Prevalence of Shiga toxin-producing Escherichia coli and Salmonellae and some associated hematologic and biochemical profile alterations in lambs.

Lamb enteritis constitutes an economic burden on sheep production worldwide. We aimed to estimate the prevalence of Shiga toxin-producing Escherichia coli (STEC) and Salmonellae among diarrheic lambs at Kafrelsheikh Governorate, Egypt and to detect the associated clinical, hematologic, biochemical, and antioxidant parameters. Fifty diarrheic and twenty apparently healthy control lambs were examined clinically, and hematologically. Diarrheic lambs had a significant elevated body temperature, respiratory and pulse rate, most of hemogram para-meters, total proteins and albumin, oxidative stress markers malonaldiahyde and nitric oxide levels, liver enzymes, urea and creatinine than control group. On the other hand, these diarrheic lambs had significant reduction in total leukocyte count and lymphocytes, antioxidant biomarkers super oxide dismutase activities and reduced glutathione than control lambs. E. coli and Salmonella spp. were isolated from 32.00% and 16.00% of diseased lambs, respectively. Serotyping and biochemical tests of examined samples identified 16 E. coli isolates belonged to 10 different serotypes; O6, O8, O26:H11, O75, O84:H21, O103:H2, O114:H4, O121:H7, O128:H2 and O163:H2. All isolates are STEC as they harbor either Shiga-toxin 1 or Shiga-toxin 2 genes or both. One isolate carries intimin gene (eaeA) and classified as EHEC; O26:H11. The obtained nine isolates of Salmonella carry enterotoxin (Stn) genes, eight of them carry hyper-invasive locus (hilA) gene, all isolates belonged to six serotypes; S. Enteritidis, S. Heidelberg, S. Tsevie, S. Typhimurium, S. Essen, and S. Infantis. Lamb diarrhea was prevalent in the studied area and might constitute a veterinary and public health threat. Alteration in hemato-biochemical para-meters and oxidative-anti-oxidant balance could help adopt appropriate treatment regimens.

Introduction

Bacterial enteritis in lambs is a serious health disorder associated with diarrhea resulting from alterations in intestinal flora which is responsible for the disorder of the colonic environment and leads into economic losses resulted from low growth rates and death due to malnutrition and dehydration.[1],[2]

Diarrhea associated with infectious agents in a herd is often difficult to be managed due to the large number of potential enteropathogens involved and the difficulty in confirming an etiologic diagnosis.[3] Several etiological agents are associated with infectious diarrhea in lambs like E coli, Salmonella spp., Clostridium spp., Campylobacter spp., Cryptosporidium spp., Giardia spp., Adenoviridae, Coronaviridade, and Rotaviriadae.[4]

Escherichia coli is considered as the most common and important pathogen of bacterial enteritis in lambs and kids and is associated with a serious health risk.[5] Pathogenic strains of E. coli are distinguished from normal flora by their possession of virulence factors. These pathogenic strains include Shiga toxin-producing E. coli (STEC), entero-pathogenic E. coli (EPEC) and enterotoxigenic E. coli (ETEC) which considered the major cause of diarrhea in newborn farm animals.[6] STEC isolates carry genes encoding Shiga toxins and may possess other virulence genes for intimin and enterohemolysin. STEC strains, which also have eaeA and ehly genes, are called enterohemorrhagic E. coli (EHEC).[7]

Enteric disease associated with Salmonella occurs only sporadically,[8] but outbreaks are typically associated with Salmonella enterica subspecies enterica infection, and serotype typhimurium is the most commonly linked to gastroenteritis in sheep.[9] Virulence of Salmonellae depends on the presence of genes which are responsible for invasion into the epithelial cells and colonization and secretory diarrhea; sefA and stn, respectively.[10]

The infected lambs with virulent strains of E. coli such as STEC and salmonella spp. and the presence of these microorganisms in lamb fecal excreta constitutes a veterinary and public health threat.[11] Therefore, serological and molecular techniques are essential for detecting and characterizing pathogenic bacteria and virulence markers, respectively which are responsible for bacterial enteritis.[12]

