Brittney J Brown1, Kimber L Boekell1, Brian R Stotter1,2, Brianna E Talbot1, Johannes S Schlondorff1. 1. Division of Nephrology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, United States of America. 2. Division of Nephrology, Boston Children's Hospital, Harvard Medical School, Boston, Massachusetts, United States of America.
Abstract
Mutations in TRPC6 are a cause of autosomal dominant focal segmental glomerulosclerosis in humans. Many of these mutations are known to have a gain-of-function effect on the non-specific cation channel function of TRPC6. In vitro studies have suggested these mutations affect several signaling pathways, but in vivo studies have largely compared wild-type and Trpc6-deficient rodents. We developed mice carrying a gain-of-function Trpc6 mutation encoding an E896K amino acid change, corresponding to a known FSGS mutation in TRPC6. Homozygous mutant Trpc6 animals have no appreciable renal pathology, and do not develop albuminuria until very advanced age. The Trpc6E896K mutation does not impart susceptibility to PAN nephrosis. The animals show a slight delay in recovery from the albumin overload model. In response to chronic angiotensin II infusion, Trpc6E896K/E896K mice have slightly greater albuminuria initially compared to wild-type animals, an effect that is lost at later time points, and a statistically non-significant trend toward more glomerular injury. This phenotype is nearly opposite to that of Trpc6-deficient animals previously described. The Trpc6 mutation does not appreciably impact renal interstitial fibrosis in response to either angiotensin II infusion, or folate-induced kidney injury. TRPC6 protein and TRPC6-agonist induced calcium influx could not be detected in glomeruli. In sum, these findings suggest that a gain-of-function Trpc6 mutation confers only a mild susceptibility to glomerular injury in the mouse.
Mutations in TRPC6 are a cause of autosomal dominant focal segmental glomerulosclerosis in humans. Many of these mutations are known to have a gain-of-function effect on the non-specific cation channel function of TRPC6. In vitro studies have suggested these mutations affect several signaling pathways, but in vivo studies have largely compared wild-type and Trpc6-deficient rodents. We developed mice carrying a gain-of-function Trpc6 mutation encoding an E896K amino acid change, corresponding to a known FSGS mutation in TRPC6. Homozygous mutant Trpc6 animals have no appreciable renal pathology, and do not develop albuminuria until very advanced age. The Trpc6E896K mutation does not impart susceptibility to PAN nephrosis. The animals show a slight delay in recovery from the albumin overload model. In response to chronic angiotensin II infusion, Trpc6E896K/E896K mice have slightly greater albuminuria initially compared to wild-type animals, an effect that is lost at later time points, and a statistically non-significant trend toward more glomerular injury. This phenotype is nearly opposite to that of Trpc6-deficient animals previously described. The Trpc6 mutation does not appreciably impact renal interstitial fibrosis in response to either angiotensin II infusion, or folate-induced kidney injury. TRPC6 protein and TRPC6-agonist induced calcium influx could not be detected in glomeruli. In sum, these findings suggest that a gain-of-function Trpc6 mutation confers only a mild susceptibility to glomerular injury in the mouse.
Focal and segmental glomerulosclerosis (FSGS) is a common cause of nephrotic syndrome in adults, frequently progresses to end-stage kidney disease, and has few effective treatment options [1-3]. Studies over the last 25 years have uncovered a substantial genetic component in the pathogenesis of FSGS [4-9]. Several dozen genes are implicated in the development of autosomal recessive and dominant forms of congenital nephrotic syndrome and FSGS [10]. Among these, gain-of-function mutations in TRPC6 are known to cause autosomal dominant FSGS in humans [11-17].Canonical transient receptor potential 6 (TRPC6) is a member of the transient receptor potential (TRP) superfamily of cation channels [18, 19]. TRPC6 is a non-specific cation channel activated downstream of Gαq coupled receptors [20], including angiotensin II receptor 1 [13], and functions as a receptor-operated calcium effector [21]. Multiple TRPC6 mutations have been reported in cases of autosomal dominant, predominantly adult onset, FSGS [12–17, 22]. The plurality of these have a gain-of-function (GOF) phenotype, and cluster to the interface of the N-terminal ankyrin repeat domain with the C-terminal rib helix and coiled-coil [23-25], disrupting an inhibitory calcium-binding site [26]. In vitro studies demonstrate that overexpression of TRPC6 GOF mutants activates several signaling pathways [27, 28], and induces