Characterization of Vibrio parahaemolyticus isolated from stool specimens of diarrhea patients in Nantong, Jiangsu, China during 2018-2020.

Vibrio parahaemolyticus is the leading cause of acute seafood-associated gastroenteritis worldwide. The aim of this study was to investigate the presence of virulence genes, biofilm formation, motor capacities and antimicrobial resistance profile of V. parahaemolyticus isolates isolated from clinical samples in Nantong during 2018-2020. Sixty-six V. parahaemolyticus strains isolated from stool specimens of diarrheal patients were examined. The PCR results showed that there were two tdh+trh+ isolates, four tdh-trh- isolates and sixty tdh+trh- isolates, accounting for 3.0%, 6.1% and 90.9%, respectively. All the tdh carrying isolates manifested the positive reactions for the Kanagawa phenomenon (KP) test. Most of the isolates harbored at least one of the specific DNA markers of 'pandemic group' strains, suggesting that the dominant isolates of V. parahaemolyticus in Nantong might belong to the new O3: K6 or its serovariants. All tdh+ isolates possessed the Vp-PAI genes, but no tdh-trh- isolates carried the T3SS2 genes. All isolates were biofilm producers and had relatively strong motor capacities. In addition, the V. parahaemolyticus isolates were resistant to ampicillin (98.5%), cefuroxime (75.6%), cefepime (66.7%), piperacillin (59.1%) and ampicillin/sulbactam (50.0%), but sensitive to ciprofloxacin (100.0%), levofloxacin (100.0%), trimethoprim-sulfamethoxazole (98.5%), gentamicin (98.5%), amikacin (97%), meropenem (71.2%), and ceftazidime (56.1%). Multidrug-resistant isolates in clinical might be related to the inappropriate use of antimicrobials in aquaculture.

Introduction

Vibrio parahaemolyticus, a Gram-negative, highly motile, halophilic bacterium, is naturally found in marine ecosystems [1]. This bacterium is the leading cause of seafood-associated gastroenteritis in many countries including China [2-5]. Human infections with V. parahaemolyticus are usually caused by consumption of raw or undercooked seafood [6]. Pathogenic isolates usually produce thermostable direct hemolysin (TDH; encoded by tdh) and/or TDH-related hemolysin (TRH; encoded by trh) [7]. However, other factors such as the type III secretion systems (T3SS1 and T3SS2), urease (encoded by ure) and proteases also play roles in the pathogenesis of V. parahaemolyticus [6, 7]. T3SS1 is expressed by both pathogenic and non-pathogenic isolates, whereas T3SS2 only exists in pathogenic isolates [8]. The T3SS2 gene cluster and the two copies of tdh genes are present in a pathogenicity island known as Vp-PAI located on the smaller chromosome 2 of V. parahaemolyticus [9]. V. parahaemolyticus can utilize T3SS2 to efficiently inject TDH into target cells as an effector that contributes to intestinal fluid accumulation in an animal model [10].

There are total 13 somatic (O) antigens and 71 capsular (K) antigens in V. parahaemolyticus making up more than 70 serotypes [11]. However, since 1996, the new O3: K6 and its serovariants (O4: K68, O1: K25, O1: KUT, O1: K26 etc.) known as the ‘pandemic group’ had accounted for the majority of clinical isolates [12]. The ‘pandemic group’ isolates usually carried the tdh gene but not the trh and ure genes [12]. V. parahaemolyticus can be confirmed by the species-specific thermolabile hemolysin (tlh) and toxR genes [13-16], while the ‘pandemic group’ isolates can be distinguished by PCR targeting on several specific DNA markers, including the group-specific (GS) DNA sequence of toxRS/new [17], the ORF8 located on the f237 phage [18], the insertion sequence in the ORF of HU-α [19], the pandemic group specific (PGS) sequence [20], and the DNA fragment of VP2905 ORF [21].