On the other hand, diarrhea in lambs is associated with hemato-biochemical and oxidative parameters alterations creating an imbalance in the electrolyte, fluid and acid-base balance in the animal body. These changes establish a high risk for animal mortality and, therefore the evaluation of such alterations is important for determining the proper medical intervention.[13]

The current work aimed to determine the prevalence of Shiga toxin-producing Escherichia coli and Salmonellae among lambs suffered from enteritis in Kafrelsheikh Governorate. Furthermore, we evaluated the clinical, hemato-biochemical, oxidative and antioxidant para-meters consequences among these lambs.

Materials and Methods

Animals and samples. A total of 70 (apparently healthy; n = 20 and diarrheic lambs; n = 50) lambs of both sexes and aged from 1 to 60 days from Kafrelsheikh Governorate were examined and sampled. The animals were from a large sheep farm out of the six governmental farms in the governorate.

Clinical examination. All animals were subjected to clinical examination including general health condition, body temperature, pulse, respiration, character of mucous membranes, auscultation of chest and abdomen and characters of the diarrhea according to Radostits et al.[9]

Blood collection for hematological examination and antioxidant biomarkers. Two blood samples were collected from jugular vein of each lamb. The first sample was collected in Vacutainer™ tubes (BD, Franklin Lakes, USA) containing EDTA for hematological studies according to standard techniques described by Feldman et al.[14] using Vet analyzer (Medonic CA620/530; Boule Medical AB, Stockholm, Sweden) and for anti-oxidant biomarkers super oxide dismutase (SOD) according to Abelson et al.[15] and reduced glutathione (GSH) according to Pertile et al.[16] The second sample was collected without anticoagulant and allowed to clot at room temperature, then centrifuged at 3,000 rpm for 10 min for serum separation. Serum samples were stored at – 20.00 ˚C for further biochemical studies.

Serum biochemical parameters and oxidative stress markers. The following biochemical parameters were determined in serum: serum total protein, serum albumin according to Henry et al.,[17] serum globulin was calculated as the difference between total protein and albumin together with albumin to globulin ratio (A/G) according to Kaneko et al.[18] Serum alanine amino transferase (ALT), aspartate amino transferase (AST) according to Reitman and Frankel,[19] and alkaline transferase (ALP) according to Rec.[20] Glucose according to Nagy et al.[21] urea nitrogen according to Patton and Crouch,[22] creatinine according to Young,[23] L-malondialdehyde (L-MDA) according to Esterbauer et al.[24] Nitric oxide (NO) according to Aebi,[25] Spectrophoto-metrically (Optizen 3220 UV; Mecasys Co. Ltd, Daejeon, South Korea) using diagnostic test kits (Spinreact, Girona, Spain for serum proteins and Spectrum Diagnostics, Cairo, Egypt for other parameters).

Samples for bacteriological examination. Rectal swabs were taken from diarrheic (lambs) by means of sterile cotton swabs and transported to laboratory as soon as possible in sterile MacConkey broth (Oxoid Ltd., Basingstoke, UK) and incubated at 37.00 ˚C for 24 hr for increasing chances of isolation. The samples (rectal swabs) were cultivated aerobically then bacterial isolates were subjected for characterization by studying their cultural, and biochemical characteristics according to Quinn et al.[26]

Isolation and identification of causative agents. For isolation of Salmonella strains, a loopful from the MacConkey broth was inoculated into selenite F broth with overnight incubation at 37.00 ˚C. Then, a loopful was streaked out onto MacConkey’s agar, xylose lysine deoxycholate (Oxoid Ltd.) and Salmonella–Shigella agar media (Oxoid Ltd.) and incubated at 37.00 ˚C for 24 hr. Suspected colonies were subjected to biochemical testing according to Collee et al.[27] For isolation of E. coli strains, a loopful from the MacConkey broth was inoculated into MacConkey’s agar and incubated at 37.00 ˚C for 24 hr. Lactose fermenter (pink) colonies were streaked onto and Eosin Methylene Blue agar and confirmed as E. coli using the standard biochemical tests according to Collee et al.[27]

Biochemical identification of Standard bio-chemical tests for detection of E. coli were performed for 16 positive isolates according to Kreig and Holt,[28] including indole production test, methyl red test, nitrite reduction, ONPG, Sugar fermentation as lactose and arabinose.

