Inter-Relationship Between a Transcriptional Regulator of Flagella Genes cj0440c and Thiamine Metabolic Pathway in Campylobacter jejuni.

Campylobacter jejuni is a major cause of gastroenteritis in humans. It has been reported that the pathogenesis of C. jejuni is closely related to the formation, adhesion, and invasion of flagella toxin in host epithelial cells. A putative transcriptional regulator, known as cj0440c, is thought to be involved in the regulation of flagellar synthesis. However, confirmation of this hypothesis requires deep insight into the regulation mechanism of cj0440c and its possible relationship with different antibiotics. Therefore, the study explained here was designed to determine the relationship and function (phenotypically and genotypically) of cj0440c in the flagellar synthesis of C. jejuni NCTC11168. The study determined the mode of expression of cj0440c and flagella-related genes under exposure to various drugs. To verify the involvement of cj0440c protein in the metabolic pathway of thiamine, an enzymatic hydrolysis experiment was performed and analyzed through the application of mass spectrometry. The overexpression vector of C. jejuni NCTC11168 was also constructed to find out whether or not target genes were regulated by cj0440c. The findings of the study showed that cj0440c and other flagella-related genes were expressed differentially under the influence of various antibiotics including erythromycin, tylosin, azithromycin, gentamicin, etimicin, enrofloxacin, gatifloxacin, tetracycline, and tigecycline. The analysis showed that the cj0440c protein did not catalyze the degradation of thiamine. In conclusion, the study aids in the understanding of the inter-relationship between the regulatory mechanism of flagella genes and the thiamine metabolic pathway.

1. Introduction

Campylobacter jejuni (C. jejuni) is a pathogenic bacterium that is considered a major cause of food-borne diarrhea around the globe [1]. It is estimated that more than 400 million people each year are exposed to these bacteria and, as a consequence, develop gastroenteritis [2]. Humans may be infected via the consumption of contaminated poultry meat, milk, or water [3, 4]. Outbreaks of C. jejuni infection in humans are relatively rare. However, Campylobacter infection has serious consequences in those with autoimmune-mediated diseases such as Guillain-Barre syndrome and Miller-Fisher syndrome [5]. It has been found that the pathogenesis of Campylobacter is closely related to the formation, adhesion, and invasion of the toxin of the flagella in the host epithelial cells [6]. The motility of the flagella helps the bacteria to cross the membrane of intestinal epithelial cells [7]. Therefore, the role of flagella in C. jejuni virulence should not be underestimated.

The synthesis of C. jejuni flagella is a complex process; more than 50 genes such as flgS (Cj0793), flgR (CJ1024), and fliA (Cj0061) are involved in their synthesis and regulation [8]. Three sigma factors (σ, σ, and σ) are involved in the regulation of flagellar synthesis in C. jejuni. However, research on the regulatory mechanism of flagella has focused on the deletion mutation of known genes, and information is scarce regarding the cj0440c gene. Bioinformatic analysis reveals that cj0440c is a putative transcriptional regulator that encodes a TEN/THI-4 protein family, but the molecular function of this family has not been determined. This gene (cj0440c) is present upstream of cj0441 (which creates an acyl carrier protein, acpP) [9] and downstream of the cj0437-cj0439 operon, which plays a pivotal role in the susceptibility of Campylobacter to hydrogen peroxide (H2O2) [10, 11]. Hence, genes that lie both upstream and downstream of cj0440c are essential for Campylobacter's survival, growth, colonization, and pathogenesis. Although the cj0440c gene is present at opposite ends of the DNA coding strand, it can be divergently transcribed with its up-and-downstream genes and probably acts as a transcriptional regulator for several genes that are involved in the biosynthesis of flagella. However, the biological functions of cj0440c in C. jejuni are mostly unknown.