The increasing number of V. parahaemolyticus isolates is shown to be resistant to multiple antibiotics due to inappropriate use of antimicrobials in aquaculture [15, 22–25]. In particular, the emergence of multi-drug resistant isolates should be given sufficient attention. V. parahaemolyticus isolates harboring the class 1 integrons of dfrA14-blaVEB-1-aadB and blaVEB-1-aadB-arr2-cmlA-blaOXA-10-aadA1, which are strongly associated with multi-drug resistance to various antibiotics including ampicillin, ceftazidime, cefotaxime and gentamicin, have been isolated from ready-to-eat foods in China [26]. Biofilms are extracellular matrix-enclosed bacterial colonies on surfaces [27]. V. parahaemolyticus is able to form biofilms on seafood surfaces, which enhance resistance to adverse growth conditions and/or chemical agents such as detergents and antibiotics thereby improving the survival rate and pathogenicity of the bacteria [27]. The biofilm formation ability of V. parahaemolyticus requires some specific genes, such as those associated with the biosynthesis of flagella, pili and exopolysaccharide [27, 28].

Nantong is located in the southeast of Jiangsu, bordering the Yellow Sea, with a coastline of over 200 km. The threat of V. parahaemolyticus to the health of citizens should be given adequate attention with the increasing of seafood consumption. Nevertheless, there is limited literature involving the prevalence or pathogenic profiles of V. parahaemolyticus in this city. In this study, a total of 66 V. parahaemolyticus isolates were isolated from stool specimens of diarrhoeal cases in Nantong, Jiangsu, China during 2018–2020. The polymerase chain reaction (PCR) assay was applied to screen the virulence-associated genes including tdh, trh, ure, Mtase and Vp-PAI genes (vopP, vscC2, vopC and VPA1376), as well as the species-specific marker genes tlh and toxR. All the isolates were subjected for screening of pandemic genotype by detecting the presence of PGS sequence (PGS-PCR), toxRS/new (GS-PCR), HU-α and orf8. At the same, a series of phenotypic experiments were employed to detect the hemolytic activities, biofilm formation abilities, motor (swimming and swarming) capacities and antimicrobial resistance profile of the V. parahaemolyticus isolates.

Materials and methods

Isolation of V. parahaemolyticus

Stool specimens from diarrhoeal cases (watery or loose stools with a duration of no more than 7 days) admitted in the different hospitals in Nantong were collected during 2018–2020, and screened for the presence of V. parahaemolyticus by applying the published methods [25, 29]. Briefly, stool specimens were inoculated into 5 ml of Alkaline Peptone Water (APW) (Polypeptone 10 g/L; Sodium chloride 10 g/L; pH8.6) and incubated at 37°C with shaking for 12 h. The APW-enriched culture was diluted 10,000-fold with the phosphate-buffered saline (PBS), and then 200 μL of the diluted samples were spread onto Thiosulphate Citrate Bile Salts Sucrose (TCBS; Beijing Land Bridge, China) agar plate, and incubated at 37°C for 12 h. The green or blue-green colonies were selected as presumed V. parahaemolyticus and then characterized by VITEK automatic biochemical analyzer (bioMerieux, France).

Ethics approval was not requested because no human or animal subjects were involved.

Polymerase chain reaction (PCR) assay

Approximately 20 μL glycerol stock of V. parahaemolyticus was inoculated into 5 mL 2.5% Bacto heart infusion (HI; BD Bioscience, USA) broth supplemented with 1.5% (w/v) NaCl and incubated at 37°C with shaking at 200 rpm for 12 h, followed by centrifugation at 8000 g for 5 min. The genomic DNA was isolated using a QIAamp DNA mini Kit (Qiagen, Germany), and the concentration of DNA was determined by a NanoDrop spectrophotometry (ThermoFisher Scientific, USA).

Primers for PCR were synthesized by GRNEWIZ (Suzhou, China) and listed in Table 1. The PCR reaction mixture contained 10 μL 2×Taq PCR Mastermix (TIANGEN BIOTECH CO., LTD., China), 2 μL genomic DNA (10 ng/μL), 1 μL primer pair solution (10 μM each), and 7 μL sterile distilled water. PCR amplification was performed as the following conditions: pre-denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 94°C for 50 s, annealing at 54°C for 50 s, and extension at 72°C for 50 s, and ending extension at 72°C for 5 min. PCR products were detected by 1% agarose gel electrophoresis.

Table 1

Primers used in this study.