cytotoxicity [29-31]. The relevance of these findings to disease pathogenesis, however, remains uncertain.An animal model genetically recapitulating TRPC6 gain-of-function disease has not been reported to date. Transgenic overexpression of either wild-type, or gain-of-function, mutant Trpc6 in podocytes causes only modest albuminuria and mild histological changes in mice, with no clear difference between wild-type and mutant Trpc6 animals [32]. As Trpc6 is widely expressed, including in mesangial cells, renal tubular epithelial cells, smooth muscle cells, and fibroblasts [13, 33–35], the relative importance of TRPC6 activity in podocytes versus other cells types in the pathogenesis of FSGS is unclear. While TRPC6 has been shown to be upregulated in several acquired proteinuric diseases [36-38], whether increased channel expression mediates similar pathologic effects as mutant TRPC6 is unknown. Studies utilizing Trpc6 knockout animals have provided conflicting data as to a role for the wild-type channel in renal disease, with some reporting amelioration of disease [29, 35, 37, 39–41], and others increased susceptibility [42, 43].In the present study, we characterize the renal consequences of introducing a gain-of-function E896K mutation [44], corresponding to the human TRPC6 E897K FSGS mutation [12], into the mouse Trpc6 gene. Homozygous Trpc6 mice have no baseline renal pathology or proteinuria until advanced age. They show no susceptibility to PAN nephrosis, only mildly delayed recovery from the albumin overload model, and transiently higher albuminuria early in an angiotensin II infusion model with an associated trend toward more glomerular sclerosis. Furthermore, the Trpc6 mutation does not influence recovery from, nor residual interstitial fibrosis induced by, folate-induced acute kidney injury. In sum, the results suggest that gain-of-function Trpc6 mutations induce only mild susceptibility to renal disease in the mouse.
Material and methods
Materials
All chemicals were purchased from Sigma Aldrich unless otherwise specified. GSK1702934A (GSK) was obtained from Focus Biomolecules and dissolved in DMSO. Fura-2 QBT was from Molecular Devices. Puromycin aminonucleoside was from MedChemExpress.
Mice
All animal procedures were approved by the Beth Israel Deaconess Medical Center (BIDMC) Animal Care and Use Committee, and carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Trpc6 mice were generated at the BIDMC transgenic core via established protocols as described [44]. Animals were backcrossed and maintained on an FVB/NJ (Jackson Laboratory) background. Genotyping of the Trpc6 locus was performed using a custom TaqMan SNP assay. Trpc6 mice [45] were obtained from the Jackson Laboratory. After crossing the mice with C57BL/6J, heterozygous Trpc6 mice were crossed to generate Trpc6 mice and littermate Trpc6 wild-type animals. Animals were maintained in a temperature controlled facility with a 12 hour light, 12 hour dark cycle, and had ad lib access to water and standard chow.For tissue collection, mice were sacrificed by deep anesthesia with inhaled isoflurane on a warming blanket to minimize distress, followed by terminal cardiac puncture. Serum samples were obtained by cheek pouch vein or terminal cardiac puncture, and sent to the UAB O’Brien Center Core C for serum creatinine measurement by isotope dilution LC-MS/MS. Spot urine samples were collected from mice in unlined cages for up to 3 hours. Albuminuria quantification was performed using a mouse albumin ELISA kit (Bethyl Laboratories, Inc. E90-134). Urine creatinine measurement was performed by quantitative colorimetric assay using the QuantiChrom Creatinine Assay Kit (BioAssay Systems DICT-500).
Albumin overload model
8–12 week old, male wild-type (n = 11) and Trpc6 (n = 15) mice were given daily injections of low-endotoxin bovine serum albumin (BSA, A-9430, Sigma Chemical Co, St. Louis, MO) in sterile saline (300mg/ml) by intraperitoneal injection at a dose of 10mg/g body weight on days 1–5 using an established protocol [46]. Urine samples were collected at baseline, day 2 (prior to the second injection), day 6 (24 hours after the last injection), day 9 and day 12. Urine albumin and creatinine measurements were obtained as above.
Puromycin aminonucleoside nephrosis
We utilized the two dose PAN model as described by Refaeli et al. [47] 8 to 10 week old male mice of various genotypes were utilized: Trpc6 on an FVB background; and wild type and Trpc6 F1 offspring of FVB and 129X1/SvJ (Jackson Laboratory) crossings. Animals were given two doses of puromycin aminonucleoside (450mg/kg; dissolved in normal saline at 18mg/ml) by intraperitoneal injection on days 0 and 7. Urine was collected at baseline, and at day 14 and 21; animals were sacrificed and kidneys collected at day 14 or 21.
