| Literature DB >> 35923236 |
Y H Tompkins1, P Teng1, R Pazdro2, W K Kim1.
Abstract
The objective of this study was to evaluate the impact of coccidiosis on bone quality and antioxidant status in the liver and bone marrow of broiler chickens. A total of 360 13-day old male broilers (Cobb 500) were randomly assigned to different groups (negative control, low, medium-low, medium-high, and highest dose groups) and orally gavaged with different concentrations of Eimeria oocysts solution. Broiler tibia and tibia bone marrow were collected at 6 days post-infection (6 dpi) for bone 3-D structural analyses and the gene expression related to osteogenesis, oxidative stress, and adipogenesis using micro-computed tomography (micro-CT) and real-time qPCR analysis, respectively. Metaphyseal bone mineral density and content were reduced in response to the increase of Eimeria challenge dose, and poor trabecular bone traits were observed in the high inoculation group. However, there were no significant structural changes in metaphyseal cortical bone. Medium-high Eimeria challenge dose significantly increased level of peroxisome proliferator-activated receptor gamma (PPARG, p < 0.05) and decreased levels of bone gamma-carboxyglutamate protein coding gene (BGLAP, p < 0.05) and fatty acid synthase coding gene (FASN, p < 0.05) in bone marrow. An increased mRNA level of superoxide dismutase type 1 (SOD1, p < 0.05) and heme oxygenase 1 (HMOX1, p < 0.05), and increased enzyme activity of superoxide dismutase (SOD, p < 0.05) were found in bone marrow of Eimeria challenged groups compared with that of non-infected control. Similarly, enzyme activity of SOD and the mRNA level of SOD1, HMOX1 and aflatoxin aldehyde reductase (AKE7A2) were increased in the liver of infected broilers (p < 0.05), whereas glutathione (GSH) content was lower in the medium-high challenge group (p < 0.05) compared with non-challenged control. Moreover, the mRNA expression of catalase (CAT) and nuclear factor kappa B1 (NFKB1) showed dose-depend response in the liver, where expression of CAT and NFKB1 was upregulated in the low challenge group but decreased with the higher Eimeria challenge dosage (p < 0.05). In conclusion, high challenge dose of Eimeria infection negatively affected the long bone development. The structural changes of tibia and decreased mineral content were mainly located at the trabecular bone of metaphyseal area. The change of redox and impaired antioxidant status following the Eimeria infection were observed in the liver and bone marrow of broilers.Entities:
Keywords: bone health; bone mineral loss; bone quality; broiler bone; eimeria; oxidative stress
Year: 2022 PMID: 35923236 PMCID: PMC9340159 DOI: 10.3389/fphys.2022.945740
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Eimeria spp. challenge dosage (Unit: oocysts/chick).
| Treatment group |
|
|
| Total Concentration | Challenge Dosage |
|---|---|---|---|---|---|
| Control | 0 | 0 | 0 | 0 | Non-challenge |
| Low | 6,250 | 6,250 | 31,250 | 43,750 | Lowest challenge dose |
| Med-low | 12,500 | 12,500 | 62,500 | 87,500 | Medium-low challenge dose |
| Med-high | 25,000 | 25,000 | 125,000 | 175,000 | Medium-high challenge dose |
| High | 50,000 | 50,000 | 250,000 | 350,000 | Highest challenge dose |
Low, the lowest challenge dose; Med-low, the medium-low challenge dose; Med-high, the medium-high challenge dose; High, the highest challenge dose.
Definition and description of bone microstructure by using micro-CT method (Bouxsein et al., 2010).