Due to the involvement of the cj0440c gene in the regulation of flagellar synthesis and the lack of information on the possible influence of antibiotic resistance, the study explained here was designed to determine the relationship and function (phenotypically and genotypically) of cj0440c in the flagellar synthesis of C. jejuni NCTC11168. To achieve that, the expression of cj0440c and other flagella genes during exposure to eight different kinds of antibiotics was detected through the use of reverse-transcription polymerase chain reaction (RT-PCR) preliminarily to detect the relationship between cj0440c and flagella genes. The cj0440c protein was expressed and purified, and a digestion experiment was designed that employed thiamine as the substrate to determine whether or not cj0440c was a thiaminase and can regulate directly the expression of flagella genes.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Culture Conditions

The C. jejuni NCTC11168 strain that was designated as sensitive (S) was obtained from the Chinese Centre for Disease Control and Prevention. The Escherichia coli strains and plasmids that were used in this study and their sources are listed in Table 1. Campylobacter strains were grown on plates that contained Skirrow Campylobacter selective agar (Hopebio, Qingdao, China) and were supplemented with 5% sterile defibrinated sheep blood at 42 °C under a microaerobic environment (85% N2, 10% CO2, and 5% O2). The C. jejuni NCTC11168 strain that was designated as resistant (R), which was resistant to different kinds of antibiotics, was procured from our laboratory (the China Ministry of Agriculture Laboratory for Risk Assessment of Quality and Safety of Livestock and Poultry Products, Huazhong Agricultural University, Wuhan, China). E. coli cells were grown at 37 °C in a shaking incubator (200 rpm) in Luria-Bertani (LB) medium. When necessary, LB media were supplemented with kanamycin (30 μg/ml) or ampicillin (100 μg/ml).

Table 1

Bacterial strain and plasmid used in the present study.

Name	Description
Bacterial strain
NCTC 11168	Campylobacter jejuni NCTC 11168 (S)
NCTC 11168	Campylobacter jejuni NCTC 11168 (R)
ATCC 33560	Campylobacter jejuni ATCC 33560
DH5α	E. coli strain for DNA manipulation
BL21	E. coli strain for DNA manipulation
Plasmid
pRY112	Cm-resistant C. jejuni/E. coli vector
pMD19-T simple	Amp-resistant E. coli vector
pET28-a	Km-resistant E. coli vector

2.2. Antimicrobial Susceptibility Assessment

The minimal inhibitory concentrations (MICs) of S and R against nine commercially available and frequently practiced antimicrobials, which were erythromycin (Ery), tylosin (Tyl), azithromycin (Azi), gentamicin (Gen), etimicin (Eti), enrofloxacin (Enr), gatifloxacin (Gati), tetracycline (Tet), and tigecycline (Tige), were determined by use of the broth microdilution susceptibility method, as described previously by the Clinical and Laboratory Standards Institute [12]. C. jejuni ATCC33560 was used as the quality control strain. The experiment was performed in triplicate.

The mutant prevention concentration (MPC) was defined as the lowest concentration of drug that prevented bacterial colony formation in a culture that contained >1010 bacteria. The determination was similar to that for the MIC, except that >1010 cells were tested at high drug concentrations (from 1 MIC to 128 MIC) and agar plates were used. Inoculated plates were incubated for 72 h. The minimum drug concentration that led to nonbacterial growth was the provisional MPC (MPCpr). The mutant selection window (MSW) was the drug concentration range between the MIC and the MPC.

2.3. Detection of Expression of Flagella Genes in C. jejuni by RT-PCR

Both strains (S and R) were induced by the addition of 0.5MPC of each of the eight antibiotics. The total RNA from each sample was extracted using the RNAprep pure cell/bacteria kit (Tiangen Biotech, Beijing, China). The quality and quantity of the RNA were determined by the application of formaldehyde denaturing gel electrophoresis and the use of a Nanodrop TM 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The cDNA was synthesized from the extracted RNA using a HiScript II one-step RT-PCR kit (Nanjing Vazyme Biotech Co, Nanjing, China).

