| Literature DB >> 36036017 |
Kara N Thomas1, Katherine N Zimmel1, Alison Basel1, Alexis N Roach1, Nicole A Mehta1, Kelly R Thomas1, Luke J Dotson1, Yudhishtar S Bedi1, Michael C Golding1.
Abstract
Hormesis refers to graded adaptive responses to harmful environmental stimuli where low-level toxicant exposures stimulate tissue growth and responsiveness while, in contrast, higher-level exposures induce toxicity. Although the intergenerational inheritance of programmed hormetic growth responses is described in plants and insects, researchers have yet to observe this phenomenon in mammals. Using a physiologically relevant mouse model, we demonstrate that chronic preconception paternal alcohol exposures program nonlinear, dose-dependent changes in offspring fetoplacental growth. Our studies identify an inverse j-shaped curve with a threshold of 2.4 g/Kg per day; below this threshold, paternal ethanol exposures induce programmed increases in placental growth, while doses exceeding this point yield comparative decreases in placental growth. In male offspring, higher paternal exposures induce dose-dependent increases in the placental labyrinth layer but do not impact fetal growth. In contrast, the placental hypertrophy induced by low-level paternal ethanol exposures associate with increased offspring crown-rump length, particularly in male offspring. Finally, alterations in placental physiology correlate with disruptions in both mitochondrial-encoded and imprinted gene expression. Understanding the influence of ethanol on the paternally-inherited epigenetic program and downstream hormetic responses in offspring growth may help explain the enormous variation observed in fetal alcohol spectrum disorder (FASD) phenotypes and incidence.Entities:
Keywords: Fetal Alcohol Spectrum Disorder (FASDs); alcohol; developmental programming; epigenetic programming; genomic imprinting; hormesis; paternal; placenta
Year: 2022 PMID: 36036017 PMCID: PMC9405020 DOI: 10.3389/fcell.2022.930375
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
FIGURE 1A limited access model to study concentration-dependent, ethanol-induced changes in paternal epigenetic programming. (A) Schematic outline of the experimental approach used to model the impacts of increasing ethanol concentrations on offspring fetoplacental growth. The preconception exposure period lasted 6 weeks, with exposures continuing during the breeding phase, which lasted from weeks seven and fifteen († one Control, two Medium- and two High-concentration litters were sired between weeks sixteen and eighteen). (B) Fluid consumption patterns compared between the different treatment groups (n = 17 Control, 13 Low, 12 Medium, 13 High). (C) Comparison of average plasma alcohol levels between treatment groups, measured after 3 weeks of exposure, at the end of the daily treatment window (n = 3 Low, 4 Medium, 5 High). (D) Comparison of sire body weight throughout the 10-week preconception exposure window (n = 17 Control, 13 Low, 12 Medium, 13 High). We used one-way (C) and two-way ANOVAs (B,D) to assay differences between treatment groups. Error bars represent the standard error of the mean, *p < 0.05, **p < 0.01.
RT-qPCR primers.
| Gene | Forward | Reverse |
|---|---|---|
| Ywhaz | TTGATCCCCAATGCTTCGC | CAGCAACCTCGGCCAAGTAA |
| Pgk1 | AGATGCCAGGACCTGTATGCTT | TGTGCCAGGGTGGTGACTTTA |
| Slc22a18 | TGATGTCCAGTGTGCTCCAT | AGAGTTCGGGTCAATGGTTG |
| Slc3a2 | TGATGAATGCACCCTTGTACTTG | GCTCCCCAGTGAAAGTGGA |
| Slc38a2 | ACTCATACCCCACCAAGCAG | CACAATCGCATTGCTCAGAT |
| Slc38a4 | TGATTGGGATGTTAGTCTGAGG | GGCCTGGGTTAAAATGTGTG |
| Slc2a3 | GATCGGCTCTTTCCAGTTTG | CAATCATGCCACCAACAGAG |
| Tpbpa | TGAAGAGCTGAACCACTGGA | CTTGCAGTTCAGCATCCAAC |
| Cdkn1c | AACGTCTGAGATGAGTTAGTTTAGAGG | AAGCCCAGAGTTCTTCCATCGT |
| H19 | TGATGGAGAGGACAGAAGGGC | CTTGATTCAGAACGAGACGGACT |
| mPeg3 | TTCTCCTTGGTCTCSCGGGC | AAGGCTCTGGTTGACAGTCGTG |
| Ascl2 | TGCCGCACCAGAACTCGTAG | GCCTCGGTTGCTCCAGATC |
| Mt-ND5 | CCTGGCAGACGAACAAGACAT | GGCGAGGCTTCCGATTACTA |
| Mt-Cytb | CAATCGTTCACCTCCTCTTCCT | GAGCGTAGAATGGCGTATGC |
| Mt-Co1 | CAATAGTAGAAGCAGGAGCAGGAA | GTTTAGGTTGCGGTCTGTTAGTAGT |
| Mt-Nd1 | ATTCTAATCGCCATAGCCTTCCT | TGGGTGTGGTATTGGTAGGGG |
| Atp5e | GACAGGCTGGACTCAGCTAC | CCCGAAGTCTTCTCAGCGTT |
| Atp5mf | CGGACACCAGGACTTCAAGAT | GGGACCCCTCTTCAGTGGA |
| Atp5l | TACTCGAAGCCTCGATTGGC | AGGGATTTCAGCAGGGGTTG |
Statistical analyses associated with each figure.