| Abbreviation | Variable | Unit | Description |
|---|---|---|---|
| BMC | Bone mineral content | g | The amount of the solid objects (bone minerals that mostly included calcium and phosphorous) within the region of interest |
| BMD | Bone mineral density | g/mm2 | The ratio of bone minerals within a mixed bone-soft tissue region |
| TV | Total volume | mm3 | Volume of the entire region of interest |
| BV | Bone volume | mm3 | Volume of the region segmented as bone |
| BS | Bone surface | mm2 | Surface area of all solid objects (bone tissue) within the total tissue volume |
| BV/TV | Bone volume fraction | % | Ratio of the solid objects (bone tissue) volume to the total volume of the region of interest |
| BS/BV | Specific bone surface | mm2/mm3 | Ratio of the segmented bone surface to the mineralized bone volume |
| BS/TV | Bone surface density | % | Ratio of the segmented bone surface to the total volume of the region of interest |
| Tb. N | Trabecular number | 1/mm | Measure of the average number of trabeculae per unit length |
| Tb. Th | Trabecular thickness | mm | Mean thickness of trabeculae osseous structure. It assessed using direct 3D methods |
| Tb. Sp | Trabecular spacing | mm | Mean space between trabeculae (marrow space), assessed using direct 3D methods |
| SMI | Structure model index | - | An indicator of the structure of trabeculae; Parallel plates was defined as 0 and cylindrical rods was rated as 3 |
| Tb.pf | Trabecular pattern factor | 1/mm | Describes quantitatively trabecular connectivity |
| Conn. Dn | Connectivity density | 1/mm3 | A measure of the degree of connectivity of trabeculae normalized by TV |
| Po (op) | Cortical porosity (open pore) | % | In a given cortical region, the volume of open pores (Po.V, mm3) ÷ total volume of cortical bone compartment (Ct.V, mm3) |
| Po.V (op) | Open pore volume | mm3 | The volume of the open pores |
| Po.V (tot) | Total pore volume | mm3 | The volume of all pores |
| Po (tot) | Total cortical porosity | % | In a given cortical region, the volume of pores (Po.V, mm3) ÷ total volume of cortical bone compartment (Ct.V, mm3) |
Nucleotide sequences of the primers used for real-time qPCR.
| Gene | Primer Sequence (5′-3′) | Product length (bp) | Annealing temperature (°C) | Accession # | Gene references |
|---|---|---|---|---|---|
| GAPDH | F-GCTAAGGCTGTGGGGAAAGT R-TCAGCAGCAGCCTTCACTAC | 161 | 55 | NM_204,305.1 |
|
| ACTB | F-CAACACAGTGCTGTCTGGTGGTA R-ATCGTACTCCTGCTTGCTGATCC | 205 | 61 | NM_205,518.1 |
|
| NFKB1 | F-GAAGGAATCGTACCGGGAACA R-CTCAGAGGGCCTTGTGACAGTAA | 131 | 59 | XM_015,285,418.2 |
|
| RUNX2 | F-ACTTTGACAATAACTGTCCT R-GACCCCTACTCTCATACTGG | 192 | 60 | XM_015,285,081.2 |
|
| PPARG | F-GAGCCCAAGTTTGAGTTTGC R-TCTTCAATGGGCTTCACATTT | 131 | 58 | XM_025,154,400.1 |
|
| FASN | F-AGAGGCTTTGAAGCTCGGAC R-GGTGCCTGAATACTTGGGCT | 127 | 60 | NM_205,155.3 |
|
| FABP4 | F-GCAGAAGTGGGATGGCAAAG R- GTTCGCCTTCGGATCAGTCC | 153 | 60 | NM_204,290.1 |
|
| BGLAP | F-GGATGCTCGCAGTGCTAAAG R-CTCACACACCTCTCGTTGGG | 142 | 57 | NM_205,387.3 |
|
| SOD1 | F-ATTACCGGCTTGTCTGATGG R-CCTCCCTTTGCAGTCACATT | 173 | 58 | NM_205,064.1 |
|
| CAT | F-ACTGCAAGGCGAAAGTGTTT R-GGCTATGGATGAAGGATGGA | 222 | 60 | NM_001,031,215.1 |
|
| AKR7A2 | F-CAAACTGCAGGGTTCTCTTG R-GAAGTAGTTGGGGCAGTCGT | 234 | 60 | NM_205,344.1 |
|
| HMOX1 | F-CTGGAGAAGGGTTGGCTTTCT R-GAAGCTCTGCCTTTGGCTGTA | 166 | 60 | XM_417,628.2 |
|
| GPX1 | F-AACCAATTCGGGCACCAG R-CCGTTCACCTCGCACTTCTC | 122 | 60 | NM_001,277,853.2 |
|
GAPDH: glyceraldehyde-3-phosphate dehydrogenase; ACTB: actin beta; PPARG: peroxisome proliferator-activated receptor gamma; FASN: fatty acid synthase; SREBP1: sterol regulatory element-binding transcription factor 1; BGLAP: bone gamma-carboxyglutamate protein; RUNX2: runt-related transcription factor 2; FABP4: adipose tissue fatty acid binding protein four; NFKB1: nuclear factor kappa B subunit one; CAT: catalase; SOD1: superoxide dismutase type 1; GPX1: glutathione peroxidase one; HMOX1: heme oxygenase one; and AKR7A2: aflatoxin aldehyde reductase.