Angiotensin II infusion model
Three month old male wild-type and Trpc6 mice (n = 10 each) were implanted with osmotic minipumps (Alzet model 2004; Alza Corp) loaded with angiotensin II diluted in sterile saline to provide a dose of 1 μg/kg/min. The minipumps were implanted in a dorsal subcutaneous location under isofluorane anesthesia under sterile conditions. A dose of meloxicam, 1 mg/kg subcutaneously, was given prior to anesthesia to provide post-operative analgesia; a heating pad was utilized during the operative and post-operative period to prevent hypothermia. Urine was collected at baseline, and at weeks 2 and 4 of the infusion. Serum was collected at baseline and at the time of sacrifice. At the end of the 4 week infusion period, animals were sacrificed, and heart and kidneys were harvested and weighed. Tissue samples were processed for histologic analysis. Additional tissue samples were snap frozen in liquid nitrogen for RNA isolation.
Folate nephropathy model
Three to four month old, male and female, wild-type and Trpc6 mice (n = 13–19 per group) were administered folate (20 mg/ml in 0.3 M sodium bicarbonate solution) at a dose of 250 mg/kg by intraperitoneal injection. Serum samples were collected at baseline (1 week prior to folate administration), 2 days after folate injection, and at the time of sacrifice. 21 days after folate injection, animals were sacrificed under anesthesia. Kidneys were decapsulated and processed for histology and RNA isolation.
Histology
Tissue was transversely bread loafed and immersion fixed in 4% paraformaldehyde at 4°C for 24 hours. After washing in PBS, samples were further processed for paraffin embedding, sectioning, and staining by the BIDMC Histology Core. Three-micron sections stained with H&E, PAS, and Sirius Red were analyzed using an Olympus BX60 microscope equipped with a digital DP73 camera and cellSens software.Glomeruli were scored for sclerotic lesions (present or absent) on PAS stained sections by an observer blinded to genotype and treatment. All glomeruli (>100/animal) on a single histologic section containing 2–3 transversely bread loafed portions of a kidney were scored, and the percentage of sclerosed glomeruli calculated.To calculate podocyte density, kidney sections were stained for immunofluorescence microscopy as described previously [48], using rabbit monoclonal anti-WT1 (Abcam, ab89901) and appropriate fluorophore-labeled secondary antibody (Jackson ImmunoResearch Laboratories), and counterstained with fluorescently labeled wheat germ agglutinin (Invitrogen, W7024) and Hoechst 33342. Podocyte number and glomerular cross-section were obtained for 20 glomeruli per animal. TRPC6 immunofluorescence microscopy was performed using a rabbit polyclonal antibody (Alomone, ACC-017).Renal fibrosis was quantified by imaging Sirius Red stained sections under polarized light using established methods [49]. Ten non-overlapping 20x fields of cortex were captured per animal, and analyzed using ImageJ. Perivascular areas were excluded from the analysis.
Platelet and glomerular isolation
Mouse platelets were isolated using modified standard procedures [50], as previously outlined [44]. Washed platelets were resuspended directly in NP-40 lysis buffer containing Complete protease inhibitors (Roche). Glomeruli were isolated using magnetic bead perfusion as previously described [48, 51], utilizing high iron content magnetic particles (AMS-40-10H, Spherotech). For western blot, glomeruli were resuspended in NP-40 lysis buffer with protease inhibitors. For podocyte outgrowth, glomeruli were cultured in 6 well tissue culture plates with RPMI-1640 supplemented with 10% fetal bovine serum, and 1% ampicillin, penicillin, and streptomycin [52]. After 10 days of culture, outgrown podocytes were passaged and plated onto clear bottom 96 well plates for calcium imaging experiments.
Fura-2 calcium imaging
Primary podocyte cultures were subject to Fura-2 fluorescence ratio measurement (Fura-2 QBT kit R8197, Molecular Devices) using a FlexStation III reader with automated pipetting at the Harvard ICCB-Longwood screening facility in a 96-well format essentially as previously described [30, 44]. Final concentrations of agonists were as follows: 100 μM ADP, 100 μM ATP, 50 μM GSK1702934A, 0.5 u/ml thrombin, and 1 μM thapsigargin.