Biochemical identification of Standard biochemical tests for detection of Salmonella were performed for nine positive isolates according to Kreig and Holt,[28] including motility positive, methyl red test, citrateutilization, H2S, ODC, LDC and arginine dihydrolase while with Sugar fermentation only xylose.

Serological identification of The isolates of E. coli were serologically identified according to Kok et al.[29] using rapid diagnostic E. coli antisera sets (Denka Seiken, Tokyo, Japan) for diagnosis of the enteropathogenic types.

Serological identification of . The isolates of Salmonella were serologically carried out according to Kauffman,[30] for determination of somatic (O) antigen by Slide agglutination test and flagellar (H) antigen using tube agglutination test.

Multiplex polymerase chain reaction for detection of virulence genes. The PCR was applied on E. coli isolates as well as Salmonella isolates.

Genomic DNA extraction. It was carried out following Sambrook et al.[31] Genomic DNA from individual pure cultures of E. coli isolates and salmonella isolates was extracted by GeneJET Genomic DNA Purification Kit (Thermo-Fisher, Waltham, USA) according to manufacturer's guidelines.

Primer sequences of used for PCR identification. Application of PCR for identification of Shiga toxins (stx1 and stx2) and intimin (eaeA) genes of E. coli was performed essentially using primers (Amersham Pharmacia Biotech, Orsay, France), (Table 1).

Table 1

Primer sequences of E. coli and Salmonella spp. virulence genes used for PCR identification

Microorganism	Primer	Oligonucleotide sequence (5′ → 3′)	Product size (bp)	References
hilA (R)	5′ CTGTCGCCTTAATCGCATGT ′3
E. coli	stx1 (F)	5′ ATAAATCGCCATTCGTTGACTAC ′3	180	Paton and Paton[48]
	stx 1 (R)	5′ AGAACGCCCACTGAGATCATC ′3
	stx 2 (F)	5′ GGCACTGTCTGAAACTGCTCC ′3	255
	stx 2 (R)	5′ TCGCCAGTTATCTGACATTCTG ′3
	eaeA (F)	5′ GACCCGGCACAAGCATAAGC ′3	384
	eaeA (R)	5′ CCACCTGCAGCAACAAGAGG ′3
Salmonella spp.	Ssn (F)	5′ CTTTGGTCGTAAAATAAGGCG ′3	260	Makino et al.[49]
	stn (R)	5′ TGCCCAAAGCAGAGAGATTC ′3
Salmonella spp.	hilA (F)	5′ CTGCCGCAGTGTTAAGGATA ′3	497	Guo et al.[50]

Primer sequences of species used for PCR identification. Application of PCR for identification of virulence factors including enterotoxin (stn), and hyper-invasive locus (hilA) genes of Salmonella species were synthesized (Table 1).

Statistical analysis. All data were presented by the means ± standard error. All pair-wise comparison of infected lambs to control was analyzed by one way analysis of variance using SPSS Software for data analysis (version 23.0, IBM Corp., Armonk, USA). Unless otherwise indicated, all differences were considered statistically significant at p < 0.05.