Tibia length, width, and cortical bone thickness.
| Unit (mm) | Bone length | Bone width | Cortical bone thickness |
|---|---|---|---|
| Control | 54.497 | 4.959 | 0.841 |
| Low | 54.436 | 4.969 | 0.850 |
| Med-low | 55.413 | 4.958 | 0.898 |
| Med-High | 55.109 | 4.969 | 0.841 |
| High | 55.092 | 5.086 | 0.873 |
| SEM | 0.244 | 0.051 | 0.021 |
| ANOVA | 0.226 | 0.925 | 0.836 |
Cortical thickness: a mean thickness of cortical mid-shaft.
Tibial metaphysis microstructure changes with increasing challenge dose of mixed Eimeria spp. oocysts.
| Items | Unit | Control | Low | Med-low | Med-High | High | SEM | ANOVA | |
|---|---|---|---|---|---|---|---|---|---|
|
| BMC | G | 61.244 ab | 70.906a | 68.282 ab | 67.241 ab | 51.567b | 2.139 | 0.025 |
| BMD | g/mm2 | 0.209a | 0.209a | 0.215a | 0.213a | 0.170b | 0.004 | 0.002 | |
| TV | mm3 | 295.216 | 339.192 | 318.777 | 312.631 | 303.064 | 6.177 | 0.284 | |
| BV | mm3 | 89.331 | 100.332 | 108.552 | 101.309 | 85.588 | 3.196 | 0.134 | |
| BS | mm2 | 1,260.402 | 1,419.550 | 1,415.952 | 1,333.981 | 1,116.761 | 48.366 | 0.250 | |
| BV/TV | % | 29.590 ab | 29.628 ab | 34.105a | 32.069 ab | 28.161b | 0.667 | 0.023 | |
| BS/BV | mm2/mm3 | 14.018 | 14.114 | 13.047 | 13.281 | 13.025 | 0.224 | 0.360 | |
| BS/TV | % | 4.160 | 4.171 | 4.454 | 4.236 | 3.671 | 0.105 | 0.202 | |
|
| BMC | G | 2.812a | 2.646a | 1.839ab | 2.462a | 1.087b | 0.161 | 0.001 |
| BMD | g/mm2 | 0.087a | 0.096a | 0.068ab | 0.083a | 0.038b | 0.005 | <0.001 | |
| TV | mm3 | 178.487 | 205.576 | 174.901 | 178.060 | 188.858 | 3.882 | 0.065 | |
| BV | mm3 | 5.802 | 7.704 | 6.717 | 6.086 | 4.863 | 0.331 | 0.073 | |
| BS | mm2 | 295.527a | 385.188ab | 340.596 ab | 321.624 ab | 258.360b | 14.230 | 0.048 | |
| BV/TV | % | 3.238 | 3.710 | 3.863 | 3.424 | 2.59072 | 0.156 | 0.075 | |
| BS/BV | mm2/mm3 | 52.046 | 50.578 | 50.831 | 52.900 | 54.140 | 0.643 | 0.394 | |
| Tb. N | 1/mm | 0.389 ab | 0.435 ab | 0.464a | 0.421 ab | 0.310b | 0.017 | 0.025 | |
| Tb. Th | Mm | 0.082 | 0.085 | 0.083 | 0.081 | 0.083 | 0.001 | 0.846 | |
| Tb. Sp | Mm | 2.848 | 2.513 | 2.364 | 2.376 | 2.935 | 0.087 | 0.100 | |
| SMI | - | 2.622b | 2.617b | 2.577b | 2.661 ab | 2.759a | 0.017 | 0.002 | |
| Tb.pf | 1/mm | 18.814 ab | 18.238 ab | 17.943b | 19.635 ab | 21.084a | 0.360 | 0.029 | |
| Conn. Dn | 1/mm3 | 10.158 ab | 11.076a | 11.852 ab | 10.389 ab | 8.077b | 0.407 | 0.035 | |
|
| BMC | G | 44.029 | 47.190 | 51.033 | 46.949 | 41.989 | 1.388 | 0.306 |
| BMD | g/mm2 | 0.412 | 0.401 | 0.404 | 0.402 | 0.409 | 0.876 | 0.876 | |
| TV | mm3 | 108.061 | 118.168 | 126.627 | 117.158 | 103.270 | 3.955 | 0.386 | |
| BV | mm3 | 79.177 | 87.435 | 93.899 | 87.243 | 78.179 | 2.614 | 0.298 | |
| BV/TV | % | 73.945 | 74.158 | 74.263 | 74.701 | 76.121 | 0.537 | 0.741 | |
| Po (op) | % | 25.951 | 25.736 | 25.604 | 25.171 | 23.763 | 0.536 | 0.737 | |
| Po.V (op) | mm3 | 28.767 | 30.605 | 32.559 | 29.757 | 24.971 | 1.455 | 0.589 | |
| Po.V (tot) | mm3 | 28.884 | 30.733 | 32.727 | 29.915 | 25.091 | 1.462 | 0.588 | |
| Po (tot) | % | 26.055 | 25.842 | 25.738 | 25.299 | 23.879 | 0.537 | 0.741 |
Low, the lowest challenge dose; Med-low, the medium-low challengeadose; Med-high, the medium-high challenge dose; High, the highest challenge dose.