RNA isolation and gene expression
RNA was isolated from snap frozen tissue using RNeasy universal kits, and reverse transcribed into cDNA with the QuantiTect Reverse transcription kit (both Qiagen). Real-time PCR reactions were run on a QuantStudio 6 Flex machine using PowerUp SYBR Green master mix (Applied Biosystems) using gene specific primer sets (Table 1). Expression levels were normalized to 18S rRNA, Hprt and Gapdh.
Table 1
Primer sequences used for qPCR gene expression analysis.
Target
Forward
Reverse
GAPDH
CGTCCCGTAGACAAAATGG
TCAATGAAGGGGTCGTTGA
HPRT
GAGGAGTCCTGTTGATGTTGCCAG
GGCTGGCCTATAGGCTCATAGTGC
αSMA
CTGACAGAGGCACCACTGAA
CATCTCCAGAGTCCAGCACA
Collagen I
GAGCGGAGAGTACTGGATCG
GTTCGGGCTGATGTACCAGT
Fn1
CGAGGTGACAGAGACCACAA
CTGGAGTCAAGCCAGACACA
TGF-β
TTGCTTCAGCTCCACAGAGA
TGGTTGTAGAGGGCAAGGAC
CTGF
CCCTAGCTGCCTACCGACTG
TTAGAACAGGCGCTCCACTC
KIM-1
TCAGCTCGGGAATGCACAA
TGGTTGCCTTCCGTGTCTCT
NGAL (Lcn2)
TGATCCCTGCCCCATCTCT
GGAACTGATCGCTCCGGAA
18S RNA
GCAATTATTCCCCATGAACG
AGGGCCTCACTAAACCATCC
Trpc6
ACTGGTGTGCTCCTTGCAG
GAGCAGCCCCAGGAAAAT
Western blotting
Lysates were mixed with 4x sample loading buffer containing β-mercaptoethanol and immediately incubated at 95°C for 5 minutes. SDS-PAGE was performed as previously described [28]. Western blotting using fluorescence detection was performed using Immobilon-FL PVDF membrane (Millipore), Chameleon Duo pre-stained protein ladder, Intercept blocking buffer, and an Odyssey CLx imaging system (all LI-COR). Primary antibodies against the following antigens were utilized: Erk1/2 (CST #9107, 1:1000), Podocalyxin (MAB1556, R&D Systems, 1:500), TRPC6 (Alomone ACC-017, 1:500). Fluorescent secondary antibodies (IRDye 690RD anti-mouse and anti-rat; IRDye 800CW anti-rabbit; all LI-COR) were used at 1:20,000 dilution.
Statistical analysis
All statistical analyses were performed using GraphPad Prism version 9. The specific statistical tests utilized for each experiment are specified within the corresponding figure legends. Symbols used for pair-wise comparison adjusted p-values are: ns, p>0.05; *, p<0.05; **, p<0.01; ***, p<0.001.
Results
Trpc6 mice were viable and fertile, and born at the expected Mendelian ratio when generated by mating heterozygous animals. Trpc6 and Trpc6 mice showed no evidence of developing albuminuria compared to their wild-type counterparts at 6 months of age (Fig 1A). Even in female animals aged 20 to 23 months, albuminuria did not differ significantly between wild-type and knock-in animals (Fig 1B). The fraction of Trpc6 mice that did develop albuminuria demonstrated mesangial expansion and mesangial hypercellularity, but no appreciable glomerular sclerosis (Fig 1C), similar to age-associated glomerular changes reported to occur in wild-type female mice in this age range [53, 54].
Fig 1
Baseline and albumin overload induced albuminuria in wild-type and Trpc6 mice.
A, urine albumin-to-creatinine ratio (ACR) measurements from six-month old, wild-type (WT), Trpc6 (Het), and Trpc6 (KI) males. Shown are individual values, geometric mean and SD; n = 4-9/group. Groups were compared by one-way ANOVA with Tukey’s multiple comparisons test; all comparisons without statistical significant differences. B, urine ACR from 20–23 month old, female WT (n = 6) and KI (n = 8) animals. Shown are geometric mean and individual values; log-transformed ACRs were compared by unpaired t-test. C, glomerular histology of 23 month old, female (i) wild-type, (ii) non-proteinuric KI, and (iii) albuminuric KI mice. Mesangial expansion (arrows) and mesangial hypercellularity (arrowheads) are apparent in the albuminuric animal. PAS stained sections; scale bar represents 20 μm. D, albuminuria in WT and KI male mice subject to albumin overload from day 1–5. Shown are geometric mean, SD and individual values; n = 11 (WT) and 15 (KI). Log-transformed ACRs were compared between genotypes by mixed-effects analysis with Sidak’s multiple comparisons test. Trpc6 had statistically significantly more albuminuria compared to wild-type only on day 9.