Results

Clinical Findings. The control lambs had a normal appetite with normal defecation in form of small hard pellets. On the other hand, lambs suffered from enteritis manifested clinical signs of diarrhea i.e., profuse and watery in some cases, and pasty white or yellowish and rancid in the others. The fecal materials were accumulated on the tail and hind limbs. These lambs suffered from fever associated with dullness, anorexia with congested mucous membrane. Body temperature, respiratory rate and pulse rate among diseased lambs were significantly higher than among the control lambs at p ≤ 0.05; 41.10 ± 0.08 ˚C, 37.33 ± 0.88 and 121.60 ± 2.60 among diseased lambs and 39.20 ± 0.17 ˚C, 23.66 ± 1.20 and 81.00 ± 1.52 among control lambs, respectively.

Hematological findings. Lambs suffered from diarrhea had an elevated RBCs count, Hb concentration, PCV neutrophils and monocytes than control lambs. On the other hand, diarrheic lambs had a significant decrease in total leukocyte count and lymphocytes compared to the control lambs (Table 2).

Table 2

Hemato-biochemical and antioxidants parameters among diarrheic and control lambs

Parameters	Control	Diseased
Whole blood sample
RBCs (10 6 mm -3 )	7.90 ± 0.25	9.25 ± 0.24*
Hb (g dL -1 )	10.50 ± 0.45	12.14 ± 0.14**
PCV (%)	29.12 ± 0.56	34.15 ± 1.15**
WBCs (10 3 mm -3 )	9.92 ± 0.68	8.80 ± 0.56*
Lymphocytes (%)	55.50 ± 2.08	37.80 ± 2.6**
Neutrophil (%)	39.50 ± 2.00	54.50 ± 3.2**
Monocytes (%)	2.52 ± 0.04	5.01 ± 0.14**
Eosinophils (%)	2.20 ± 0.21	2.10 ± 0.45
Basophils (%)	1.24 ± 0.12	1.00 ± 0.12
SOD (U mL -1 )	205.12 ± 10.45	152.94 ± 9.14**
GSH-R (mmol L -1)	6.24 ± 0.10	5.12 ± 0.14*
Serum sample
Total protein (g dL -1 )	6.29 ± 0.21	8.37 ± 0.22*
Albumin (g dL -1 )	3.33 ± 0.45	5.09 ± 0.09*
Globulin (g dL -1 )	2.96 ± 0.50	3.28 ± 0.15
A/G ratio	1.13 ± 0.12	1.55 ± 0.12
ALT (U L -1 )	50.12 ± 2.56	68.45 ± 4.22**
AST (U L -1 )	29.16 ± 2.56	38.55 ± 1.18**
ALP (U L -1 )	16.20 ± 2.21	33.30 ± 1.45**
Urea (mg dL -1 )	37.16 ± 0.45	51.22 ± 2.71**
Creatinine (mg dL -1 )	1.01 ± 0.04	1.12 ± 0.24*
Glucose (mg dL -1 )	55.12 ± 1.12	48.12 ± 2.12**
MDA (mmol mL -1 )	1.69 ± 0.21	4.25 ± 0.14**
NO (µmol L -1 )	6.96 ± 1.50	9.31 ± 0.15*

RBCs: Red blood cells, Hb: Hemoglobin, PCV: Packed cell volume, WBCs: White blood cells, SOD: Superoxide dismutase, GSH-R: Reduced glutathione, A/G: Albumin to globulin ratio, ALT: Serum alanine amino transferase, AST: Aspartate amino transferase. ALP: Alkaline transferase, MDA: Malonaldiahyde, NO: Nitric oxide.

*,** indicate significant differences compared to the control values at p ≤ 0.05 and p ≤ 0.001, respectively.

Serum biochemical analysis. There was a significant increase in serum protein profile and serum enzyme activities among diarrheic than the control lambs. How-ever, diarrheic lambs had a significant decrease in serum glucose concentration than the control ones (Table 2).

Oxidative stress and antioxidant biomarkers. The MDA and NO levels were significantly increased in diarrheic lambs compared to apparently healthy lambs (p < 0.05), while SOD activities and GSH levels were significantly reduced among diseases lambs (p < 0.05), (Table 2).