Target	Sequence (forward/reverse, 5ꞌ→3ꞌ)	Amplicon size (bp)	Reference
toxR/new	FTAATGAGGTAGAAACA/ACGTAACGGGCCTACA	651	[25]
PGS sequence	TTCGTTTCGCGCCACAACT/TGCGGTGATTATTCGCGTCT	235	[25]
Mtase	GTCTTGTCGAATAGAACTCTGA/TAAGCTCCAAAATCCATACG	683	[25]
tlh	AAAGCGGATTATGCAGAAGCACTG/GCTACTTTCTAGCATTTTCTCTGC	450	[25]
tdh	GTAAAGGTCTCTGACTTTTGGAC/TGGAATAGAACCTTCATCTTCACC	269	[25]
trh	TTGGCTTCGATATTTTCAGTATCT/CATAACAAACATATGCCCATTTCCG	500	[25]
vopC	CAGAGTTGGTTTCGCAG/CTGGTACGCCTCTTGGACAG	579	[25]
vopP	CGTCCAACTCTATTGTTGTG/CAATGTTGGCTATTCGGTTG	393	[25]
vscC2	GCGGTCTATTGCTATCCT/TCTTGGTATTGATAGTGGGTG	362	[25]
VPA1376	GCTCTCCTTGGTACCAATCAC/CTGGGATCTTGATGTCAAGGT	1067	[25]
HU-a	CGATAACCTATGAGAAGGGAAACC/CTAGAAGGAAGAATTGATTGTCAAATAATG	474	[25]
ure	CTTGTCATCGGGTGTCACTA/GATGTTAGGTTCACCTACTGACT	464	[25]
orf8	GTTCGCATACAGTTGAGG/AAGTACACAGGAGTGAG	700	[25]
toxR	GTCTTCTGACGCAATCGTTG/ATACGAGTGGTTGCTGTCATG	368	This study

Biofilm crystal violet (CV) staining

CV staining was performed as previously described [30]. Briefly, the overnight cultures were diluted 50-fold into 5 mL HI broth and cultured at 37°C with shaking at 200 rpm to OD600 equals to 1.4. The resultant cultures were 50-fold diluted into 2 mL Difco marine (M) broth 2216 (BD Biosciences, USA) in 96-well plates (Corning Inc., Untied States) and allowed to grow at 30°C with shaking at 150 rpm for 48 h. The surface attached biofilms in vitro were stained with 0.1% CV. The bound CV was dissolved with 20% ethanol, and the OD570 values were then determined as the index of CV staining.

Swimming motility

Swimming motility assay was performed as previously described [31]. Briefly, the overnight cell cultures were diluted 50-fold into 5 mL HI broth and cultured at 37°C with shaking at 200 rpm to OD600 equals to 1.4. Thereafter, 2 μL of the culture was inoculated into the semi-solid swim plates (1% Oxoid Tryptone, 2% NaCl [Merck, Germany], and 0.2% Difco Noble agar [BD Biosciences, USA]). Diameter of swimming area was measured after incubation at 37°C for 2 h.

Swarming motility

Swarming motility assay was performed as previously described [31]. Briefly, the overnight cell cultures were diluted 50-fold into 5 mL HI broth and cultured at 37°C with shaking at 200 rpm to OD600 equals to 1.4. Thereafter, 2 μL of the culture was spotted on the swarm plate (2.5% Bacto heart infusion, 1.5% NaCl, and 1.8% Difco noble agar). Diameter of swarming zone was measured after incubation at 37°C for 48 h.

Kanagawa phenomenon (KP) test

KP test was performed as previously described [32]. Briefly, 5 μL of the overnight cell culture was inoculated onto Wagatsuma agar (CHROMagar, China) containing 5% rabbit red blood cells (RBCs). Isolates with β-hemolysis after incubation at 37°C were considered as the KP positive.

Antibiotic susceptibility testing (AST)

The VITEK 2 AST-GN09 antimicrobial sensitivity kit contains the following antimicrobial agents: ampicillin (AMP), ampicillin/sulbactam (SAM), piperacillin (PIP), piperacillin/tazobactam (TZP), cefazolin (CZ), cefuroxime (CXM), ceftazidime (CAZ), cefepime (FEP), meropenem (MEM), amikacin (AN), gentamicin (CN), ciprofloxacin (CIP), levofloxacin (LEV), and trimethoprim-sulfamethoxazole (SXT). A proper amount of separated and purified bacteria was added into a test tube containing 3 mL 0.45% NaCl solution, adjusting the turbidity of the bacteria solution to be the same as that of 0.5–0.63 Macmillan tube, taking 145 μL of 0.5–0.63 Macmillan unit bacteria suspension in a testing tube. AST for V. parahaemolyticus isolates was determined by minimum inhibitory concentrations (MICs) using a VITEK2 Compact automatic microbial analyzer (bioMérieux, France) [33]. The results were categorized as resistant (R), intermediate (I), or susceptible (S).