Baseline and albumin overload induced albuminuria in wild-type and Trpc6 mice.
A, urine albumin-to-creatinine ratio (ACR) measurements from six-month old, wild-type (WT), Trpc6 (Het), and Trpc6 (KI) males. Shown are individual values, geometric mean and SD; n = 4-9/group. Groups were compared by one-way ANOVA with Tukey’s multiple comparisons test; all comparisons without statistical significant differences. B, urine ACR from 20–23 month old, female WT (n = 6) and KI (n = 8) animals. Shown are geometric mean and individual values; log-transformed ACRs were compared by unpaired t-test. C, glomerular histology of 23 month old, female (i) wild-type, (ii) non-proteinuric KI, and (iii) albuminuric KI mice. Mesangial expansion (arrows) and mesangial hypercellularity (arrowheads) are apparent in the albuminuric animal. PAS stained sections; scale bar represents 20 μm. D, albuminuria in WT and KI male mice subject to albumin overload from day 1–5. Shown are geometric mean, SD and individual values; n = 11 (WT) and 15 (KI). Log-transformed ACRs were compared between genotypes by mixed-effects analysis with Sidak’s multiple comparisons test. Trpc6 had statistically significantly more albuminuria compared to wild-type only on day 9.
Albumin overload model
Wild-type and Trpc6 male mice were compared in their response to the transient albumin overload model (Fig 1D). A mixed-effects model suggests a statistically significant effect of genotype on albuminuria across the combined time-points (p = 0.0153). However, by multiple comparisons, the albuminuria observed in Trpc6 male mice was only statistically significantly higher than controls at day 9, 4 days after the last albumin administration. Both groups showed a similar degree of albuminuria a week after injections were discontinued, when albuminuria had returned back to near baseline. As has been reported by others [55], no histological sequelae were apparent by light microscopy after the recovery period.
Puromycin aminonucleoside nephrosis
Mice heterozygous for the Inf2 mutation [56], or a Podxl null mutation [47], show dramatic sensitivity to glomerular injury in the PAN model. We therefore examined whether the Trpc6 allele might confer a similar susceptibility. Trpc6 mice exposed to the two dose PAN regimen [47] had only a small increase in proteinuria (Fig 2A) without the development of glomerular sclerosis (Fig 2B). We also compared Trpc6 and Trpc6 animals generated through an F1 cross with Sv/129 animals, as Sv/129 animals show some susceptibility to PAN. These animals all developed low grade proteinuria (Fig 2C), but histological analysis revealed no glomerular sclerosis, and only very rare evidence of tubular protein reabsorption droplets and proteinaceous casts (Fig 2D). Furthermore, albuminuria did not differ based on Trpc6 genotype. These results suggest that the Trpc6 allele does not affect susceptibility to PAN.
Fig 2
Puromycin aminonucleoside nephrosis in Trpc6 mutant mice.
Various Trpc6 genotype male mice were subject to two intraperitoneal injections of puromycin aminonucleoside (PA; 450mg/kg) on days 0 and 7. Trpc6 mice on the FVB background developed a small (<5 fold) increase in albuminuria at day 14 compared to baseline (A). B, PAS stained histology sections of Trpc6 kidney 14 days after PAN revealed no appreciable (i) cortical, or (ii) glomerular, pathology. Scale bar represents 50 μm. C, urinary albumin-to-creatinine ratios (ACR) of Trpc6 (WT) and Trpc6 (Het) animals on an F1 FVB/NJ x Sv/129 background before and 21 days after PAN induction. D, PAS stained WT (i, ii), and Het (iii, iv) kidney sections 21 days after PA administration demonstrate largely preserved cortical, and glomerular architecture, with very rare (estimated <1% of renal cortex cross sectional area) proteinaceous casts (arrows), and tubules with protein reabsorption droplets (arrowheads). Scale bars represent 200 μm (i, iii), and 20 μm (ii, iv). ACRs (A, C) are shown as geometric mean, SD and individual values. Log-transformed ACRs were compared for statistical analyses by paired t-test or two-way ANOVA.
Puromycin aminonucleoside nephrosis in Trpc6 mutant mice.