The batches of cDNA of nine antibiotic-resistant bacteria and standard bacteria were subjected to RT-PCR to determine the expression of the flagellar genes, according to a previously described study [13]. Briefly, the PCR amplification was performed in the IQ5 Multicolor Real-time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The cycling conditions were as follows: 3 min of pre-incubation at 95 °C, followed by 45 cycles of 10s at 95 °C and 40s at 52 °C. The primer sets used for specific genes (cj0440c, cj1339c, cj1338c, cj0043, cj0697, and 16S) are listed in Table 2. It was decided to use 16S rDNA as an internal control for normalization. The experiment was performed in triplicate to obtain an average value for the fold change. A t-test was performed to analyze the significant difference between resistant bacteria and standard bacteria.

Table 2

Primers used for qRT-PCR in the current study.

Gene	Sequence (5′-3′)
Cj0440c-F	CGAGCTCATGcaccaccaccaccaccacATGCTTTTCTCTAATTTAATCA
Cj0440c-R	TCCCCGCGGTTAAAGATTTAATTCCATTCTTAAAGAA
CmeABC-F	GGACTAGTTAAATGGAATCAATAGCTCCAAAGC
CmeABC-R	CGAGCTCCAGGGTAAGTAAAACTAAGTGGTAA
Cj0440c-F1	CGGGATCCATGATGCTTTTCTCTAATTTAATCA
Cj0440c-R1	CCCTCGAGAAGATTTAATTCCATTCTTAAAGAA
Cj0440cF	AGTTGCTCTTAGTGCTTGCG
Cj0440cR	TGCTCCCAAAAAGCCACTTC
Cj1339cF	TCCATTAAACGGTTGATATCTGCTT
Cj1339cR	AAGGCTATGGATGAGCAACTTAAAAT
Cj0043F	GGGTTCTCCTGTTGCAAGTGA
Cj0043R	GCCCCTAAAACCCCAAAAAAT
Cj1338cF	TTACCATTGTTGATAGCTTGACCTAAA
Cj1338cR	TGCTTCAGGGATGGCGATA
Cj0697F	TGGTTCAGACCAAAGATGGA
Cj0697R	TGCCAGCATTCTGAGGATTA
16SF	GCTCGTGTCGTGAGATGTTG
16SR	GCGGTATTGCGTCTCATTGTAT

2.4. Construction of cj0440c Overexpression Mutants in C. jejuni NCTC11168

The DNA fragment of the cj0440c gene and promoter CmeABC was amplified from the C. jejuni NCTC11168 genome using Taq polymerase (Takara, Kusatsu, Shiga, Japan) with primers of cj0440c-F/R and CmeABC-F/R (Table 2). The cj0440c-F/R carried endonuclease restriction sites of Sac I and Sac II, while CmeABC-F/R carried endonuclease restriction sites of Sac I and Spe I. PCRs were performed in a total volume of 20 μl using 0.5 μl of each primer (10 μM), 2 μl of Taq polymerase buffer (10×), 1.6 μl of deoxynucleoside triphosphates (2.5 mM), 0.2 μl of Taq polymerase, and 200 ng of DNA template. The amplification program was as follows: initial denaturation at 95 °C for 5 min, denaturation at 95 °C for 30s, and annealing at 52 °C for 30s, followed by 35 cycles of extension at 72 °C for 1 min and an additional final extension at 72 °C for 5 min. PCR products were evaluated on a 1% agarose gel under ultraviolet light in the presence of ethidium bromide. After the reaction, the PCR products were analyzed on agarose gel, and the desired gene fragments were excised and purified through the use of a gel extraction kit (Omega Bio-tek Inc. Georgia, USA).

T4 DNA ligase enzyme (Takara, Kusatsu, Shiga, Japan) was used to connect cj0440c and CmeABC fragments by the same restriction sites (Sac I) to gain a new fragment Cme440. This new fragment was then cloned into a pMD19-T sample vector (Takara, Kusatsu, Shiga, Japan) to generate plasmid T-Cme440. Enzymatic double digestion (which involves cutting DNA with two restriction enzymes simultaneously) was used for Spe I and Sac II. A similar action was replicated on the vector pRY112. Insertion was performed at 16 °C using the T4 DNA ligase enzyme. The ligation product was transformed into DH5α by heat shock (at 4 °C for 30 min, 42 °C for 90s, and 4 °C for 2 min). Afterward, the transformed cells were restored through the addition of LB liquid medium to the transformants, and the mixture was incubated for 2 h. Bacteria were collected through the use of low-speed centrifugation. Finally, bacterial pellets were added to an LB medium that contained chloramphenicol to produce the recombinant clones that contained the vector. The clones were sent to the company for sequencing and the right plasmid was named pRY-Cme440.

