Background: Circular RNAs (circRNAs) are a new family of endogenous non-coding RNAs generated by a covalently closed loop, and a mounting body of data suggests they control gene expression. While the circRNA-homeodomain-interacting protein kinase-2 (circHIPK2) is generated from the homeodomain-interacting protein kinase 2 (HIPK2) gene, the function of circHIPK2 in nasopharyngeal cancer (NPC) along with the responsible mechanisms are still unclear. Methods: RNA-sequencing data was utilized to determine the differentially expressed circRNAs, and circHIPK2 was established as a novel prospective circRNA. The expressions of circRNAs along with messenger RNAs (mRNAs) in NPC tissues and cells was assessed via quantitative real-time polymerase chain reaction (qRT-PCR), and the transfection of NPC cells with plasmids in vitro and in vivo was adopted to explore the effects of circHIPK2 in NPC. Western blotting was adopted to assess the expressions of HIPK2 and β-catenin, while Cell Counting Kit (CCK)-8 assay coupled with colony-forming assay were utilized to assess the biological functions. The expression of nuclear and cytoplasmic HIPK2 was detected via nucleocytoplasmic separation assay. Results: Herein, we established that circHIPK2 was upregulated in NPC tissues. Over-expression of circHIPK2 promoted cell proliferation in vitro and in vivo, and further studies revealed it inhibited the protein level of HIPK2 in a post-transcriptional pattern, decreasing β-catenin expression and suppressing the proliferation of NPC. Conclusions: Our findings demonstrated elevated circHIPK2 facilitated the cell proliferation of NPC cells via the circHIPK2/HIPK2 axis, suggesting circHIPK2 might be an oncogene to promote the process of NPC and could be a novel treatment target for its management. 2022 Translational Cancer Research. All rights reserved.
Background: Circular RNAs (circRNAs) are a new family of endogenous non-coding RNAs generated by a covalently closed loop, and a mounting body of data suggests they control gene expression. While the circRNA-homeodomain-interacting protein kinase-2 (circHIPK2) is generated from the homeodomain-interacting protein kinase 2 (HIPK2) gene, the function of circHIPK2 in nasopharyngeal cancer (NPC) along with the responsible mechanisms are still unclear. Methods: RNA-sequencing data was utilized to determine the differentially expressed circRNAs, and circHIPK2 was established as a novel prospective circRNA. The expressions of circRNAs along with messenger RNAs (mRNAs) in NPC tissues and cells was assessed via quantitative real-time polymerase chain reaction (qRT-PCR), and the transfection of NPC cells with plasmids in vitro and in vivo was adopted to explore the effects of circHIPK2 in NPC. Western blotting was adopted to assess the expressions of HIPK2 and β-catenin, while Cell Counting Kit (CCK)-8 assay coupled with colony-forming assay were utilized to assess the biological functions. The expression of nuclear and cytoplasmic HIPK2 was detected via nucleocytoplasmic separation assay. Results: Herein, we established that circHIPK2 was upregulated in NPC tissues. Over-expression of circHIPK2 promoted cell proliferation in vitro and in vivo, and further studies revealed it inhibited the protein level of HIPK2 in a post-transcriptional pattern, decreasing β-catenin expression and suppressing the proliferation of NPC. Conclusions: Our findings demonstrated elevated circHIPK2 facilitated the cell proliferation of NPC cells via the circHIPK2/HIPK2 axis, suggesting circHIPK2 might be an oncogene to promote the process of NPC and could be a novel treatment target for its management. 2022 Translational Cancer Research. All rights reserved.