Various Trpc6 genotype male mice were subject to two intraperitoneal injections of puromycin aminonucleoside (PA; 450mg/kg) on days 0 and 7. Trpc6 mice on the FVB background developed a small (<5 fold) increase in albuminuria at day 14 compared to baseline (A). B, PAS stained histology sections of Trpc6 kidney 14 days after PAN revealed no appreciable (i) cortical, or (ii) glomerular, pathology. Scale bar represents 50 μm. C, urinary albumin-to-creatinine ratios (ACR) of Trpc6 (WT) and Trpc6 (Het) animals on an F1 FVB/NJ x Sv/129 background before and 21 days after PAN induction. D, PAS stained WT (i, ii), and Het (iii, iv) kidney sections 21 days after PA administration demonstrate largely preserved cortical, and glomerular architecture, with very rare (estimated <1% of renal cortex cross sectional area) proteinaceous casts (arrows), and tubules with protein reabsorption droplets (arrowheads). Scale bars represent 200 μm (i, iii), and 20 μm (ii, iv). ACRs (A, C) are shown as geometric mean, SD and individual values. Log-transformed ACRs were compared for statistical analyses by paired t-test or two-way ANOVA.
Angiotensin II infusion
Multiple studies have reported a role for TRPC6 channel activation downstream of angiotensin II signaling [13, 57–61]. Trpc6 knockout mice develop less albuminuria initially, and trend toward less renal pathology, compared to wild-type animals, in response to chronic ATII infusion despite a similar response in blood pressure [39]. We therefore exposed Trpc6 and wild-type male mice to 4 weeks of ATII infusion, and compared their response. Trpc6 animals developed greater albuminuria after 2 weeks compared to wild-type animals, but this difference did not persist at the end of the infusion period (Fig 3A). Serum creatinine did not differ between genotypes either at baseline, or at the end of the experiment (Fig 3B).
Fig 3
Effect of Trpc6 genotype on glomerular response to angiotensin II infusion.
Wild-type and Trpc6 (KI) male mice were subject to ATII infusion for 4 weeks. A, urine albumin-to-creatinine ratio (ACR) measurements demonstrate development of robust albuminuria in both groups. KI mice developed slightly greater albuminuria at 2 weeks compared to wild-type, an effect that did not persist at 4 weeks. Shown are median and individual values; n = 10/group. Log-transformed ACRs were compared between genotypes by two-way ANOVA with Sidak’s multiple comparisons test. B, serum creatinine measurements at baseline and after 4 weeks of ATII infusion. Shown are mean and individual values; n = 10/group; no statistically significant differences between genotypes. C, example of renal pathology in a KI mouse after ATII infusion. Shown is a PAS stained section demonstrating a segmental glomerular lesion (arrow), tubular atrophy with cystic changes and proteinaceous casts (asterisks), and protein reabsorption droplets (arrowheads). Scale bar represents 20 μm. D, percentage of glomeruli showing evidence of segmental lesions in control wild-type males (Ctrl; n = 4), and wild-type (WT) and Trpc6 (KI) males subjected to ATII infusion (n = 10 each). Shown are median and individual values; differences between groups did not reach statistical significance by Kruskal-Wallis test with Dunn’s multiple comparisons. Glomerular podocyte density (E), glomerular area (F), and podocyte number per glomerular cross-section (G) were measured. Shown are mean and individual averages per animal in untreated control animals (Ctrl; n = 4) and ATII treated wild-type and knock-in animals (n = 5 each). 20 glomeruli were measured per animal. One-way ANOVA analysis with Tukey’s multiple comparisons test.
Effect of Trpc6 genotype on glomerular response to angiotensin II infusion.