2.5. Cloning, Expression, and Purification of cj0440c in E. coli

The size of the target gene cj0440c (Gene ID: 904765) was 666 bp. The DNA fragment of the cj0440c gene was amplified from the C. jejuni NCTC11168 genome through the use of Taq polymerase (Takara, Kusatsu, Shiga, Japan) with primers of cj0440c-F1/R1 (Table 2) that carried endonuclease restriction sites of BamH I and Xho I. The vector (pET28a) was of size 5369 bp and carried a kanamycin resistance gene and different restriction sites for various enzymes. The expression vector was constructed through the use of the method described above and was named the expression vector P-440.

2.6. Inducible Expression and Purification of cj0440c Protein

The expression host E. coli BL21 was used for the expression of recombinant protein cj0440c. Induction of the bacteria that contained P-440 was performed by overnight culture in the presence of 50 μg/ml kanamycin. Bacterial culture (200 μl) was grown in broth media and transferred to 20 ml of fresh liquid medium. The growth of bacterial culture was monitored by an optical density (OD) spectrophotometer at 600 nm. Isopropyl-β-d-thiogalactoside (IPTG) was added when the OD600 value reached 0.6 to induce the protein expression. The best conditions for expression of cj0440c protein were found to be 0.1 mM IPTG at 25 °C for 20 h with the use of E. coli BL21 (DE3) cells.

The recombinant protein contained N-terminal 6 × His tags and C-terminal 6 × His tags. It was purified from the cell lysate through the use of nickel-nitriloacetic acid (Ni-NTA) affinity chromatography. The E. coli BL21 cells, which contained P-440 after induction, were harvested by centrifugation at 4000 rpm for 20 min. The cells were resuspended in ice-cold phosphate-buffered saline (PBS) and sonicated at 50% power for 30 min. The cell lysates were centrifuged at 12000 rpm for 30 min at 4 °C. The supernatant was incubated with 100 μl Ni-NTA Sepharose (GE Healthcare, Chicago, Il, USA) in 1.5 ml tubes at 4 °C for 2 h in a shaking incubator. The supernatant was washed with 1 ml of Ni-NTA wash buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, and 300 mM imidazole). Next, the bound proteins were eluted in 1 ml of Ni-NTA elution buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl, and 500 mM imidazole). The eluted protein was run through a 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) system and then transferred to a polyvinylidene difluoride (PVDF) membrane and immunoblotted with anti-His antibody.

2.7. Detection of the Role of cj0440c in Thiamine Metabolism

TenA can catalyze thiamine degradation to 4-methyl-5-(2-hydroxyethyl) thiazole (THZ) and 4-amino-5-hydroxymethyl-2-methylpyrimidine (HMP) (Figure 1).

Figure 1

The degradation of thiamine into THZ and HMP catalyzing by TenA.

For qualitative assessment, thiaminase activity of cj0440c was identified by incubating different concentrations (15 μM, 20 μM, 25 μM, or 30 μM) of cj0440c and thiamine (2.5 mM) at room temperature in 50 mM tris(hydroxymethyl)aminomethane (tris buffer) (pH 8.0). A 100 μl aliquot of this reaction mixture was removed after 5 h and quenched by heating at 95 °C for 2 min. The reaction was repeated without cj0440c to produce the control, and then the compounds were analyzed by mass spectrometry (MS).

3. Results

3.1. Antimicrobial Susceptibility of C. jejuni NCTC11168 (S and R Strains)

The susceptibility of C. jejuni NCTC11168 (S and R strains) to each of nine antibiotics was determined. As expected, the C. jejuni NCTC11168 (R) showed higher resistance to the nine tested antibiotics than the S strain, as shown in Table 3. Likewise, high MPC and MSW were observed in the C. jejuni NCTC11168 (R) strain when compared with the S strain.