Microbiological findings. The E. coli and Salmonella were the main cause of bacterial enteritis in examined lambs. The percentage of isolated bacteria was calculated relative to the total diseased lambs. The bacterial isolates from collected fecal samples of diarrheic lambs found that E. coli was present in 16 samples (32.00%), Salmonella in nine samples (18.00%), Enterobacter spp. in five samples (10.00%), proteus in four samples (8.00%), Citrobacter spp. in four samples (8.00%), Klebsiella spp. in four samples (8.00%), Providencia spp. in three samples (6.00%), Serrattia spp. in two samples (4.00%) and about three samples (6.00%) were mixed infections. A total of 10 different E. coli serotypes were identified biochemically as O6, O75, O8, O114, O128, O26, O84, O103, O121 and O163 (Table 3) and a total number of six different salmonella serotypes were identified biochemically as S. Enteritidis, S. Heidelberg, S. Tsevie, S. Typhimurium, S. Essen, and S. Infantis (Table 3).

Table 3

Virulence genes distribution of E. coli and Salmonella spp. isolated from diarrheic lambs

Serovars	Extracted isolates (n)	Genes (n)
Salmonella		stn		hilA
O163 : H2	1	0	1	0
S. Enteritidis	3	3		3
S. Essen	1	0		1
S. Heidelberg	1	1		1
S. Infantis	2	0		2
S. Tsevie	1	1		0
S. Typhimurium	1	1		1
E. coli		stx1	stx2	eaeA
O6	1	1	0	0
O8	2	2	2	0
O26 : H11	1	1	1	1
O75	3	2	0	0
O84 : H21	2	0	2	0
O103 : H2	1	1	1	0
O114 : H4	1	1	0	0
O121 : H7	1	0	1	0
O128 : H2	3	3	0	0

Multiplex PCR of the virulence of serogroups and serotypes. All of E. coli isolated was identified by PCR as Shiga toxin producing isolates (prevalence 100%). The production of stx 1, stx2 and eaeA genes was varied among the isolated serogroups. The stx 1 was shown in serogroups: (mainly O6), (O75), (O8), (O103), (O114) and (O128). Moreover, stx 2 was shown in serogroups: mainly (O8), (O26), (O84), (O103), (O121) and (O163). On the contrary, the production of eaeA was shown among the recovered serogroups: mainly (O26), (O8) and (O78), (Fig. 1A). The production of Stn and hilA genes was varied among the isolated serogroups. Stn was shown in S. Enteritidis, S. Heidelberg, S. Tsevie and S. Typhimurium. Moreover, the production of hilA was shown among S. Enteritidis, S. Essen, S. Heidelberg, S. Tsevie, S. Infanti and S. Typhimurium (Table 3, Fig. 1B).

Fig. 1

Agarose gel electrophoresis of multiplex PCR. A) stx1 (180bp), stx2 (255 bp) and eaeA (384 bp) virulence genes for characterization of Enteropathogenic E. coli. Lane M: 100 bp ladder as molecular size DNA marker. Lane C+: Control positive E. coli for stx1, stx2, eaeA and hlyA genes. Lane C-: Control negative. Lanes 1 (O6), 5, 6 (O75), 11 (O114), 13, 14 and 15 (O128): Positive E. coli for stx1gene. Lanes 8, 9 (O84), 12 (O121) and 16 (O163): Positive E. coli for stx2 gene.Lanes 2, 3 (O8) and 10 (O103): Positive E. coli for stx1 and stx2 genes. Lane 4 (O26): Positive E. coli for stx1, stx2 and eaeA genes. Lane 7 (O75): Negative E. coli for stx1, stx2 and eaeA genes. B) stn (260 bp) and hilA (497 bp) virulence genes for characterization of Salmonella species. Lane M: 100 bp ladder as molecular size DNA marker. Lane C+: Control positive strain for stn and hilA genes. Lane C-: Control negative. Lanes 1, 2, 3 (S. Enteritidis), 5 (S. Heidelberg) and 9 (S. Typhimurium): Positive Salmonellae for stn and hilA genes. Lanes 4 (S. Essen), 6 and 7 (S. Infantis): Positive Salmonellae for hilA gene. Lane 8 (S. Tsevie): Positive Salmonella strain for stn gene