Wild-type and Trpc6 (KI) male mice were subject to ATII infusion for 4 weeks. A, urine albumin-to-creatinine ratio (ACR) measurements demonstrate development of robust albuminuria in both groups. KI mice developed slightly greater albuminuria at 2 weeks compared to wild-type, an effect that did not persist at 4 weeks. Shown are median and individual values; n = 10/group. Log-transformed ACRs were compared between genotypes by two-way ANOVA with Sidak’s multiple comparisons test. B, serum creatinine measurements at baseline and after 4 weeks of ATII infusion. Shown are mean and individual values; n = 10/group; no statistically significant differences between genotypes. C, example of renal pathology in a KI mouse after ATII infusion. Shown is a PAS stained section demonstrating a segmental glomerular lesion (arrow), tubular atrophy with cystic changes and proteinaceous casts (asterisks), and protein reabsorption droplets (arrowheads). Scale bar represents 20 μm. D, percentage of glomeruli showing evidence of segmental lesions in control wild-type males (Ctrl; n = 4), and wild-type (WT) and Trpc6 (KI) males subjected to ATII infusion (n = 10 each). Shown are median and individual values; differences between groups did not reach statistical significance by Kruskal-Wallis test with Dunn’s multiple comparisons. Glomerular podocyte density (E), glomerular area (F), and podocyte number per glomerular cross-section (G) were measured. Shown are mean and individual averages per animal in untreated control animals (Ctrl; n = 4) and ATII treated wild-type and knock-in animals (n = 5 each). 20 glomeruli were measured per animal. One-way ANOVA analysis with Tukey’s multiple comparisons test.Histologic examination of kidney sections revealed rare glomerular lesions and isolated tubular dilations with proteinacious casts (Fig 3C). Although there was a trend toward more glomerular lesions in Trpc6 mice, this did not reach statistical significance (Fig 3D). Podocyte density was lower in angiotensin II treated animals compared to controls (Fig 3E), but Trpc6 genotype did not affect this parameter. The effect was driven by an increase in average glomerular cross-sectional area (Fig 3F), with no evidence of significant podocyte loss (Fig 3G).Angiotensin II treated animals developed significant perivascular fibrosis, especially in the heart (Fig 4A). However, interstitial fibrosis of the renal cortex, quantified by birefringence of Sirius red stained sections imaged under polarized light, showed no difference between control and ATII treated animals (Fig 4B). Kidney and heart weight, normalized to body weight, similarly were not different between groups (S1 Fig). The relative expression of Trpc6 (Fig 4C), and several fibrosis (Fig 4D and 4E) and kidney injury (Fig 4F and 4G) genes, was ascertained by RT-PCR of whole kidney RNA. The expression of Trpc6 and collagen I was higher in angiotensin II exposed kidneys compared to wild-type control samples, with Kim-1 and NGAL (Lcn2) mRNA levels trending higher. However, the expression levels of none of these genes differed significantly between angiotensin treated wild-type and Trpc6 mice.
Fig 4
Fibrotic response to angiotensin II infusion.
A, histology of control and ATII treated kidneys and heart demonstrating the development of perivascular fibrosis. Sections stained with Sirius Red; scale bar equals 20 μm. B, percentage of Sirius Red stained renal cortex demonstrating birefringence in control wild-type male animals (Ctrl), and wild-type and Trpc6 (KI) males subjected to ATII infusion. Shown are median and individual values; no significant pairwise comparisons by one-way ANOVA with Tukey’s multiple comparisons. Relative gene expression analysis demonstrated upregulation of both Trpc6 (C) and Collagen I (D) mRNA in kidneys subjected to ATII infusion. Fibronectin (E) showed no significant change, while Kim-1 (F) and NGAL/Lcn2 (G) demonstrated a trend toward increased expression upon ATII treatment. Shown are mean and individual values; Brown-Forsythe one-way ANOVA with Dunnett’s multiple comparisons. Only statistically significant pairwise comparisons are shown.
Fibrotic response to angiotensin II infusion.
A, histology of control and ATII treated kidneys and heart demonstrating the development of perivascular fibrosis. Sections stained with Sirius Red; scale bar equals 20 μm. B, percentage of Sirius Red stained renal cortex demonstrating birefringence in control wild-type male animals (Ctrl), and wild-type and Trpc6 (KI) males subjected to ATII infusion. Shown are median and individual values; no significant pairwise comparisons by one-way ANOVA with Tukey’s multiple comparisons. Relative gene expression analysis demonstrated upregulation of both Trpc6 (C) and Collagen I (D) mRNA in kidneys subjected to ATII infusion. Fibronectin (E) showed no significant change, while Kim-1 (F) and NGAL/Lcn2 (G) demonstrated a trend toward increased expression upon ATII treatment. Shown are mean and individual values; Brown-Forsythe one-way ANOVA with Dunnett’s multiple comparisons. Only statistically significant pairwise comparisons are shown.