Table 3

The MIC, MPC, and MSW results of C. jejuni NCTC11168 (S) and C. jejuni NCTC11168 (R) for nine antibiotic drugs.

Name	NCTC11168 (S)		NCTC11168 (R)
	MIC (μg/mL)	MPC	MSW	MIC (μg/mL)	MPC	MSW
Erythromycin	0.125	2MIC	1-2MIC	0.5	2MIC	1-4MIC
Tylosin	0.5	2MIC	1-2MIC	2.0	4MIC	1-4MIC
Azithromycin	<0.125	2MIC	1-2MIC	0.5	4MIC	1-4MIC
Gentamicin	0.25	4MIC	1-4MIC	0.5	8MIC	1-8MIC
Etimicin	1.0	4MIC	1-4MIC	2.0	8MIC	1-8MIC
Enrofloxacin	0.125	8MIC	1-8MIC	4.0	32MIC	1-32MIC
Gatifloxacin	0.25	4MIC	1-4MIC	4.0	8MIC	1-8MIC
Tetracycline	0.125	32MIC	1-32MIC	16.0	128MIC	1-128MIC
Tigecycline	<0.125	8MIC	1-8MIC	0.25	64MIC	1-64MIC

3.2. Expression of cj0440c and Other Flagella-Related Genes in C. jejuni NCTC11168 (S and R Strains) Exposed to Antibiotics

The expression of flagella-related genes was measured through the use of real-time quantitative RT-PCR (qRT-PCR) during exposure to the macrolide, aminoglycoside, quinolone, and tetracycline groups of antibiotics. Among these genes, 16S rDNA was used as an internal control, cj1338c and cj1339c were those that transcribed the filament proteins, cj0043 was the gene for the flagellar hook protein, and cj0697 was the gene for the flagellar basal body protein. It is of note that these four genes are distributed in every part of the flagella. A trend toward increased expression of all genes including cj0440c in the presence of macrolides (Ery and Azi), aminoglycosides (Gen and Eti), quinolones (Enr and Gati), and tetracyclines (Tet and Tige) was observed in the study (Figures 2(a)–2(d)).

Figure 2

(a)–(d) The increased expression of Flagella-related genes by qRT-PCR under the exposure of different antibiotics in C. jejuni NCTC11168 (S & R) strains. (a) shows the increased expression of flagella-related genes under the exposure of macrolide antibiotics; (b) shows the increased expression of flagellar-related genes under the exposure of aminoglycoside antibiotics; (c) shows the increased expression of flagella-related genes under the exposure of quinolone antibiotics, and (d) shows the increased expression of flagella-related genes under the exposure of tetracycline antibiotics in C. jejuni NCTC11168 (S & R) strains.

3.3. The Western Blot Analysis of cj0440c Protein

A western blot analysis revealed the increased expression of protein under the influence of IPTG (Figure 3). The best conditions for induction of cj0440c protein were 20 h in 0.1 mM IPTG at 25 °C; the best purification conditions for this protein were its elution in 500 mM imidazole.

Figure 3

The expression of protein Cj0440c through western blot. Lane M is protein molecular weight 116 Marker; lane 1 is C. jejuni NCTC1118 control before induction; lane 2 is overexpression protein after induction by IPTG, and lane 3 is a purified protein.

3.4. Reaction of cj0440c with Thiamine

MS was used to determine the products of the reaction of catalyzed thiamine with different concentrations of cj0440c protein (Figures 4(a)–4(e)). Figure 4(a) represents the blank group that is without cj0440c. The molecular weight of thiamine is 337 kDa, that of THZ is 143 kDa and that of HMP is 139 kDa. There was no difference between the results for the experimental group and those for the blank group. MS analysis showed that the cj0440c protein did not catalyze the degradation of thiamine.