Discussion

Bacterial enteritis in lambs is a serious problem facing the international intensified livestock production. The disease morbidity and mortalities result mainly from the severe alterations in the hemato-biochemical parameters and oxidative-antioxidative balance in affected lambs.[11] In the current study, the clinical and hemato-bicoemical parameters disturbances and the oxidative-antioxidative imbalance among lambs with bacterial enteritis were studied at Kafrelsheikh governorate, Egypt. Furthermore, the prevalence of STEC and Salmonella spp. enteritis among these lambs were determined. Our results are in agreement with what had been reported by Radostits et al.[9] who stated that the clinical signs of bacterial enteritis among lambs characterized by feces of clay to yellowish gray or grayish to greenish color containing mucous and sometimes blood. Many cases showed a rise in body temperature with congested mucous membrane.

Similarly, the recorded anorexia, depression, dullness and muscular weakness among lambs might be due to escape of intracellular potassium, hyperkalemia and hypoglycemia as confirmed in hemato-biochemical alterations obtained in the current study. The most isolated bacterial species in the current study were E. coli and Salmonella spp. and these bacteria are responsible for the clinical signs. E. coli bacteria adhere to the apical portion of microvilli which fuse with one another and become atrophic resulting in indigestion and malabsorption.[32] In salmonellosis, there is an excessive stimulation of active chloride secretion with inhibition of sodium absorption resulting in drawing of water tissue to gut leading to diarrhea.[9]

The current study demonstrates a highly significant increase in PCV, RBC count and Hb value than those in healthy ones. The increase in hematological parameters may be attributed to hemo-concentration, excessive loss of body fluid and dehydration which lead to decrease plasma volume.[9] Leukogram in diarrheic lambs found to be significantly depressed for total WBCs than the corresponding values in healthy ones. Differential leucocyte count revealed that there was marked lympho-penia, neutrophilia and monocytosis. The decrease of total leucocytic count in diarrheic lambs may be attributed to the stress of malnutrition. This suggestion was supported by the result obtained by Mgongo et al.[33] Lymphopenia might have been due to stressful condition produced by multiple etiological agents.

Serum analysis of diarrheic lambs showed significant decrease in serum glucose levels with compared to the control. The occurrence of hypoglycemia in diarrheic lambs may be attributed to weak or absence of normal suckling affinity and altered intestinal epithelial transport and developing endotoxic-septic shock.[34] On the other hand, increase in the concentrations of serum total proteins and albumin in diarrheic lambs are in line with Guzelbektes et al.[35] who showed that diarrhea also influenced the plasma protein profile increasing values for total serum protein and serum albumin concentration.

Ghanem et al. stated that inflammation of gastro-intestinal tract of diarrheic sheep and cellular destruction of the liver and intestinal mucosa lead to significant increase in serum enzyme activities of ALT, AST and ALP in diarrheic animals compared to the control healthy ones[36] which are in agreement with our findings.

Kidney function tests of diarrheic lamb in this study are in agreement with Singh et al. who stated that, uremia is a constant finding especially in the late stage of neonatal calf diarrhea with marked increase in serum urea and exerts its due effect in the pathogenesis of diarrhea.[13] This may be due to decrease in renal function and reduction in glomerular filtration rate caused by hypovolemia, systemic arterial hypotension and vasopressin release.

Concerning oxidative stress and antioxidant status of diarrheic lambs, our results are in agreement with previously report by Ahmed and Soad, as they mentioned that, the reduced SOD activities in diarrheic sheep lead to accumulation of oxidant substances and free radicals that caused cellular damage to the intestinal lining mucosa.[37] Higher MDA levels in serum of diarrheic lambs suggested increased production of lipid peroxidation in the liver, and indirectly pointed to enhanced free radical generation, lipid peroxidation and oxidative stress.