Entities:
Keywords:
circHIPK2; homeodomain-interacting protein kinase 2 (HIPK2); nasopharyngeal carcinoma; proliferation
Nasopharyngeal carcinoma (NPC) originates from the epithelial tissue of the nasopharynx and is among the most common malignant tumors of the head and neck (1). NPC is very common in Southern China, and Southeast Asia (2). While radiotherapy or chemotherapy may successfully control local tumor development along with local recurrence, with a 5-year rate of survival of over 80%, distant metastasis coupled with radiotherapy resistance contribute to the low survival rate (3). Thus, to develop more efficient therapy methods, further research into the pathogenesis of NPC along with the molecular mechanisms of metastasis and proliferation is required.CircRNAs are “covalently closed single-stranded transcripts comprising many RNA species” (4). Originally thought to be a by-product of mRNA biosynthesis due to the processing of precursor mRNA (5), circRNAs have been proven to have pivotal roles in a range of biological processes and are linked with the onset and progress of many human diseases, including a multitude of malignant tumors (6-8). CircRNAs may work as sponges of microRNAs (miRNAs) (9), dock to proteins (10,11), or code for tiny peptides, leading to abnormal gene expression that could influence cancer biology (12). Although many circRNAs have been identified, their functions in NPC are still largely unknown.Herein, we found a circRNA derived from the homodomain-interacting protein kinase 2 (HIPK2) gene, termed circHIPK2 (circBase ID: hsa_circ_0001756), which was remarkably upregulated in NPC tissues. The proliferation of circHIPK2 was explored in NPC cells via in vitro along with in vivo experiments. Further research illustrated circHIPK2 repressed HIPK2 protein contents in a post-transcriptional manner, lowering β-catenin expression and dampening NPC growth. Collectively, circHIPK2 may serve as a possible target for NPC treatment. We present the following article in accordance with the ARRIVE reporting checklist (available at https://tcr.amegroups.com/article/view/10.21037/tcr-22-1645/rc).
Methods
Human NPC tissue specimens and cell culture
Pathological evaluation was utilized to diagnose NPC in normal along with nasopharyngeal tissues taken from patients at The First Affiliated Hospital of Soochow University. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The research protocol and the use of human samples were approved by the Ethics Committee of Soochow University (No. SUDA20210705A01) and all participants signed informed consent forms. The CNE, CNE-2, 5-8F, 6-10B, along with the immortalized nasopharyngeal epithelial cells NP69 were acquired from the Oncology Laboratory of the First Affiliated Hospital of Soochow University. CNE, CNE-2, 5-8F, along with 6-10B cells were inoculated in H1640 medium enriched with 10% fetal bovine serum (HyClone, Logan, UT, USA), whilst NP69 cells were grown in keratinocyte serum-free medium enriched with bovine pituitary extract (Invitrogen) (BD Biosciences). The cells were then kept under 37 ℃ along with 5% CO2 conditions.
RNA extraction, preparation of complementary DNA (cDNA), and qRT-PCR analysis
Isolation of total RNA (tRNA) from NPC cell lines or tissues was performed with TRIzol reagent (Takara, Dalian, China), and generation of cDNA. tRNA was performed with the PrimeScript® RT Master Mix (Takara, Dalian, China) as described by the manufacturer. Afterwards, quantitative Real-Time polymerase chain reaction (qRT-PCR) was run on the Roche Light Cycler 96 Real-time PCR system (Roche Diagnostics, Basel, Switzerland) in triplicate. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was adopted as endogenous controls, and the comparative ∆∆Ct approach was adopted to assess relative expression. The primer sequences were as follows: circHIPK2, Forward: AGGTCTTATCCACGCTGACC, Reverse: GAAGGGTGTGAGGGGAGAAA; HIPK2, Forward: CCACCTACTTGCAGTCCAGA, Reverse: AGCTCCTGGATATAACGGCC; GAPDH, Forward: AATCCCATCACCATCTTCC, Reverse: CATCACGCCACAGTTTCC.
Western blotting
Western blotting was completed as documented previously (13). Harvesting of proteins was performed as illustrated in the figures, fractionated via sodium dodecyl sulfate polyacrylamide gel electrophoresis, and blotted onto polyvinylidene fluoride membranes. The membranes were blocked in 1% Bovine Serum Albumin (BSA) for 20 minutes at room temperature (RT) then inoculated overnight with anti-β-catenin, anti-HIPK2, anti-GAPDH (Abgent, USA), and anti-LaminB1 antibodies. Afterwards, the blots were probed for 1 hour at room temperature with horseradish peroxidase-linked secondary antibodies before being processed with the enhanced chemiluminescence plus Western Blotting Detection System. GAPDH was utilized as a loading control.
Plasmid construction and small interfering RNA (siRNA) interference assay
We cloned the human circHIPK2 cDNA into the Plvx-circ vector with a front circular frame and a rear circular frame to create circHIPK2 over-expression plasmids, with an empty plasmid as a negative control. GenePharma produced siRNA for circHIPK2 (Shanghai, China), and as a negative control, scrambled siRNA was generated. Lipofectamine 3000 (Invitrogen) was adopted in the transfection as described by the manufacturer, and 48 hours post transfection, total RNA along with proteins was collected.