Replicates and statistical methods

PCR, KP test and AST were performed two times with the same results. The swimming, swarming and CV staining were performed three independent bacterial cultures with three replicates for each, and the results were expressed as the mean ± standard deviation (SD). Paired Student’s t-tests were employed to calculate the statistical significance. P < 0.01 was considered as the significant.

Results

Identification of virulence genes in clinical V. parahaemolyticus isolates

A total of 66 isolates were isolated from stool specimens. All the isolates were confirmed by the VITEK automatic biochemical analysis. There were two tdh+trh+ isolates, four tdh-trh- isolates and sixty tdh+trh- isolates (Table 2), accounting for 3.0%, 6.1% and 90.9%, respectively. No isolate was tdh-trh+. The tlh and toxR genes were detected in all isolates (Table 2). The toxR/new, orf8 and HU-α genes were only detected in the tdh+trh- isolates (Table 2), and the prevalence of these genes was all 40.9% (27/66). The prevalence of PGS sequence was 100.0% (2/2) in tdh+trh+ isolates, 86.7% (52/60) in tdh+trh- isolates and 50.0% (2/4) in tdh-trh- isolates (Table 2). The prevalence of ure was 100.0% (2/2) in tdh+trh+ isolates, 0.0% (0/60) in tdh+trh- isolates and 25.0% (1/4) in tdh-trh- isolates (Table 2). The prevalence of Mtase was 0.0% (0/2) in tdh+trh+ isolates, 45.0% (27/60) in tdh+trh- isolates and 25.0% (1/4) in tdh-trh- isolates (Table 2). The other four virulence genes, vopP (100.0%; Table 2), vscC2 (100.0%; Table 2), vopC (98.3%; Table 2), and VPA1376 (98.3%; Table 2), were detected in the genomic DNA of tdh+trh- isolates. One tdh-trh- isolate was also confirmed to harbor the VPA1376 gene (Table 2).

Table 2

Presence of virulence genes in the 66 clinical V. parahaemolyticus isolates.

Strain ID	tlh	tdh	trh	toxR/new	PGS sequence	toxR	ure	MTase	orf8	HU-α	vopP	vscC2	vopC	VPA1376
VP5	+	+	+	-	+	+	+	-	-	-	-	-	-	-
VP19	+	+	+	-	+	+	+	-	-	-	-	-	-	-
VP2	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP3	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP4	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP6	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP8	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP9	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP10	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP11	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP12	+	+	-	-	-	+	-	-	-	-	+	+	+	+
VP13	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP14	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP16	+	+	-	+	-	+	-	+	+	+	+	+	+	+
VP17	+	+	-	+	-	+	-	+	+	+	+	+	+	+
VP18	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP20	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP29	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP30	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP36	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP37	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP39	+	+	-	-	-	+	-	-	-	-	+	+	+	+
VP40	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP41	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP42	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP43	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP44	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP45	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP46	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP47	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP48	+	+	-	-	-	+	-	-	-	-	+	+	+	+
VP49	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP50	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP51	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP52	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP53	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP54	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP55	+	+	-	-	-	+	-	-	-	-	+	+	+	+
VP56	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP57	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP58	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP59	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP60	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP61	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP62	+	+	-	-	+	+	-	-	-	-	+	+	+	+
VP63	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP64	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP65	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP66	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP67	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP69	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP70	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP71	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP72	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP73	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP74	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP75	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP76	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP77	+	+	-	+	+	+	-	+	+	+	+	+	+	+
VP78	+	+	-	-	+	+	-	+	+	+	+	+	+	-
VP79	+	+	-	-	-	+	-	-	-	-	+	+	+	+
VP80	+	+	-	-	-	+	-	-	-	-	+	+	-	+
VP7	+	-	-	-	-	+	-	-	-	-	-	-	-	-
VP15	+	-	-	-	+	+	-	-	-	-	-	-	-	-
VP35	+	-	-	-	+	+	-	-	-	-	-	-	-	-
VP68	+	-	-	-	-	+	+	+	-	-	-	-	-	+

Hemolytic activity of clinical V. parahaemolyticus isolates

The hemolytic activity of each isolate was measured by the KP test on the Wagatsuma agar supplemented with 5% RBCs. As shown in Fig 1, all the tdh+trh and tdh+trh- isolates were recorded as positive reactions with a β hemolysis zone surrounding the growth spot, whereas all the tdh-trh- isolates gave negative reactions. These results suggested that all isolates harboring the tdh gene was able to express active TDH.

