| Literature DB >> 36032736 |
Robert Nogle1, Shilpa Nagaraju1, Sagar M Utturkar2, Richard J Giannone3, Vinicio Reynoso1, Ching Leang1, Robert L Hettich3, Wayne P Mitchell1, Sean D Simpson1, Michael C Jewett4,5,6,7,8, Michael Köpke1, Steven D Brown1.
Abstract
Clostridium autoethanogenum is a model gas-fermenting acetogen for commercial ethanol production. It is also a platform organism being developed for the carbon-negative production of acetone and isopropanol by gas fermentation. We have assembled a 5.5 kb pCA plasmid for type strain DSM10061 (JA1-1) using three genome sequence datasets. pCA is predicted to encode seven open-reading frames and estimated to be a low-copy number plasmid present at approximately 12 copies per chromosome. RNA-seq analyses indicate that pCA genes are transcribed at low levels and two proteins, CAETHG_05090 (putative replication protein) and CAETHG_05115 (hypothetical, a possible Mob protein), were detected at low levels during batch gas fermentations. Thiolase (thlA), CoA-transferase (ctfAB), and acetoacetate decarboxylase (adc) genes were introduced into a vector for isopropanol production in C. autoethanogenum using the native plasmid origin of replication. The availability of the pCA sequence will facilitate studies into its physiological role and could form the basis for genetic tool optimization.Entities:
Keywords: acetogen; biofuel; clostridia; ethanol; genome; syngas; synthetic biology
Year: 2022 PMID: 36032736 PMCID: PMC9413188 DOI: 10.3389/fbioe.2022.932363
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Plasmid pCA, its genes, and sequence coverage. The outermost ring (black) represents the circular pCA plasmid sequence (5.49 KB). The next inner ring represents the seven plasmid genes encoded on positive (yellow) and negative (green) strands, regulatory elements (purple), and repeat regions (orange). The next five rings represent the raw-read coverage from Illumina, 454, Ion Torrent and PacBio technology, respectively. Feature coordinates are also available in the GenBank submission.
FIGURE 2Verification of the plasmid pCA sequence via PCR and agarose electrophoresis. PCR product locations relative to the gene locations on pCA are shown (A) and associated amplicons for respective products 1–7 (B).
FIGURE 3pUB110/pMV158-like replication protein in pCA. Replication protein sequences from Bacillus species and Rep protein from pCA (pCA-Rep) were aligned using ClustalW. The conserved regions are highlighted in red and the putative active site tyrosine residue is underlined.
FIGURE 4Expression of plasmid genes in the published RNASeq data. Normalized (FPKM) and mean expression of the plasmid genes corresponding to varying biomass concentration (low, medium-low, medium, and high), and recombinant poly-3-hydroxybutyrate (PHB) and empty plasmid (EP) strains grown using syngas (20% H2, denoted in sample label by 20) or steel mill off-gas (2% H2 denoted in sample label by 2). See original articles for details (Table 1).
Sequences and chromosome data sources.
| Data type | NCBI BioProject/GenBank Accession/Proteomics DB | References |
|---|---|---|
| RNA-seq | PRJNA355951 |
|
| RNA-seq | PRJNA476240 |
|
| DNA sequence | PRJNA219420 |
|
| DNA sequence | PRJNA291963 |
|
| DNA sequence | PRJNA280340 |
|
| Chromosome sequence | CP012395 |
|
| Plasmid sequence | CP097624.1 | This study |
| Raw proteomics | MassIVE: MSV000089452 | This study |
| Searched proteomics | ProteomeXchange: PXD033792 | This study |
FIGURE 5C. autoethanogenum isopropanol production via heterologous expression using two different origins of replication. Plasmids pIPA-1 and pIPA-2 contain the same acetone production genes, promoter sequences, and differ in origins from pBP1 (Woods et al., 2019) or from native plasmid pCA, respectively. Plasmid details are available in supplemental GenBank files. Acetone is converted to isopropanol via a native chromosomal secondary alcohol dehydrogenase, as previously described (Köpke et al., 2014).
Oligonucleotides used to confirm plasmids via overlapping PCR reactions.
| Primer | Gene | Product name | Product size (bp) | Sequence |
|---|---|---|---|---|
| P1_3349 | CAETHG_05110 | Product 1 | 1,807 | TCGTTAAAACCACTGCAGCC |
| P1_5155 | CAETHG_05120 | Product 1 | ACTGGCCTGACTCTTCGAAA | |
| P2_2169 | CAETHG_05105 | Product 2 | 1,200 | TGAGCCAGTCGAATACCACA |
| P2_3368 | CAETHG_05110 | Product 2 | GGCTGCAGTGGTTTTAACGA | |
| P3_483 | CAETHG_05090 | Product 3 | 1,706 | TGTGTGCATGGAGAAGGTCA |
| P3_2188 | CAETHG_05105 | Product 3 | TGTGGTATTCGACTGGCTCA | |
| P4_3050 | CAETHG_05110 | Product 4 | 1,502 | TGTTAACTACCGGCGTGTCA |
| P4_4551 | CAETHG_05115 | Product 4 | AGCAAGTCCACGTGAAGCTA | |
| P5_2162 | CAETHG_05105 | Product 5 | 908 | TTCTTCCTGAGCCAGTCGAA |
| P5_3069 | CAETHG_05110 | Product 5 | TGACACGCCGGTAGTTAACA | |
| P6_3580 | intergenic | Product 6 | 1,651 | GGAGCGAACCCTTGACATTT |
| P6_5230 | CAETHG_05120 | Product 6 | AGGCTCGGAAACAGGACAAT | |
| P7_4533 | CAETHG_05115 | Product 7 | 2,334 | AGCTTCACGTGGACTTGCTA |
| P7_1367 | CAETHG_05095 | Product 7 | TGCGGTGCTAAACATAATGACA |