CCK-8 cell proliferation assay
The cells after transfection were digested and planted at 5,000 cells/well in 96-well plates. Five duplicate wells were set for each sample in each group, and 100 µL of the growth medium was introduced to every well. The cells were inoculated with 10 µL of CCK-8 solution (Dojindo, Japan) at the given time points and incubated in the dark for an additional 2 hours. At a wavelength of 450 nm, the absorbance was measured. The experiment was repeated thrice.
Colony formation assay
The cells after transfection were digested and planted at 1,000 cells/well in 6-well plates for 2 weeks and the surviving colonies were fixed with 4% paraformaldehyde (PFA), stained with 0.05% crystal violet, then counted.
Fluorescence in situ hybridization (FISH)
The sub-cellular localization of circHIPK2 in NPC cells was assessed with RNA FISH (RiboBio, Guangzhou, China) utilizing the RiboTMFluorescent in situ Hybridization Kit as documented by the manufacturer and a circHIPK2 probe tagged with the Cy3 fluorescent dye.
Nucleocytoplasmic separation experiments
A Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime, Shanghai, China) was utilized to separate of nuclear and cytosolic fractions of NPC cells as described by the manufacturer. LamB1 and GAPDH served as the nuclear as well as the cytoplasmic control.
Animal studies
Animal experiments were performed under a project license (No. SUDA20210705A01) granted by the Ethics Committee of Soochow University, in compliance with the Ethics Committee of Soochow University guidelines for the care and use of animals. A protocol was prepared before the study without registration. The BALB/c nude mice (n=5 for each group) used in this investigation were five weeks old, male, and acquired from Beijing Vital River Laboratory Animal Technology Co., Ltd. Animals were kept in a 12-hour light/12-hour dark cycle at 22±2 ℃ with unrestricted access to food along with water. Cells transfected with the circHIPK2 over-expression vector, circHIPK2 short hairpin RNA (shRNA), or the empty vector and scrambled shRNA were injected into the armpit of the mice. After 4 weeks, the subcutaneous tumor size was measured, with the volume (V) of the tumor computed via the formula V = (Width2 × Length)/2.
Statistical analysis
Results are recorded as means ± standard error of the mean for at least three independent experiments. GraphPadPrism8 statistical software package was used for data analysis and the Student’s t-test (two-tailed) was used for continuous variables. P<0.05 denotes statistical significance.
Results
circHIPK2 (hsa-circ-0001756) is considerably upregulated in NPC
Differentially expressed circRNAs were explored via RNA sequencing data in four NPC along with normal nasopharyngeal tissues to determine their significance in the onset and progress of the disease (unpublished data) (). The results showed elevated contents of circRNAs were more prevalent than down-regulated circRNAs among differentially expressed circRNAs. We categorized the up-regulated circRNAs via fold change after screening them using an average normal tissue read count of more than 100. qRT-PCR was adopted to confirm the three up-regulated circRNAs in 14 NPC along with normal nasopharyngeal tissues. The results showed that hsa-circ-0001756 (circHIPK2), rather than hsa-circ-0006006 and hsa-circ-0057090, was dramatically up-regulated in NPC tissues (), and the head-to-tail splicing of exon 2 gave rise to circHIPK2, which was derived from the HIPK2 gene (). Subsequently, the expression of circHIPK2 was detected in NPC cell lines (CNE, CNE-2, 5-8F and 6-10B) by qRT-PCR, and the results revealed that circHIPK2 showed higher expression in CNE along with CNE-2 cell lines, and lower expression in 5-8F, as well as 6-10B cell lines (). Moreover, Sanger sequencing verified head-to-tail splicing in the RT-PCR product of circHIPK2 with the expected size (). Collectively, these results illustrated that circHIPK2 was presented in the NPC cell lines and was remarkably upregulated in NPC tissues.
Figure 1
circHIPK2 is significantly up-regulated in nasopharyngeal carcinoma tissues. (A) Clustered heat map of the differentially expressed circRNAs in four NPC (T1–T4) and normal nasopharyngeal tissues (N1–N4). Rows represent circRNAs while columns represent tissues. (B,C) hsa-circ-0006006, hsa-circ-0057090 and hsa-circ-0001756 were validated in 14 NPC and normal nasopharyngeal tissues using qRT-PCR (*P<0.05; ns, non-significant). (D) Schematic illustration showing the circularization of HIPK2 exon 2 forming circHIPK2 (hsa-circ-0001756). (E) The expression of circHIPK2 in NPC cell lines were measured by qRT-PCR. (F,G) The existence of circHIPK2 was proved by RT-PCR and its back splicing junction was verified by Sanger sequencing. Arrow indicates the special splicing junction of circHIPK2. NPC, nasopharyngeal carcinoma; circRNAs, circular RNAs; qRT-PCR, quantitative real-time polymerase chain reaction.
