| Literature DB >> 36035472 |
Hai-Ping Ma1, Min Fu1, Maisitanguli Masula1, Chang-Shuang Xing1, Qiang Zhou1, Jing-Tong Tan1, Jiang Wang1.
Abstract
Subject: Perioperative regulation of coagulation function through heparin in patients undergoing cardiac surgery with cardiopulmonary bypass is an important part of performing cardiac surgery, and postoperative bleeding due to abnormal coagulation function caused by differences in heparin sensitivity in different individuals is an independent risk factor for postoperative complications and death. Method: Using an online database, 10 miRNAs interacting with AT-III and FX genes were predicted. Patients were divided into three groups according to the difference in activated clotting time (ACT) after the first dose of heparin (2.5 mg kg-1): group A: hyposensitive group (ACT < 480 s); group B: sensitive group (480 s ≤ ACT ≤ 760 s); and group C: hypersensitive group (ACT > 760 s). Perioperative and 24 h postoperative blood loss and other clinical data of patients in the three groups were recorded. Blood samples were collected before surgery, and RT-PCR was used to detect the levels of AT-III and FX gene mRNA and the levels of predicted 10 miRNAs. Result: Heparin sensitivity was positively correlated with AT-III mRNA levels and negatively correlated with FX gene mRNA levels in the three groups, and the blood loss in group B was significantly lower than that in groups A and C, which was statistically significant (p < 0.05). miR-3064-5p and miR-4745-5p expression levels were significantly different among group A, group B, and group C (p < 0.05) and were closely correlated with AT-III and FX gene mRNA expression levels, respectively.Entities:
Keywords: Antithrombin 3 (AT-III); Factor X (FX); cardiopulmanory bypass; heparin; miRNA; microRNA
Year: 2022 PMID: 36035472 PMCID: PMC9412912 DOI: 10.3389/fphys.2022.914333
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
FIGURE 1Network prediction Venn diagram of miRNAs interacting with (A) AT-III and (B) FX genes.
Primer information table for fluorescence quantitative AT-III and FX gene mRNA detection.
| Primer | Sequence, (5′ to 3′) | Product size |
|---|---|---|
| SERPINC1-F | AGAGCGGCCATCAACAAATG | 131 bp |
| SERPINC1-R | TTCCACAGGCCCTTGAAGTAA | |
| F10-F | GCTCGGGGAAAGTCTGTTCAT | 129 bp |
| F10-R | CAGGTCTCTTCCATGCACTCTC | |
| GAPDH_F | GGAGCGAGATCCCTCCAAAAT | 197 bp |
| GAPDH_R | GGCTGTTGTCATACTTCTCATGG |
Primer information table for fluorescent quantitative miRNA detection.
| Primer | Sequence, (5′ to 3′) |
|---|---|
| hsa miR 6845-3P | AGCCTCTCCTCCCTGT |
| hsa miR 4687-3P | GCAGTGGCTGTTGGAG |
| hsa miR 7974 | GGCTGTGATGCTCTCCT |
| hsa miR 3064-5P | CGCAGTCTGGCTGTTGT |
| hsa miR 149-5P | CTGGCTCCGTGTCTTC |
| hsa miR 5047 | TGCAGCTGCGGTTG |
| hsa miR 6743-3P | GCCGCTCTTCTCCCT |
| hsa miR 4745-5P | GCAGTGAGTGGGGCTC |
| hsa miR 6776-5P | CAGTCTGGGTGCAGTG |
| hsa miR 4436B-5P | CACTTCTGCCTGCCCT |
| hsa U6 | CTCGCTTCGGCAGCACA |
FIGURE 2Flowchart for the inclusion of patients.