| Graph | Statistical test | Sample size | Outliers | |
|---|---|---|---|---|
|
| ||||
| B. Sire fluid consumption by treatment week | Two-way ordinary ANOVA, multiple comparisons using uncorrected Fisher’s LSD, only comparisons to Control were performed |
| 0 | |
| C. Sire plasma alcohol levels | One-way ordinary ANOVA, multiple comparisons using uncorrected Fisher’s LSD |
| 0 | |
|
| ||||
| A-F. Testes, seminal vesicle, epididymal tract, liver, pancreas, spleen normalized to body weight | We inserted organ weights into Excel and combined the weights for paired (eg., left right testis) tissues, then divided by total body weight | A-C. | 0 | |
| D-F. | ||||
| G. | ||||
|
| ||||
| A-G. Gestational sac weight, crown-rump length, fetal weight, placental weight, placental diameter, placental efficiency, brain to body weight | Two-way ordinary ANOVA, multiple comparisons using uncorrected Fisher’s LSD, only comparisons to Control were performed | A-D/F. Males: | A-C & E-G. 0. D. Male: 2 Control, 1 Low, 1 High | |
| Females: | ||||
| E. | ||||
| G. Males: | ||||
| Females: | ||||
|
| ||||
| A. Fluid consumption determined drinking types within High group | Split population along average consumption of 0.157 g/g |
| 0 | |
| One-way ANOVA, multiple comparisons using uncorrected Fisher’s LSD | ||||
| B. Placental weights for male and female fetuses by sire drinker type | Two-way ANOVA, multiple comparisons using uncorrected Fisher’s LSD |
| Male: 2 Control, 2 Heavy; Female: 1 Control, 2 Moderate | |
| C. Male placental weight vs. Average fluid consumption | Simple linear regression and two-tailed Pearson correlation |
| 0 | |
|
| ||||
| A. Male and B. female log transformed relative average placental weight compared to sire daily ethanol dose | We normalized placental weights to the Control average, then log-transformed the average relative placental weights for each litter (dependent variable) and graphed these against the paternal dose of EtOH. |
| 0 | |
| Non-linear regression using fourth order polynomial model with least squares regression; Diagnostics: R squared and Runs test | ||||
| C. Male and female average relative placental weight and D. crown-rump length compared between upper and lower thresholds (inflection points) | Two-way ordinary ANOVA, multiple comparisons using uncorrected Fisher’s LSD |
| 0 | |
| E. Male and F. female average relative crown-rump length compared to sire daily ethanol dose | Non-linear regression using fourth order polynomial model with least squares regression; Diagnostics: R squared and Runs test |
| 0 | |
|
| ||||
| B-E, H-I. Chorion, decidua, junctional zone, labyrinth, junctional zone to decidua, and labyrinth to junctional zone | Two-way ANOVA, multiple comparisons using uncorrected Fisher’s LSD | Males: | B, D-E, & I. 0 C. Male: 1 Low; Female: 1 Control H. Male: 1 Low | |
| Females: | ||||
| F/G. Male Dose Response Decidua and Labyrinth | Simple linear regression and two-tailed Pearson correlation |
| 0 | |
|
| ||||
| J. Male and female central and peripheral labyrinth blood spaces | Three-way (sex, location, treatment) ordinary ANOVA, multiple comparisons using uncorrected Fisher’s LSD | Males: 8 Control, 8 Low, 6 High | 0 | |
| Females: 8 Control, 8 Low, 7 High | ||||
| K. Heart to body weight | Two-way ordinary ANOVA, multiple comparisons using uncorrected Fisher’s LSD, only comparisons to Control were performed | Males: | 0 | |
| Females: | ||||
|
| ||||
| Gene | Statistical Test | Experimental N | ||
| Outliers | ||||
| Control | Low | High | ||
| Ascl2 | M: Welch; F: ANOVA | M7; F8 | M7; F7 | M8; F8 |
| 0 | 0 | M3; F0 | ||
| Cdkn1c | M: Welch; F: ANOVA | M 8; F8 | M7; F8 | M8; F7 |
| 0 | 0 | 0 | ||
| Slc22a18 | M & F: Welch | M8; F8 | M7; F7 | M8; F8 |
| M0; F1 | M0; F0 | M0; F1 | ||
| Slc3a2 | M: ANOVA; F: Kruskal—Wallis | M7; F7 | M8; F7 | M8; F8 |
