| Literature DB >> 36035190 |
Juan Luo1, Hongxi Guo2, Lifang Feng1, Luhong Yang1, Xiaoqian Chen1, Tingting Du1, Man Hu1, Hui Yao1, Xiaohong Chen1.
Abstract
Transcobalamin (TC) deficiency is a rare autosomal recessive disease characterized by megaloblastic anemia. It is caused by cellular vitamin B12 depletion, which subsequently results in elevated levels of homocysteine and methylmalonic acid. This disease is usually diagnosed by genetic analysis of the TCN2 gene. Here, we described a 2.2-month-old Chinese girl with TC deficiency presenting with diarrhea, fever and poor feeding. Whole-exome sequencing detected a pair of compound-heterozygous mutations in TCN2 gene, c.754-12C>G and c.1031_1032delGA (p.R344Tfs*20). To our knowledge, it is the first time that they were identified and reported in TC deficiency. This study contributes to a better understanding of the TC deficiency, expanding the spectrum of TCN2 mutations in this disorder and also supporting the early diagnosis and proper treatment of similar cases in the future.Entities:
Keywords: TCN2 gene; megaloblastic anemia; transcobalamin II (TC II) deficiency; vitamin B12 (cobalamin, VB12); whole-exome sequencing (WES)
Year: 2022 PMID: 36035190 PMCID: PMC9411981 DOI: 10.3389/fgene.2022.951007
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Primers of Sanger sequencing and reverse transcription PCR (rtPCR).
| Primer | Sequence 5′->3′ |
|---|---|
| c.754–12C>G Sanger sequencing forward primer | ATCCAGGCTCTCTGTCCTCA |
| c.754–12C>G Sanger sequencing reverse primer | GGGAACCCTCTCCTCTGTTC |
| c.1031_1032delGA Sanger sequencing forward primer | GGCATTACAGGTGGGAAAGA |
| c.1031_1032delGA Sanger sequencing reverse primer | CAGCAAATCAGGATGAAGCA |
| rtPCR forward primer | AGGATGGAGCCTTCCAGAAT |
| rtPCR reverse primer | AAGCTGCCAGAACTCCCTTT |
FIGURE 1Genetic information of the patient. (A) Sanger sequencing showed a heterozygous maternally inherited variants (c.1031_1032delGA) and a heterozygous paternally inherited variant (c.754–12C>G) in TCN2 gene in patient. (B) Pedigree analysis of this family. (C) Reverse transcription and Sanger sequencing of exon 3-7 of TCN2 mRNA revealed an 11-base (TCTATCACCAG) insertion in the intron 5 and a 2-bp deletion (r.1031_1032delGA) in the exon 7.
Laboratory findings of patients before and after hydroxy-Cbl treatment.
| Parameters | Before | After treatment | ||||
|---|---|---|---|---|---|---|
| Age | 2 m2 d | 2 m9 d | 5 m | 10 m | 1 y7 m | 2 y3 m |
| Hb (g/L) (90–140) | 73 | 123 | 121 | 119 | 129 | 123 |
| RBC (1012/L) (3.2–4.9) | 2.25 | 4.41 | 3.98 | 4.32 | 4.61 | 4.55 |
| MCV (fL) (75–121) | 89.5 | 84.7 | 86.7 | 79.3 | 81.8 | 85.9 |
| WBC (109/L) (5–12) | 2.48 | 9.85 | 9.79 | 8.2 | 7.35 | 4.8 |
| ANC (109/L) (1.08–5.9) | 0.49 | 1.37 | 1.01 | 1.42 | 1.64 | 1.40 |
| Plt (109/L) (100–378) | 3 | 334 | 261 | 242 | 237 | 144 |
| Vitamin B12 (pg/ml) (139.4–651.5) | 275.60 | >1,400 | >2000 | >2000 | >2000 | - |
| Homocysteine (μmol/L) (<15) | 21.85 | 6.71 | 13.1 | 5.36 | 5.60 | 8.93 |
| Urine methylmalonic acid (μmol/L) (0.2–3.6) | 23.87 | 3.20 | 1.54 | 0.92 | 1.14 | 1.11 |
| Propionyl carnitine to acetylcarnitine (0.04–0.25) | 0.319 | 0.10 | 0.04 | 0.05 | 0.06 | 0.14 |
Hb, hemoglobulin; RBC, red blood cell; MCV, mean corpuscular volume; WBC, white blood cell; ANC, absolute neutrophil count; plt, platelets.
FIGURE 2The spectrum landscape of mutations in TCN2 gene. A total of 48 mutations and polymorphisms of TCN2 gene were reported in HGMD. Disease-causing mutations (DMs) are marked on the top. Other non-DMs and polymorphisms are marked in the bottom. Two variants identified in this study are highlighted in red.