Bacterial isolates from collected fecal samples of diarrheic lambs revealed that many bacterial species are incriminated as causative agents in such problem, especially when the respective organisms have been isolated in pure culture as declared by Wani et al.[38] who isolated similar bacteria from fecal samples of diarrheic lambs and Nasr et al.[39] who isolated E. coli (34.20 %), Salmonella (5.26%), Proteus (13.10%), Klebsiella (7.89%) and mixed infection (21.00%).

In the current study E. coli and Salmonella were the main cause of bacterial diarrhea in lamb. Several investigations isolated the same organisms with various percentages.[40] The prevalence of Salmonella in the present study was higher than that reported by Younis et al.[41] (4.09%). Much more prevalence of Salmonella was reported by Moussa et al.[42] (43.53%). Differences of the prevalence rates of Salmonella in diarrheic lambs in comparison to the previous studies could be explained in the light of species and geographical locations and hygienic measures. These factors significantly influence the prevalence of salmonellosis.[41] The prevalence of E. coli in the current study was nearly coincided with the findings of Bendali et al.[43] in France (20.30%), but higher than those of Azzam et al.[44] (5.40%), and lower than that recorded by Osman et al.[45] (63.60%). The differences of the prevalence rates of E. coli in diarrheic lambs may be attributed also to the geographical locations and management practice as well as hygienic measures where ETEC infection occurs mainly through ingestion of contaminated food or water.6 Proteus sp. and Klebsiella sp. appear to play a minor role as causative agents of diarrhea in sheep.[40]

Up to our knowledge, the current study is one of the first researches on the characterization of STEC and salmonella spp. responsible for diarrhea among neonatal lambs in Egypt. The virulence of E. coli serogroups mainly controlled via the production of virulence encoding genes, in particular stx1, stx2 and eaeA. Our results detected that all of serotypes are STEC and one serotype belonged to EHEC and these serotypes are considered major causes of enteritis among animals and hemorrhagic enteritis among humans.[12] O8 and O75 serogroups are known to be ETEC which commonly isolated from diarrheic lambs.[12] In the current study, these 2 serotypes carry the Shiga toxin producing genes and this may be attributed to the nature of horizontal gene transfer (HGT) among different E. coli serotypes,[46] which is responsible for evolution of new pathogenic serotypes of E. coli. The limitation of our study was that we did not identify sta genes for these 2 serotypes to confirm the existence of new hybrid serotype STEC-ETEC and further work is required to confirm that finding. However, we believe that this finding is not far from the reality because we depend on gold standard serological tests for identification of E. coli serotypes.

The data demonstrated that a wide variation of STEC and ETEC serogroups were incremented in the incidence of diarrhea in small ruminates in Egypt as similar to the results obtained by Aref et al.[46] The coexisting between STEC and ETEC associated virulence genes in E. coli strains of human, animal, and environmental origins has been reported in Germany, United States and Slovakia and some of which have been associated with human disease.[47]

The virulence of salmonella serogroups mainly controlled via the production of Stn and hilA genes which were varied among the isolated serogroups. S. Enteritidis, S. Heidelberg and S. Typhimurium were all commonly isolates from diarrheic lambs.[38]

In conclusions, E. coli and Salmonella spp. are the most important cause of bacterial enteritis and diarrhea among lambs at Kafrelsheikh governorate, Egypt. Among the isolated bacteria, STEC especially EHEC and salmonella spp. are the most prevalent serotypes and this represents a veterinary and public health threat. The alteration in hemato-biochemical parameters and the disturbance in the oxidant-antioxidant balance among affected lambs could be used to adopt new strategy towards more suitable treat-ments and preventive measures against such problem.

Conflict of interest

The authors declare no financial or conflict of interest regarding this study that could inappropriately influence the work.