| M1; F0 | M0; F0 | M3; F0 | ||
| Tpbpa | M: Welch; F: ANOVA | M7; F6 | M7; F7 | M8; F8 |
| M1; F0 | M0; F1 | M0; F0 | ||
| Mt—Cytb | M: ANOVA; F: Kruskal—Wallis | M7; F8 | M7; F7 | M8; F8 |
| M0; F1 | M2; F2 | 0 | ||
| H19 | M: ANOVA; F: Welch | M7; F8 | M7; F7 | M7; F8 |
| 0 | 0 | 0 | ||
| mPeg3 | F: Kruskal—Wallis | M7; F8 | M7; F7 | M7; F8 |
| 0 | 0 | 0 | ||
| Mt—Nd5 | M & F ANOVA | M8; F7 | M8; F5 | M8; F8 |
| 0 | 0 | 0 | ||
FIGURE 2Chronic paternal ethanol exposures do not impact macro measures of male reproductive health or fertility. Paternal preconception alcohol exposures do not impact large-scale measures of male reproductive physiology, including normalized (A) testis, (B) seminal vesicle, or (C) epididymal track weights (n = 22 Control, 12-25 Low, 15 Medium, 18 High). Chronic male ethanol exposure does not impact normalized (D) liver, (E) pancreas or (F) spleen weights (n = 22 Control, 9 Low, 10-15 Medium, 17 High). (G) Chronic preconception paternal alcohol exposures do not influence offspring litter size (n = 22 Control, 25 Low, 15 Medium, 18 High litters). To assay changes between treatment groups, we used a one-way ANOVA. Error bars represent the standard error of the mean.
FIGURE 3Paternal preconception alcohol exposure induces concentration-dependent changes in offspring fetoplacental growth. For all measures of fetoplacental growth, we used the male and female average for each litter as the individual statistical unit. Comparison of litter average (A) gestational sac weight, (B) crown-rump length, (C) fetal weight, (D) placental weight, (E) placental diameter, and (F) placental efficiency between offspring sired by males across treatment groups (A–D/F. n = litter average with males: 20 Control, 24 Low, 15 Medium, 18 High litters; females: 21 Control, 25 Low, 15 Medium, 18 High litters; (E) n = litter average with males and females: 15 Control, 13 Low, 11 Medium, 17 High litters). (G) Comparison of normalized brain weights in the offspring of alcohol-exposed males across treatment groups (n = fetus, randomly selected from each litter, males: 28 Control, 33 Low, 15 Medium, 16 High; females: n = 29 Control, 51 Low, 19 Medium, 17 High). We used either a two-way ANOVA to contrast the impacts of sex and preconception treatments or Brown-Forsythe and Welch’s one-way ANOVA. Sex differences are indicated above the figures, while treatment effects are demarcated directly above the bar graphs. Error bars represent the standard error of the mean, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
FIGURE 4High-concentration sires display significant variation in alcohol consumption, which associates with differing effects on placental growth in the male offspring. (A) Comparison of average fluid consumption between the bottom and top consuming males within the High-concentration treatment group (One-way ANOVA, n = 22 Control, 9 Moderate, 9 Heavy). (B) Increased average placental weights in offspring sired by moderate but not heavy drinking males within the High-concentration treatment group (n = litter average with 22 Control, 9 Moderate, and 9 Heavy litters). We used a two-way ANOVA to compare average placental weights between the male and female offspring of Control, Moderate, and Heavy drinking sires. (C) Pearson correlation analysis contrasting male offspring litter average placental weights and average paternal fluid consumption across the High-concentration treatment group (n = 18 litters). Error bars represent the standard error of the mean, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