Perioperation characteristics.
| Variable | Group A, | Group B, | Group C, |
|
|---|---|---|---|---|
| Pre-operative | ||||
| Sex (male%) | 5 (50) | 3 (30) | 5 (50) | 0.59 |
| Age (years) | 53.5 (43.7,60.5) | 47.5 (38.7,56.0) | 46.0 (37.2,53.2) | 0.33 |
| Weight (kg) | 66.0 (60.0,85.5) | 67.0 (59.5,87.0) | 77.5 (60.2,82.7) | 0.83 |
| BMI (kg m−2) | 22.5 (20.0,28.7) | 24.5 (22.5,27.7) | 27.0 (20.8,30.0) | 0.71 |
| Coagulation function index | ||||
| APTT(s) | 30.3 (30.2,30.6) | 29.8 (28.7,30.5) | 30.5 (30.0,30.7) | 0.26 |
| PT(s) | 11.5 (11.4,11.5) | 11.5 (11.5,11.5) | 11.5 (11.5,11.5) | 0.54 |
| INR | 1.0 (1.0,1.2) | 1.1 (1.0,1.2) | 1.1 (1.0,1.2) | 0.71 |
| AT-III activity (%) | 81.4 (79.7,84.2) | 84.4 (81.7,87.8) | 84.5 (81.9,86.3) | 0.10 |
| Platelet count (109L−1) | 204.5 (144.5,278.5) | 186.0 (154.0,248.3) | 215.5 (131.3,241.5) | 0.93 |
| Initial haemoglobin (g l−1) | 138 (126.3,149.8) | 133.0 (116.5,147.0) | 127.5 (119.5,133.8) | 0.42 |
| Combined diseases | ||||
| Diabetes (%) | 0 | 0 | 1 (10) | 0.11 |
| Hypertension (%) | 3 (30) | 4 (40) | 1 (10) | 0.24 |
| Intra-operative | ||||
| Cardiac surgery type | ||||
| Mitral valve replacement (%) | 4 (40) | 2 (20) | 3 (30) | 0.63 |
| Aortic valve replacement (%) | 2 (20) | 2 (20) | 3 (30) | 0.84 |
| Tricuspid valve replacement (%) | 2 (20) | 3 (30) | 2 (20) | 0.84 |
| Combined valve replacement (%) | 2 (20) | 3 (30) | 2 (20) | 0.84 |
| Operation time (min) | 217.5 (180.0,240.0) | 217.5 (210.0,225.0) | 225 (180.0,240.0) | 0.97 |
| CPB time (min) | 81.5 (63.8,89.3) | 75.0 (68.5,81.8) | 72.0 (68,185.8) | 0.88 |
| CPB lowest temperature (°C) | 33.5 (32.6,33.9) | 33.5 (32.8,34,3) | 33.1 (32.6,33.6) | 0.06 |
| Postoperative | ||||
| ICU length of stay (h) | 81.0 (37,123.5) | 70.0 (53.5,95.5) | 71.5 (46.5,120.0) | 0.99 |
| Hospital length of stay (days) | 22.5 (19.8,26.3) | 20.5 (19.0,23.0) | 21.5 (19.8,27.0) | 0.66 |
Heparin sensitivity and bleeding.
| Variable | Group A, | Group B, | Group C, |
|
|---|---|---|---|---|
| Baseline ACT(s) | 161.0 (143.3,167.3) | 163.0 (141.5,186.0) | 159.5 (150.8,172.8) | 0.73 |
| Total heparin dosage (mg) | 210.0 (200.0,240.0) | 180.0 (190.0,200.0) | 185.0 (175.0,200.0) | 0.01 |
| Total protamine dosage (mg) | 240.0 (207.5,246.3) | 197.5 (185.0,210.0) | 210.0 (180.0,232.5) | 0.01 |
| ACT after the initial dose of heparin (s) | 430.5 (396.3,469.3) | 596.5 (529.5,721.3) | 958.5 (905.5,999.0) | 0.00 |
| Heparin sensitivity index (s/mg−1 kg−1) | 138.8 (114.8,150.0) | 217.0 (191.8,174.8) | 393.3 (373.4,418.9) | 0.00 |
| Intra-operative blood loss (ml) | 500.0 (437.5,600.0) | 450.0 (400.0,500.0) | 475.0 (400.0,562.5) | 0.48 |
| 24-h postoperative bleeding (ml) | 410.0 (375.0,500.0) | 355.0 (315.0,402.5) | 415.0 (400.0,435.0) | 0.02 |
| Total blood loss (ml) | 910.0 (852.5,1002.5) | 820.0 (737.5,902.5) | 905.0 (850.0,970.0) | 0.06 |
Data are median (IQR) or n (%); ACT, activated clotting time.