BMC, bone mineral content; BMD, bone mineral density; TV, total bone volume; BV, bone volume (TV, minus bone marrow volume); BS, bone surface area; BV/TV, bone volume/total volume; BS/BV, bone surface/total volume; BS/TV, bone surface/total volume; Tb. N, trabecular number; Tb. Th, trabecular bone thickness; Tb. sp, trabecular spacing; SMI, structural model index; Tb. Pf, trabecular pattern factor; Conn. dn, connectivity density; Po.V (tot), total volume of pore space; Po. V (op), volume of open pore; Po (tot), porosity rate (percent).
a, ab,b Treatments with different letters means a significantly difference between treatments by using Tukey’s HSD, test, p < 0.05, N = 6.
FIGURE 1(A) The selection of metaphyseal region of interest. (B) Representative reconstructed 2D images of broiler tibia metaphysis at six dpi (19 days of age). Metaphyseal structure analysis showed a lower bone mineral content and density coupled with impaired trabecular bone traits following the higher inoculation doses of Eimeria. The negative impact of Eimeria infection on bone traits was mainly located at metaphyseal trabecular bone.
FIGURE 2Effects of increasing oocysts dose of Eimeria mix on osteogenesis, adipogenesis and fatty acid synthesis gene expression in bone marrow of broilers. Low, the lowest challenge dose; Med-low, the medium-low challenge dose; Med-high, the medium-high challenge dose; High, the highest challenge dose. BGLAP, bone gamma-carboxyglutamate protein; RUNX2, runt-related transcription factor 2; PPARG, peroxisome proliferator-activated receptor gamma; FASN, fatty acid synthase; SREBP1: sterol regulatory element-binding transcription factor 1; FABP4: adipose tissue fatty acid binding protein 4. a, ab, b Treatments with different letters means a significantly difference between treatments by using Tukey’s HSD test, p < 0.05, N = 6.
Superoxide dismutase activity (SOD, U/g bone marrow), catalase activity (CAT, U/g bone marrow), GSH (µM/g), GSSG (µM/g) and GSH/GSSG ratio (µM/µM) concentrations in bone marrow at six dpi.
| Items | Unit | Control | Low | Med-low | Med-high | High | SEM | ANOVA | Non-challenge vs. challenge |
|---|---|---|---|---|---|---|---|---|---|
| GSH | µM/g | 18.145 | 20.891 | 19.154 | 14.762 | 15.318 | 1.260 | 0.495 | 0.469 |
| GSSG | µM/g | 0.487 | 0.506 | 0.613 | 0.360 | 0.353 | 0.034 | 0.069 | 0.224 |
| GSH + 2GSSG | µM/g | 19.119 | 21.903 | 20.379 | 15.482 | 16.025 | 1.296 | 0.452 | 0.453 |
| GSH/GSSG | µM/µM | 5.093 | 5.002 | 5.137 | 4.574 | 4.470 | 0.288 | 0.935 | 0.244 |
| CAT | U/g | 32.290 | 30.271 | 26.408 | 27.419 | 44.407 | 3.124 | 0.386 | 0.937 |
| SOD | U/g | 4.574bc | 4.385c | 5.616ab | 5.892a | 5.434abc | 0.188 | 0.027 | 0.488 |
Low, the lowest challenge dose; Med-low, the medium-low challenge dose; Med-high, the medium-high challenge dose; High, the highest challenge dose.