circHIPK2 is significantly up-regulated in nasopharyngeal carcinoma tissues. (A) Clustered heat map of the differentially expressed circRNAs in four NPC (T1–T4) and normal nasopharyngeal tissues (N1–N4). Rows represent circRNAs while columns represent tissues. (B,C) hsa-circ-0006006, hsa-circ-0057090 and hsa-circ-0001756 were validated in 14 NPC and normal nasopharyngeal tissues using qRT-PCR (*P<0.05; ns, non-significant). (D) Schematic illustration showing the circularization of HIPK2 exon 2 forming circHIPK2 (hsa-circ-0001756). (E) The expression of circHIPK2 in NPC cell lines were measured by qRT-PCR. (F,G) The existence of circHIPK2 was proved by RT-PCR and its back splicing junction was verified by Sanger sequencing. Arrow indicates the special splicing junction of circHIPK2. NPC, nasopharyngeal carcinoma; circRNAs, circular RNAs; qRT-PCR, quantitative real-time polymerase chain reaction.
Overexpression of circHIPK2 enhances the proliferation of NPC cells
To investigate the function of circHIPK2 in NPC cells, we overexpressed it in 5-8F cells by transfecting with circHIPK2 or control vector plasmids. The circHIPK2 expression was remarkably increased in the 5-8F cells transfected with circHIPK2 plasmids (). CCK-8 and clone formation assays were then performed in the 5-8F overexpression or control group, respectively, and the results illustrated over-expression of circHIPK2 promoted the proliferation of 5-8F cells in vitro (). 5-8F cell transfects of circHIPK2 or control vector were inoculated subcutaneously into BALB/c nude mice to assess if over-expression of circHIPK2 influenced tumor formation in vivo, and the circHIPK2 over-expression group gradually enhanced tumor progress and volume in contrast with the controls (). Over-expression of circHIPK2 effectively stimulates the growth of NPC cells, as illustrated by these data.
Figure 2
Overexpression of circHIPK2 promotes the proliferation of NPC cells. (A) The expression levels of circHIPK2 in 5-8F cells transfected with circHIPK2 or control vector plasmids were detected by qRT-PCR (***P<0.001). (B) The cell proliferation ability of 5-8F cells transfected with circHIPK2 or control vector plasmids at 24, 48, and 72 h (***P<0.001). (C,D) Representative results of colony formation assay of 5-8F cells transfected with circHIPK2 or control vector plasmids (**P<0.01). Cells were stained with 0.05% crystal violet. Significance was determined from three independent experiments and assessed by Student’s t-test. (E,F) Representation picture of tumor formation of the xenograft in nude mice (n=5 for each group) with circHIPK2 overexpressed 5-8F cells. Compared with the vector group, the tumor volume significantly increased in circHIPK2-treated nude mice (**P<0.01). NPC, nasopharyngeal carcinoma; qRT-PCR, quantitative real-time polymerase chain reaction.
Overexpression of circHIPK2 promotes the proliferation of NPC cells. (A) The expression levels of circHIPK2 in 5-8F cells transfected with circHIPK2 or control vector plasmids were detected by qRT-PCR (***P<0.001). (B) The cell proliferation ability of 5-8F cells transfected with circHIPK2 or control vector plasmids at 24, 48, and 72 h (***P<0.001). (C,D) Representative results of colony formation assay of 5-8F cells transfected with circHIPK2 or control vector plasmids (**P<0.01). Cells were stained with 0.05% crystal violet. Significance was determined from three independent experiments and assessed by Student’s t-test. (E,F) Representation picture of tumor formation of the xenograft in nude mice (n=5 for each group) with circHIPK2 overexpressed 5-8F cells. Compared with the vector group, the tumor volume significantly increased in circHIPK2-treated nude mice (**P<0.01). NPC, nasopharyngeal carcinoma; qRT-PCR, quantitative real-time polymerase chain reaction.
Depletion of circHIPK2 dampens growth of NPC cells
Knockdown of the circHIPK2 expression in CNE2 cells was then performed by transfection with circHIPK2 siRNA or negative control, and the results revealed circHIPK2 expression was remarkably decreased in the CNE2 cells transfected with circHIPK2 siRNA (). Subsequently, CCK-8 and clone formation assays were performed in the CNE2 depletion or control group, and the results showed depletion of circHIPK2 inhibits the proliferation of CNE2 cells in vitro (). CNE2 cell transfects of circHIPK2 shRNA or a negative control were inoculated subcutaneously into BALB/c nude mice to assess whether suppression of circHIPK2 influences tumor growth in vivo. In contrast with the controls, the circHIPK2 depletion group remarkably reduced tumor development along with volume (). These findings illustrate circHIPK2 depletion effectively blocks NPC cells from proliferating.