Correlation of AT-III and FX with heparin sensitivity.
| AT-III | FX | |
|---|---|---|
|
| 0.567 | −0.624 |
|
| 0.001 | 0.001 |
FIGURE 3Expression levels of AT-III miRNA. *p<0.05 vs. A; **p<0.01 vs. A.
FIGURE 4Expression levels of FX miRNA. *p<0.05 vs. A; **p<0.01 vs. A.
Expression levels of AT-III miRNA gene and corresponding miRNA in PBMC of patients ( , n = 10).
| Group | Group A | Group B | Group C |
|---|---|---|---|
| SERPINC1 | 1.065 ± 0.371 | 1.922 ± 1.092 | 3.187 ± 1.466△ |
| miR-6845-3p | 1.015 ± 0.189 | 0.754 ± 0.344 | 0.680 ± 0.407 |
| miR-4687-3p | 1.032 ± 0.269 | 0.888 ± 0.647 | 0.552 ± 0.341 |
| miR-7974 | 1.056 ± 0.366 | 0.870 ± 0.499 | 0.819 ± 0.398 |
| miR-3064-5p | 1.013 ± 0.170 | 0.562 ± 0.193△ | 0.456 ± 0.194△ |
| miR-149-5p | 1.145 ± 0.584 | 0.944 ± 0.620 | 0.678 ± 0.416 |
△ compared with group A, p < 0.05; ▲ Compared with group B, p < 0.05.
Correlation between AT-III and corresponding miRNA.
| miR-6845-3P | miR-4687-3P | miR-7974 | miR-3064-5P | miR-149-5P | |
|---|---|---|---|---|---|
|
| −0.248 | −0.445 | −0.241 | −0.572 | −0.247 |
|
| 0.187 | 0.014 | 0.200 | 0.001 | 0.188 |
FIGURE 5AT-III miRNA and miRNA qRT-PCR detection. *p<0.05 vs. A; **p<0.01 vs. A.
Expression levels of FX miRNA gene and corresponding miRNA in PBMC of patients ( , n = 10).
| Groups | Group A | Group B | Group C |
|---|---|---|---|
| F10 | 1.015 ± 0.188 | 0.485 ± 0.175 | 0.417 ± 0.281 |
| miR-5047 | 1.072 ± 0.403 | 1.428 ± 0.792 | 1.761 ± 1.321 |
| miR-6743-3p | 1.018 ± 0.208 | 1.958 ± 1.379 | 2.003 ± 1.468 |
| miR-4745-5p | 1.025 ± 0.234 | 1.937 ± 0.789△ | 2.506 ± 0.881△ |
| miR-6776-5p | 1.045 ± 0.321 | 1.342 ± 0.807 | 1.511 ± 1.439 |
| miR-4436b-5p | 1.091 ± 0.469 | 1.543 ± 0.969 | 1.428 ± 0.636 |
Correlation between FX and corresponding miRNA.
| miR-5047 | miR-6743-3P | miR-4745-5P | miR-6776-5P | miR-4436b-5P | |
|---|---|---|---|---|---|
|
| 0.206 | 0.284 | 0.625 | 0.300 | 0.176 |
|
| 0.274 | 0.128 | 0.001 | 0.107 | 0.351 |
FIGURE 6FX miRNA gene and miRNA qRT-PCR detection. *p<0.05 vs. A; **p<0.01 vs. A.