Fig 1

The hemolytic activity of V. parahaemolyticus isolates against RBCs was evaluated by observing whether there was a β-hemolysis zone surrounding the spot of growth on the Wagatsuma agar plate.

The pictures shown here are representative images of V. parahaemolyticus cells on Wagatsuma agar.

Biofilm formation by clinical V. parahaemolyticus isolates

Biofilm formation by the 66 isolates was investigated by the CV staining. As shown in Table 3, all the isolates were biofilm producers. Regarding the degrees of biofilm [34], 50.0% of tdh+trh+ isolates and 10.0% of tdh+trh- isolates were weak producers, 50.0% of tdh+trh+ isolates, 48.3% of tdh+trh- isolates and 100% of tdh-trh- isolates were moderate producers, while 41.7% of tdh+trh- isolates were strong producers.

Table 3

Biofilm formation by V. parahaemolyticus isolates at 30°C.

Isolates	Total No.	Degree of biofilm formation (%, average OD ± SD)			Overall biofilm producers
		Weak	Moderate	Strong
tdh + trh +	2	1 (50.0%, 0.197 ± 0.022)	1 (50.0%, 0.532 ± 0.051)	0	2 (100.0%)
tdh + trh -	60	6 (10.0%, 0.167 ± 0.017)	29 (48.3%, 0.459 ± 0.086)	25 (41.7%, 1.381 ± 0.966)	60 (100.0%)
tdh - trh -	4	0	4 (100.0%, 0.401 ± 0.056)	0	4 (100.0%)

Swimming and swarming motility of clinical V. parahaemolyticus isolates

V. parahaemolyticus possesses dual flagellar systems, i.e., a single polar flagellum for swimming in liquid and peritrichous lateral flagella for swarming on surfaces [35]. In this study, the swimming and swarming capacities were compared between each clinical isolates and the reference strain RIMD2210633. According to this, the motor abilities of clinical isolates were divided into three grades: weak, medium, and strong, which respectively indicated that their motor abilities were much lower, no difference with, or significantly higher than those of RIMD2210633. As shown in Table 4, all the isolates were swimmers; 11.7% of tdh+trh- isolates and 50.0% of tdh-trh- isolates were weak swimmers; 50.0% of tdh+trh+ isolates and 25.0% of tdh+trh- isolates were moderate swimmers, while 50.0% of tdh+trh+ isolates, 63.3% of tdh+trh- isolates and 50.0% of tdh-trh- isolates were strong swimmers. Similarly, all of the isolates were swarm cells (Table 5), among which 100% of tdh+trh- isolates, 20.0% of tdh+trh- isolates and 50.0% of tdh-trh- isolates were moderate swarm cells; 80.0% of tdh+trh- isolates and 50.0% of tdh-trh- isolates were strong swarm cells. These results indicated that all the isolates had a relatively strong motor capacity.

Table 4

Swimming motility of V. parahaemolyticus isolates.

Isolates	Total No.	Degree of swimming ability (%, average mm ± SD)			Overall swimming producers
		Weak	Moderate	Strong
tdh + trh +	2	0	1 (50.0%, 7.000 ± 1.000)	1 (50.0%, 10.667* ± 0.577)	2 (100.0%)
tdh + trh -	60	7 (11.7%, 3.405* ± 0.443)	15 (25.0%, 6.233 ± 0.793)	38 (63.3%, 10.550* ± 0.820)	60 (100.0%)
tdh - trh -	4	2 (50.0%, 3.750* ± 0.683)	0	2 (50.0%, 8.833* ± 0.382)	4 (100.0%)
RIMD2210633		6.500 ± 0.500

Table 5

Swarming motility of V. parahaemolyticus isolates.