Figure 3
Depletion of circHIPK2 inhibits proliferation of NPC cells. (A) The expression levels of circHIPK2 in CNE2 cells transfected with circHIPK2 siRNA or negative control (***P<0.001). (B) The cell proliferation ability of CNE2 cells transfected with circHIPK2 siRNA or negative control at 24, 48, and 72 h (*P<0.05, **P<0.01). (C,D) Representative results of colony formation assay of CNE2 cells transfected with circHIPK2 siRNA or control (**P<0.01). Cells were stained with 0.05% crystal violet. Significance was determined from three independent experiments and assessed by Student’s t-test. (E,F) Representation picture of tumor formation of the xenograft in nude mice (n=5 for each group) with circHIPK2 interference CNE2 cells. Compared with the control group, the tumor volume significantly decreased in circHIPK2 depletion group (*P<0.05). NPC, nasopharyngeal carcinoma; siRNA, small interfering RNA.
Depletion of circHIPK2 inhibits proliferation of NPC cells. (A) The expression levels of circHIPK2 in CNE2 cells transfected with circHIPK2 siRNA or negative control (***P<0.001). (B) The cell proliferation ability of CNE2 cells transfected with circHIPK2 siRNA or negative control at 24, 48, and 72 h (*P<0.05, **P<0.01). (C,D) Representative results of colony formation assay of CNE2 cells transfected with circHIPK2 siRNA or control (**P<0.01). Cells were stained with 0.05% crystal violet. Significance was determined from three independent experiments and assessed by Student’s t-test. (E,F) Representation picture of tumor formation of the xenograft in nude mice (n=5 for each group) with circHIPK2 interference CNE2 cells. Compared with the control group, the tumor volume significantly decreased in circHIPK2 depletion group (*P<0.05). NPC, nasopharyngeal carcinoma; siRNA, small interfering RNA.
circHIPK2 inhibits the protein level of HIPK2 at the post-transcriptional level
To explore the potential mechanism of circHIPK2 in NPC, the mRNA contents of HIPK2 were detected in circHIPK2 overexpressed 5-8F cells or depleted CNE2 cells. The results revealed the mRNA contents of HIPK2 showed no significant difference upon circHIPK2 upregulation or downregulation (). We then detected the protein contents of HIPK2 in circHIPK2 overexpressed or depleted 5-8F and CNE2 cells, and established that the protein contents of HIPK2 were remarkably decreased in circHIPK2 overexpressed 5-8F and CNE2 cells () and increased in circHIPK2 depleted 5-8F and CNE2 cells (), suggesting circHIPK2 inhibited the protein level of HIPK2 in a post-transcriptional pattern.
Figure 4
circHIPK2 inhibits the protein level of HIPK2 at the post-transcriptional level. (A) The mRNA levels of HIPK2 in circHIPK2 overexpressed 5-8F cells or depleted CNE2 cells (ns, non-significant). (B,C) The protein levels of HIPK2 and β-catenin in circHIPK2 overexpressed 5-8F and CNE2 cells. (D,E) The protein levels of HIPK2 and β-catenin in circHIPK2 depleted 5-8F and CNE2 cells. (F) RNA FISH for circHIPK2 and 18S was detected in 5-8F cells. Nuclei was stained blue (DAPI), circHIPK2 and 18S were stained red. Magnification: 200×. (G) Nuclear HIPK2 protein levels decreased significantly after circHIPK2 overexpression. FISH, fluorescence in situ hybridization; DAPI, 4',6-diamidino-2-phenylindole.