The comparisons between non-challenge control and pooled challenged groups (Low, Med-low, Med-high, and High) were calculated by unpaired t-test with Welch’s correction.
GSH, glutathione content; GSSG, oxidized glutathione content; GSH + 2GSSG: the total glutathione level; GSH/GSSG, the ratio of reduced glutathione content to oxidized glutathione content; CAT, catalase activity; SOD, superoxide dismutase.
a, ab, abc,c Treatments with different letters means a significantly difference between treatments by using Tukey’s HSD, test, p < 0.05, N = 6.
FIGURE 3Effects of increasing oocysts dose of Eimeria mix on the expression of antioxidant-related transcript genes in bone marrow of broilers. Low, the lowest challenge dose; Med-low, the medium-low challenge dose; Med-high, the medium-high challenge dose; High, the highest challenge dose. CAT, catalase; SOD1, superoxide dismutase 1; NFKB1: nuclear factor kappa B subunit 1; GPX1: glutathione peroxidase 1; HMOX1: heme oxygenase 1; and AKR7A2: aflatoxin aldehyde reductase. a, ab, b Treatments with different letters means a significantly difference between treatments by using Tukey’s HSD test, p < 0.05, N = 6. * a significant difference between non-challenge control and pooled challenge groups (Low, Med-low, Med-high, and High) by using Welch’s t-test, p < 0.05.
Superoxide dismutase activity (SOD, U/g), catalase activity (CAT, U/g) and GSH content (µM/g) in the liver at six dpi.
| Items | Unit | Control | Low | Med-low | Med-High | High | SEM | ANOVA | Non-challenge vs. challenge |
|---|---|---|---|---|---|---|---|---|---|
| SOD | U/g | 3,891.0 | 16,676.5 | 10,079.2 | 13,335.7 | 13,097.8 | 60.4 | 0.166 | <0.001 |
| CAT | U/g | 6749.8 | 6851.56 | 4,361.84 | 5,402.07 | 5,253.27 | 2029.01 | 0.778 | 0.594 |
| GSH | µM | 11.562a | 7.876 ab | 6.710 ab | 6.374b | 7.688 ab | 0.600 | 0.036 | 0.091 |
Low, the lowest challenge dose; Med-low, the medium-low challenge dose; Med-high, the medium-high challenge dose; High, the highest challenge dose.
GSH, glutathione content; CAT, catalase activity; and SOD, superoxide dismutase.
The comparisons between non-challenge control and pooled challenged grops (Low, Med-low, Med-high, and High) were calculated by unpaired t-test with Welch’s correction.
a,ab,b Treatments with different letters means a significantly difference between treatments by using Tukey’s HSD, test, p < 0.05, N = 6.
FIGURE 4Effects of increasing oocysts dose of Eimeria mix on antioxidant-related transcripts gene expression in the liver of broilers. Low, the lowest challenge dose; Med-low, the medium-low challenge dose; Med-high, the medium-high challenge dose; High, the highest challenge dose. CAT, catalase; SOD1, superoxide dismutase 1; NFKB1, nuclear factor kappa B subunit 1; GPX1, glutathione peroxidase 1; HMOX1, heme oxygenase 1; and AKR7A2, aflatoxin aldehyde reductase. a, ab, b Treatments with different letters means a significantly difference between treatments by using Tukey’s HSD test, p < 0.05, N = 6. * a significant difference between non-challenge control and pooled challenge groups (Low, Med-low, Med-high, and High) by using Welch’s t-test, p < 0.05.
FIGURE 5Correlation of antioxidant enzyme mRNA expression and bone related parameters. (A) The positive correlation between liver GPX1 mRNA level and the bone marrow BGLAP mRNA expression (B) The positive correlation between bone marrow GPX1 mRNA expression and the bone marrow FASN mRNA expression (C) The positive correlation between bone marrow GPX1 mRNA expression and the between bone marrow FABP4 mRNA expression (D) The negative correlation between bone marrow CAT mRNA expression and tibia metaphyseal total BMD (E) The negative correlation between bone marrow CAT mRNA expression and tibia metaphyseal trabecular BMD.