Isolates	Total No.	Degree of swarming ability (%, average mm ± SD)			Overall swarming producers
		Weak	Moderate	Strong
tdh + trh +	2	0	2 (100%, 14.417 ± 0.382)	0	2 (100.0%)
tdh + trh -	60	0	12 (20.0%, 14.417 ± 0.458)	48 (80.0%, 16.799* ± 0.675)	60 (100.0%)
tdh - trh -	4	0	2 (50.0%, 13.750 ± 0.433)	2 (50.0%, 17.833* ± 0.866)	4 (100.0%)
RIMD2210633		14.167 ± 0.289

Antibiotic susceptibility of clinical V. parahaemolyticus isolates

AST was performed on clinical V. parahaemolyticus isolates using 14 antibiotics. As shown in Table 6, the V. parahaemolyticus isolates were extremely resistant to ampicillin (98.5%), followed by cefuroxime (75.6%), cefepime (66.7%), piperacillin (59.1%), ampicillin/sulbactam (50.0%), piperacillin/tazobactam (45.5%), ceftazidime (43.9%), cefazolin (28.8%), and meropenem (28.8%). All the isolates were sensitive to ciprofloxacin (100.0%) and levofloxacin (100.0%), followed by trimethoprim-sulfamethoxazole (98.5%), gentamicin (98.5%), amikacin (97.0%), meropenem (71.2%), ceftazidime (56.1%), piperacillin/tazobactam (40.9%), piperacillin (36.4%), and ampicillin/sulbactam (28.8%).

Table 6

Antibiotics resistance profiles of clinical V. parahaemolyticus isolates.

Antibiotics	Number (%) of S	Number (%) of I	Number (%) of R
Ampicillin	1 (1.5)	0 (0.0)	65 (98.5)
Ampicillin/sulbactam	19 (28.8)	14 (21.2)	33 (50.0)
Piperacillin	24 (36.4)	3 (4.5)	39 (59.1)
Piperacillin/tazobactam	27 (40.9)	9 (13.6)	30 (45.5)
Cefazolin	2 (3.0)	45 (68.2)	19 (28.8)
Cefuroxime	0 (0.0)	16 (24.2)	50 (75.6)
Ceftazidime	37 (56.1)	0 (0.0)	29 (43.9)
Cefepime	22 (3.3)	0 (0.0)	44 (66.7)
Meropenem	47 (71.2)	0 (0.0)	19 (28.8)
Amikacin	64 (97.0)	2 (3.0)	0 (0.0)
Gentamicin	65 (98.5)	1 (1.5)	0 (0.0)
Ciprofloxacin	66 (100.0)	0 (0.0)	0 (0.0)
Levofloxacin	66 (100.0)	0 (0.0)	0 (0.0)
trimethoprim-sulfamethoxazole	65 (98.5)	0 (0.0)	1 (1.5)

Discussion

V. parahaemolyticus can be easily isolated from seawater and seafood [36-39]. However, most of environmental isolates are non-pathogenic with a very low detection rate of the tdh and/or trh genes [14, 15, 29, 38–41]. By contrast, majority of clinical isolates harbor the tdh and/or trh genes [14, 15, 29, 40, 41]. In this study, 66 V. parahaemolyticus isolates were isolated from stool specimens, of these, 62 isolates had the tdh gene, and 2 isolates simultaneously contained the trh gene. The proportion of clinical isolates containing the tdh and/or trh genes is similar to the results of other researchers [15, 39, 42–44]. Significantly, four isolates harbored neither the tdh nor the trh gene but had the ability to cause disease, which has been similarly reported in previous studies [13, 43]. The pathogenic mechanisms of clinical isolates carrying neither tdh nor trh still need to be further investigated.

The tlh and toxR genes are the species-specific markers that can be detected in all the V. parahaemolyticus isolates [13-16]. The PGS sequence, toxR/new, orf8 and HU-α genes were used as specific DNA markers to distinguish the ‘pandemic group’ isolates from other serotypes [17-20]. The data showed that most of the isolates harbor one or more specific DNA markers of the ‘pandemic group’, indicating that the dominant isolates of V. parahaemolyticus in Nantong might belong to the new O3: K6 or its serovariants.

