| Literature DB >> 35996522 |
R Li1, Y Yu2, S O Jaafar3, B Baghchi4, M Farsimadan5, I Arabipour6, H Vaziri5.
Abstract
Introduction: Alterations in certain microRNAs (miRNAs) and their target genes have reported in polycystic ovary syndrome (PCOS) and other disease of the female reproductive system, and so may be potential biomarkers. We hypothesised alterations in the prevalence of four miRNAs single nucleotide polymorphism (SNP) variants miR-126 rs4636297, miR-146a rs2910164, miR-196a2 rs11614913, and miR-499 rs3746444 in women with PCOS in comparison to healthy controls.Entities:
Keywords: genetic; microRNA; polycystic ovary syndrome; polymorphism; variants
Mesh:
Substances:
Year: 2022 PMID: 35996522 PMCID: PMC8915673 DOI: 10.3389/bjbs.2021.10209
Source DB: PubMed Journal: Br J Biomed Sci ISSN: 0967-4845 Impact factor: 2.432
General information of selected SNPs.
| SNP | Position | Type of variant | Change | Primer sequences | Enzyme | Products length (bp) |
|---|---|---|---|---|---|---|
| miR-126 rs4636297 | chr9:136670698 | Downstream Transcript | NR_029695.1:n. A>G | CCCGGAGCCTCATATCAGC | HaeII | 285,192,93 |
| GCTATGCCGCCTAAGTACGTC | ||||||
| miR-146a rs2910164 | chr5:160485411 | Non Coding Transcript | NR_029701.1:n.60C>G | CATGGGTTGTGTCAGTGTCAGAGCT | SacI | 147, 120, 27 |
| TGCCTTCTGTCTCCAGTCTTCCAA | ||||||
| miR-196a rs11614913 | chr12:53991815 | Non Coding Transcript | NR_029617.1:n.78C>T | CTTACCCACCCAGCAACCC | HpyCH4III | 360, 218, 142 |
| CCCCACTCACAGCTTGTCC | ||||||
| miR-499 rs3746444 | chr20:34990448 | Non Coding Transcript | NR_039912.1:n.25T>G | GCCCCTTGTCTCTATTAGCTG | Tsp451 | 416,232.184 |
| ACTTTTGCTCTTTCACTCTCAT |
The demographic and biochemical characteristics of PCOS women and controls.
| Variables | Patients (385) | Controls (385) |
|
|---|---|---|---|
| Age (years) | 28.1 ± 0.31 | 28.6 ± 0.20 | 0.28 |
| BMI (kg/m2) | 26.6 ± 5.7 | 26.1 ± 4.8 | 0.13 |
| FSH (mIU/ml) | 6.5 ± 2.2 | 5.9 ± 2.5 | 0.22 |
| LH (mIU/ml) | 15.6 ± 4.1 | 5.74 ± 1.2 |
|
| At least one successful pregnancy (n, %) | 181/202 (89) | 242/258 (93) | 0.10 |
| Only one successful pregnancy (n, %) | 50 (24) | 58 (27.6) | 0.39 |
| More than one successful pregnancy (n, %) | 131 (72.3) | 184 (76) | 0.38 |
| History of miscarriage (n, %) | 39 (19) | 26 (9) |
|
| History of premature deliveries (n, %) | 25 (12.3) | 11 (4) |
|
BMI, body mass index; FSH, follicle stimulating hormone; LH, luteinizing hormone. Data presented as mean with SD or as n (%).
Allele and genotype distribution frequencies of every four SNPs in the case and control groups.
| SNP | Model | Control | Case | OR (95%CI) | Adjusted |
|---|---|---|---|---|---|
| miR-126 rs4636297 |
| 607 (78.8) | 537 (69.7) | ||
|
| 163 (21.2) | 233 (30.3) | 1.61 (1.28–2.03) |
| |
|
| 135 (35.8) | 169 (43.8) | 1.69 (1.26–2.26) |
| |
|
| 236 (61.2) | 184 (47.7) | 0.57 (0.43–0.77) |
| |
|
| 14 (3) | 32 (8) | 2.40 (1.26–4.57) |
| |
| P | P | ||||
| miR-146a rs2910164 |
| 607 (78.8) | 494 (64) | ||
|
| 163 (21.2) | 276 (36) | 2.08 (1.65–2.61) |
| |
|
| 119 (31) | 168 (43.6) | 1.73 (1.28–2.32) |
| |
|
| 244 (63.3) | 163 (42.3) | 0.42 (0.31–0.56) |
| |
|
| 22 (6) | 54 (14) | 2.69 (1.60–4.51) |
| |
| P | P | ||||
| miR-196a rs11614913 |
| 496 (64.4) | 462 (60) | ||
|
| 274 (35.6) | 308 (40) | 1.21 (0.98–1.49) | 0.074 | |
|
| 178 (46.2) | 168 (42.3) | 0.79 (0.59–1.05) | 0.126 | |
|
| 159 (41.2) | 147 (38.6) | 0.87 (0.65–1.16) | 0.352 | |
|
| 48 (12.5) | 70 (18) | 1.56 (1.04–2.32) |
| |
| P | P | ||||
| miR-499 rs3746444 |
| 398 (51.6) | 463 (60) | ||
|
| 372 (48.4) | 307 (40) | 1.95 (1.13–2.86) |
| |
|
| 188 (48.8) | 195 (50.6) | 1.07 (0.81–1.42) | 0.61 | |
|
| 105 (27.2) | 134 (34.8) | 1.81 (1.31–2.45) |
| |
|
| 92 (23.8) | 56 (14.5) | 0.54 (0.37–0.78) |
| |
| P | P |
HWE p-value for cases.
HWE p-value for controls.
Bold values show the significant values. p < 0.05 was considered significant.
Distribution of haplotype blocks in PCOS patients and controls.
| rs3746444 | rs2910164 | rs11614913 | rs4636297 | Control frequency % | Case frequency % | OR (95% CI) | Adjusted |
|---|---|---|---|---|---|---|---|
| C |
|
|
| 19.5 | 8.0 | 0.40 (0.29–0.54) |
|
| C |
|
|
| 4.5 | 1.1 | 0.46 (0.30–0.70) |
|
| T |
|
|
| 5.9 | 1.2 | 0.21 (0.06–0.74) |
|
| T |
|
|
| 3.7 | 2.0 | 0.47 (0.28–0.85) |
|
| T |
|
|
| 9.1 | 5.5 | 0.52 (0.35–0.78) |
|
| T |
|
|
| 2.0 | 1.3 | 0.46 (0.19–1.11) | 0.06 |
| C |
|
|
| 4.2 | 1.7 | 0.76 (0.40–1.18) | 0.11 |
| T |
|
|
| 6.9 | 4.7 | 0.61 (0.35–1.04) | 0.10 |
| C |
|
|
| 1.3 | 0.0 | 0.83 (0.25–1.15) | 0.76 |
| T |
|
|
| 11.9 | 12.9 | 1.09 (0.85–1.40) | 0.54 |
| T |
|
|
| 2.4 | 4.2 | 1.77 (0.68–2.92) | 0.07 |
| T |
|
|
| 20.6 | 17.0 | 0.75 (0.58–1.07) | 0.06 |
| C |
|
|
| 10.3 | 7.5 | 0.70 (0.42–1.06) | 0.11 |
| C |
|
|
| 5.4 | 5.2 | 0.67 (0.33–1.38) | 0.37 |
| C |
|
|
| 5.0 | 5.6 | 1.45 (0.72–2.22) | 0.10 |
Bold values show the significant values. p < 0.05 was considered significant.