FIGURE 5Chronic preconception paternal ethanol exposures induce biphasic, dose-dependent effects on offspring fetoplacental growth. We used nonlinear regression to compare the sire’s daily ethanol dose to the log-transformed, average relative placental weights of (A) male and (B) female offspring. (n = 29 averages across each absolute daily dose). Comparison of male and female (C) average relative placental weight and (D) average relative crown-rump lengths between offspring sired by males below (< 1.0 g/kg) and above (> 2.4 g/kg) the identified inflection points (two-way ANOVA with n = 10 lower-dose and 5 upper-dose). Nonlinear regression comparing sire daily ethanol dose to (E) male and (F) female average relative crown-rump lengths (n = 29 averages across each absolute daily dose). We used a fourth-order polynomial model with least squares regression to identify inflection points. We eliminated outliers at Q = 1% and verified model fit using R squared analyses combined with Runs testing. Error bars represent the standard error of the mean, *p < 0.05, **p < 0.01.
FIGURE 6Chronic paternal alcohol exposures induce dose- and sex-specific changes in the histological organization of the placenta. (A) Schematic diagram depicting the layers of the murine placenta. Using microCT, we conducted a volumetric analysis of each placental layer and used a two-way ANOVA to compare measures between male and female offspring across treatment groups. Volumes for the (B) chorion, (C) decidua, (D) junctional zone, and (E) labyrinth are expressed as a ratio of the total placental volume (n = fetus, randomly selected from each litter, males: 21 Control, 43 low, 9 Medium, 11 High; females: n = 18 Control, 42 Low, 9 Medium, 9 High). Pearson correlation analysis contrasting proportional volume of the (F) decidua and (G) labyrinth with sire daily ethanol dose (n = 13 averaged individuals at each absolute daily dose). Ratios comparing the proportional volumes of the (H) junctional zone to decidua and (I) labyrinth to junctional zone between male and female offspring across treatment groups. Error bars represent the standard error of the mean, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
FIGURE 7Low-concentration paternal alcohol exposures alter placental vascular space. Histological sections comparing central and peripheral vascular spaces between female placentae derived from the offspring of (A) Control and (B) Low-concentration sires. (C) Comparison of placental vascular space between male and female offspring of Control, Low-, and High-concentration sires (n = fetus, randomly selected from each litter, males: 8 Control, 8 low, 6 High; females: n = 8 Control, 8 Low, 7 High). (D) Comparison of relative heart weights between the male and female offspring of Control and Low-concentration sires (n = fetus, randomly selected from each litter, males: 13 Control, 16 low; females: n = 11 Control, 25 Low). We used a two-way ANOVA to contrast differences between sex and the preconception treatment groups. Error bars represent the standard error of the mean, *p < 0.05, **p < 0 0.01.
FIGURE 8Paternal alcohol exposures induce alterations in placental gene expression. Analysis of imprinted gene expression in the placentae of (A) male and (B) female offspring of Control and EtOH-exposed sires in the Low- and High-concentration treatment groups. (C) Expression analysis of critical placental nutrient transporters in male and female offspring sired by Control, Low-, and High-concentration ethanol exposed males. (D) Comparison of mitochondrial-encoded transcripts in placentae derived from the male and female offspring of sires exposed to the Control, Low-, and High-concentration ethanol treatments. We analyzed gene expression using RT-qPCR. Gene expression was normalized to transcripts encoding Pgk1 and Ywhaz; (n = 8). For analysis, we used a one-way ANOVA or a Welch ANOVA. If data were not normally distributed, we used a non-parametric Kruskal-Wallis test. Error bars represent the standard error of the mean, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.