circHIPK2 inhibits the protein level of HIPK2 at the post-transcriptional level. (A) The mRNA levels of HIPK2 in circHIPK2 overexpressed 5-8F cells or depleted CNE2 cells (ns, non-significant). (B,C) The protein levels of HIPK2 and β-catenin in circHIPK2 overexpressed 5-8F and CNE2 cells. (D,E) The protein levels of HIPK2 and β-catenin in circHIPK2 depleted 5-8F and CNE2 cells. (F) RNA FISH for circHIPK2 and 18S was detected in 5-8F cells. Nuclei was stained blue (DAPI), circHIPK2 and 18S were stained red. Magnification: 200×. (G) Nuclear HIPK2 protein levels decreased significantly after circHIPK2 overexpression. FISH, fluorescence in situ hybridization; DAPI, 4',6-diamidino-2-phenylindole.HIPK2 is a type of serine/threonine protein kinase and a member of the HIPK family (14). As a tumor suppressor gene, it reduced the amount of β-catenin protein in the nucleus to exert tumor inhibition (15). Subsequently, we detected the protein contents of β-catenin, a well-known molecule that promotes tumor cell proliferation, and established that the protein contents of β-catenin were remarkably increased in circHIPK2 overexpressed 5-8F and CNE2 cells () and decreased in circHIPK2 depleted 5-8F and CNE2 cells (). This suggested circHIPK2 inhibited the protein level of HIPK2, thus decreased the β-catenin expression and suppressed the proliferation of NPC. Moreover, RNA FISH assay and nucleocytoplasmic separation experiments were used to evaluate the localization of circHIPK2 and HIPK2 in NPC cells. The results revealed circHIPK2 was mainly localized in the cytoplasm (), and HIPK2 was observed in the nucleus and cytoplasm fractions of NPC cells (). Furthermore, we found HIPK2 was remarkably decreased in both the nucleus and cytoplasm fraction upon circHIPK2 overexpression (). As HIPK2 was reported to play a cancer-inhibiting role in the nucleus in a previous study (16), we considered that overexpressed circHIPK2 inhibited the protein level of HIPK2 in the nucleus, leading to the upregulation of tumor promoting gene β-catenin. Overall, these results indicated circHIPK2 inhibited the protein level of HIPK2 in both the nucleus and cytoplasm by a post-transcriptional pattern, decreasing the β-catenin expression and suppressing the proliferation of NPC.
Discussion
Nasopharyngeal carcinoma with an insidious location is difficult to treat, and easily causes multiple complications in adjacent organs (17,18). The need for molecular targeted precision therapy is urgent. Due to advances made in next-generation sequencing technologies in recent years, a growing number of circRNAs have been discovered to be involved in the control of a range of human disease processes. Although recent studies have shown numerous circRNAs play an indispensable role in the occurrence and progress of NPC (19-23), their function in its onset and progress or specific mechanisms of circRNA in the disease are still insufficient.Through RNA sequencing of NPC clinical samples, we uncovered a substantial number of circRNAs in this research. As a type of circRNA, circHIPK2 has been found to synergize with SiO2 to induce fibroblast activation in silicosis (24), form a regulatory axis with miR124-2HG combined with autophagy and ER stress to promote astrocyte activation (25), regulate astrocytes and improve depressive behavior together with gut microbial bacteria in depression (26), and promote functional recovery by decreasing circHIPK2 in neural stem cells in ischemic stroke (27). However, the role of circHIPK2 in NPC has not yet been elucidated. We found it was remarkably upregulated in NPC tissues (), proving its overexpression enhanced the growth of NPC cells () and its depletion inhibited their growth (). We also illustrated that circHIPK2 inhibited the protein level of HIPK2 in both the nucleus and cytoplasm by a post-transcriptional pattern, decreasing β-catenin expression and suppressing the proliferation of NPC ().HIPK2 is a multi-functional protein that uses its kinase activity to dampen tumor development and stimulate responsiveness to therapy by modulating critical molecular cascades in cancer. HIPK2 inhibitions have recently been discovered in cancers, and are caused by a variety of mechanisms, consisting of HIPK2 cytoplasmic localization, protein degradation, as well as tumor development (28,29). Numerous investigations have shown HIPK2 played a pivotal role as a tumor repressor in hepatocellular, colon, and prostate cancer (28,30,31). Recent research evidence has shown posttranslational modification of small ubiquitin-like modifier, phosphorylation, acetylation, and ubiquitination exert tight control over HIPK2 (30,32). Because circRNAs may influence gene expression by docking to proteins, they may play a role in cancer biology, and we hypothesized circHIPK2 might bind to specific protein to regulate the expression of HIPK2 by a post-transcriptional pattern, although the precise mechanism by which circHIPK2 regulates HIPK2 might need to be explored in future investigations.
Conclusions
In summary, our study delineates a circHIPK2/HIPK2 module with respect to functional implications in the tumor proliferation of NPC. Our results imply circHIPK2 might play an indispensable role in tumor biology, and that the regulatory signaling might offer a novel therapeutic target for the management of NPC.The article’s supplementary files as