?).

You are correct. It must read “10 cm dish”. We have corrected this error.

C) Line 81: “of Col-GFP HSC cells” (without cells). The abbreviation already contains the word cells.

Thanks for this comments. We have deleted “without cells”

D) Line 89: The term “PIGtail” must be defined and explained. Is it a 7-nucleotide tag?

Yes, in the protocol it refers to a 7-nucleotide tag with the sequence “GTTTCTT”. According to your advice, we have added this information.

E) Line 113: The term SV40 was already mentioned in the section “Introduction” (line 58). The abbreviation in the line 113 now differs from the former. A detailed description of SV40T should be given when mentioned first.

Many thanks for this comment. In the revised version, we have now introduced the abbreviation SV40T upon first mentioning and harmonized the abbreviation to SV40T for Simian virus large T antigen.

F) Line 154: Analysis of “interspecies contamination” was mentioned several times in the manuscript but was not shown by the authors. At least one appropriate citation should be given by the authors at this point.

Yes this is correct. We have added a new reference (Masters et al., Proc Natl Acad Sci U S A 2001;98:8012-7) and again cited the two references of Ameida et al. (Refs 6 and 7) that discuss that STR profiling is suitable to detect interspecies contamination in human and mouse cell lines.

Submitted filename: Response to reviewers.docx

Click here for additional data file.

24 Aug 2022

Multiplex Short Tandem Repeat Profiling of Immortalized Hepatic Stellate Cell line Col-GFP HSC

PONE-D-22-11946R2

Dear Dr. Weiskirchen,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Pankaj Bhardwaj, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

26 Aug 2022

PONE-D-22-11946R2

Multiplex Short Tandem Repeat Profiling of Immortalized Hepatic Stellate Cell line Col-GFP HSC

Dear Dr. Weiskirchen:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Pankaj Bhardwaj

Academic Editor

PLOS ONE