The ability to product urease by V. parahaemolyticus has been demonstrated highly correlates with the existing of the trh gene [45]. As shown in this study, all the trh positive isolates possessed the ure gene. However, one tdh-trh- isolate also harbored the ure gene. The presence of ure in tdh-trh- isolate might be due to the presence of trh gene variant that could not be detected by the PCR used in this study. In addition, the MTase gene encoding a putative virulence-associated DNA methyltransferase was major detected in the tdh+tdh- isolates, which was similar to a previous report [46]. T3SS1 and T3SS2 are also thought to be involved in the pathogenicity of V. parahaemolyticus [47]. T3SS2 was only present in the tdh+ isolates [9], but a novel T3SS2 belonging to a different lineage was also detected in the trh+ isolates [48]. In this work, we showed that all the tdh+ isolates possessed at least two of the vopP, vscC2, vopC and VPA1376 genes located in the Vp-PAI gene cluster (T3SS2). None of the T3SS2 genes (vopP, vscC2 and vopC) were detected in the tdh-trh- isolates, but one of the isolates harbored the VPA1376 gene, suggesting this gene was likely to be acquired by horizontal transfer.

The antimicrobial resistance of V. parahaemolyticus has become one of the most serious threats to fish farming, food safety and public health. Most of the isolates in this study exhibited a high level of resistance to ampicillin, cefuroxime, cefepime, piperacillin, and ampicillin/sulbactam, but sensitive to ciprofloxacin, levofloxacin, trimethoprim-sulfamethoxazole, gentamicin, amikacin, meropenem, and ceftazidime. V. parahaemolyticus isolates are universally resistant to ampicillin according to literatures [3, 15, 24, 25, 40, 41, 44, 49–53]. The blaCARB-17 gene encoding a novel class A carbenicillin-hydrolyzing β-lactamase family of β-lactamase that is responsible for the resistance to penicillin was detected in all tested V. parahaemolyticus isolates [54]. However, the antimicrobial resistance profiles of V. parahaemolyticus might vary in different reports, for instance, 60.3% of V. parahaemolyticus isolates from rearing water samples of shrimp farms in Fujian, China exhibited resistance to gentamicin in the report of Shu Zhao, et al.[50], and 50.8% and 47.6% of isolates from African salad samples in Nigeria were resistant to amikacin and ceftazidime in the report of Etinosa O. Igbinosa, et al. [3]. No matter how different of the antimicrobial resistance profiles, emergence of multi-drug resistant V. parahaemolyticus is a serious threat to aquaculture and public health.

V. parahaemolyticus possesses the strong ability to form biofilms and persist on the surfaces of seafood for the long existence [27]. This study showed that all clinical V. parahaemolyticus isolates were biofilm producers. The ability to form biofilms is related to the source of isolates and cultural temperature, and pathogenic isolates produced more biofilms than non-pathogenic isolates [34, 55]. Incubation temperature of 37°C was considered as optimum temperature for biofilm formation by V. parahaemolyticus [56]. Importantly, it is universally acknowledged that bacterial cells in biofilms are much more resistant to adverse conditions than planktonic cells [27]. Therefore, the biofilm produced by V. parahaemolyticus hugely increases the potential risks to seafood consumers. The movements of V. parahaemolyticus propelled by flagella can be divided into swimming and swarming, both of which are required for the initial stages of biofilm formation [28]. The data showed that all V. parahaemolyticus isolates had relatively strong motor capacities, which were consistent with the observational facts that all the isolates were biofilm producers.

In conclusion, this study focused on the virulence, biofilm formation, motilities and antimicrobial resistance of V. parahaemolyticus isolates isolated from stool specimens of diarrheal cases in Nantong during 2018–2020. A total of 66 isolates were collected, 93.9% of them carried the tdh gene and manifested the positive reactions for KP test. Most of the isolates harbored at least one of the specific DNA markers of ‘pandemic group’ strains, suggesting that the dominant isolates of V. parahaemolyticus in Nantong belonged to the new O3: K6 and its serovariants. 100.0% of tdh+ isolates possessed the Vp-PAI genes, but only one tdh-trh- isolate carried the T3SS2 gene. All V. parahaemolyticus isolates were biofilm producers and had relatively strong motor capacities. In addition, the V. parahaemolyticus isolates were resistant to ampicillin, cefuroxime, cefepime, piperacillin and ampicillin/sulbactam, but sensitive to ciprofloxacin, levofloxacin, trimethoprim-sulfamethoxazole, gentamicin, amikacin, meropenem and ceftazidime. The data presented here would be beneficial for preventing and controlling the seafood-associated illnesses caused by V. parahaemolyticus in Nantong, Jiangsu, China.