Figure 4

(a)–(e) The mass spectrogram of the product of cj0440c protein enzymatic hydrolysis. (a) The blank group (without cj0440c protein); (b) contains 15 μM cj0440c protein; (c) contains 20 μM cj0440c protein; (d) contains 25 μM cj0440c protein; (e) contains 30 μM cj0440c protein.

4. Discussion

Over the last decade, C. jejuni has become considered one of the leading causes of food poisoning in many countries including those in Europe [14]. Because of its public health significance, it is important to study the pathogenic mechanisms that are adopted by this bacterium. Among pathogenic mechanisms, the formation of flagella is key, as they aid bacterium motility, biofilm formation, adherence, and invasion into the host cell [15]. The cj0440c gene, a putative transcriptional regulator of several flagella-related genes, and its role in the biosynthesis of flagella is not fully understood. Therefore, the study described here was conducted to determine the association of this transcriptional regulator with other flagella-related genes. The determination was performed with the use of RT-PCR. It was observed through the use of MS analysis that cj0440c had no role in thiamine hydrolysis. It was also found that cj0440c was not involved directly in the regulation of flagella genes. Increased expression of cj0440c and other flagellar genes (cj1338c, cj1339c, cj0697, and cj0043) was found in C. jejuni NCTC11168 (S and R strains) upon exposure of the bacterium to eight different kinds of antibiotics. Flagella-related genes such as cj1338c, cj1339c, cj0697, and cj0043 are distributed in every part of the flagella, including the basal body, the hook, and the filament. These genes along with a putative transcriptional regulator (cj0440c) were upregulated upon exposure to antibiotics.

The outcomes of this study are in agreement with previous observations on the upregulation of the cj0440c gene in the EryrC. jejuni [16]. It is known that bacteria suffer a fitness cost during antibiotic resistance; however, numerous other factors are involved in the compensation for the adaptation weakness [14-18]. In this study, increased expression of flagella-related genes and cj0440c suggest that the putative transcriptional regulator may affect morphological changes of the flagella by taking part in the regulation of filament. One possible explanation is that cj0440c may be involved in compensating for the fitness cost of various antibiotics via a positive relationship with flagella-related genes. These findings are in agreement with those of a previous study [19].

It has been reported that the cj0440c gene may have a role in encoding the TenA/PQQC/THI-4 family of proteins. TenA proteins enhance the expression of extracellular enzymes such as alkaline proteases, levansucrases, and neutral proteases [20]. TenA is a thiaminase II [21], and it can catalyze the degradation of thiamine [22, 23]. This family also includes pyrroloquinoline quinone synthesis protein C (PQQC). This PQQC is a prosthetic group of numerous bacterial enzymes such as methanol dehydrogenase of methylotrophs and glucose dehydrogenase [24, 25]. Biosynthesis of PQQC in E. coli can be affected by the actions of the tldD gene, which is involved in the processing of small peptides [26]. This gene removes repression of the cdtB and lgeR genes, which may regulate some flagella genes [27]. However, the findings of the present study show that cj0440c is not an enzyme, and it cannot take part in the metabolic pathways of thiamine.

This study preliminarily explored the function of cj0440c; it contributed to the improvement of the genome informatics of Campylobacter, and it provided the theoretical basis for the study of the mechanism in Campylobacter. The limitation of the current study was that all the experiments were performed in vitro, and research methods on the regulatory mechanisms of prokaryotes are limited. Therefore, further study is required to understand the signaling pathway.

5. Conclusion

Owing to the potential of Campylobacter jejuni to cause health issues among public communities with the involvement of antibiotic resistance, the current study revealed that the transcriptional regulator known as cj0440c does not transcribe an enzyme; therefore, this gene may not be involved in the synthesis of thiamine. The outcome also revealed that C. jejuni NCTC11168 (R) showed higher resistance to the nine tested antibiotics than the S strain with increased expression of the cj0440c gene in the presence of macrolides, aminoglycosides, quinolones, and tetracyclines. The study aids in the understanding of the inter-relationship between the regulatory mechanism of flagella genes and the thiamine metabolic pathway.