Folate nephropathy
As TRPC6 has also been implicated in modulating fibrosis [35, 62–66], we compared Trpc6 and wild-type mice in the folate nephropathy model (Fig 5). The administration of a high dose of folic acid leads to tubular injury and AKI in mice [67-69]. Although renal excretory function largely recovers, residual interstitial fibrosis and other hallmarks of chronic injury remain. Serum creatinine in both male (Fig 5A) and female (Fig 5B) mice demonstrated a robust rise two days after folate administration, returning to baseline after 3 weeks. Serum Cr did not differ significantly between Trpc6 genotypes at any of the time points. Histologic analysis revealed foci of interstitial fibrosis and tubular atrophy (Fig 5C). The percentage of cortex demonstrating fibrosis showed significant variability within each group, and no significant difference between Trpc6 genotypes (Fig 5D). Similarly, gene expression analysis of several fibrosis and kidney injury marker genes did not reveal any significant differences between male wild-type and Trpc6 kidneys after folate treatment (Fig 5E–5H and S2 Fig). Tubular injury markers did show upregulation in the folate treated animals compared to controls (Fig 5E and 5F). The results do suggest significant inter-individual variability in the degree of renal scarring in this model.
Fig 5
Trpc6 genotype does not influence response to folate nephropathy.
Serum creatinine in WT and KI, male (A) and female (B), mice was elevated 2 days after folate administration, and recovered to baseline levels after 3 weeks. Shown are median and individual values; n = 13-19/group. There were no statistically significant differences between genotypes at any of the time-points; two-way ANOVA with Sidak’s multiple comparisons test. C, renal histology at day 21, demonstrating areas of tubular atrophy and interstitial fibrosis surrounded by relatively preserved cortical architecture. Shown are H&E stain of a male wild-type kidney section (left), and Sirius Red stain of a female KI kidney section (right); scale bar equals 100 μm. D, the percentage of Sirius Red stained renal cortex area demonstrating birefringence 21 days after folate-induced AKI was compared between wild-type (n = 12) and KI (n = 9) male mice. Shown are mean and individual values; no differences between groups by unpaired t-test. The relative mRNA expression levels of renal injury related genes, Kim-1 (E) and Ngal/Lcn2 (F), and fibrosis genes, collagen I (G) and fibronectin (H), were compared between male control (Ctrl), and WT and KI folate-nephropathy kidney samples (n = 4-6/group). Shown are mean and individual values; Brown-Forsythe one-way ANOVA with Dunnett’s multiple comparisons. Only statistically significant pairwise comparisons are shown.
Trpc6 genotype does not influence response to folate nephropathy.
Serum creatinine in WT and KI, male (A) and female (B), mice was elevated 2 days after folate administration, and recovered to baseline levels after 3 weeks. Shown are median and individual values; n = 13-19/group. There were no statistically significant differences between genotypes at any of the time-points; two-way ANOVA with Sidak’s multiple comparisons test. C, renal histology at day 21, demonstrating areas of tubular atrophy and interstitial fibrosis surrounded by relatively preserved cortical architecture. Shown are H&E stain of a male wild-type kidney section (left), and Sirius Red stain of a female KI kidney section (right); scale bar equals 100 μm. D, the percentage of Sirius Red stained renal cortex area demonstrating birefringence 21 days after folate-induced AKI was compared between wild-type (n = 12) and KI (n = 9) male mice. Shown are mean and individual values; no differences between groups by unpaired t-test. The relative mRNA expression levels of renal injury related genes, Kim-1 (E) and Ngal/Lcn2 (F), and fibrosis genes, collagen I (G) and fibronectin (H), were compared between male control (Ctrl), and WT and KI folate-nephropathy kidney samples (n = 4-6/group). Shown are mean and individual values; Brown-Forsythe one-way ANOVA with Dunnett’s multiple comparisons. Only statistically significant pairwise comparisons are shown.
Glomeruluar TRPC6 expression and function
Although early reports localized human TRPC6 to the glomerular podocyte [12, 13], in situ hybridization [33, 35], and single cell RNAseq [70], have not detected substantial Trpc6 mRNA in murine podocytes. We probed murine glomerular lysates for TRPC6 protein by western blot (Fig 6A), utilizing Trpc6 mouse samples as negative controls. Although TRPC6 is readily detectable in murine platelets, glomerular extracts show no specific signal. Immunofluorescence microscopy attempts also failed to demonstrate a specific TRPC6 signal in wild-type kidney compared to Trpc6 tissue (S3 Fig). To ascertain if TRPC6-dependent calcium influxes might be detectable despite the lack of TRPC6 signal by western blot, we performed Fura-2 fluorimetry on primary podocytes isolated from Trpc6 glomeruli (Fig 6B–6D). We utilized GSK1702934A (GSK), a TRPC3/6 agonist [71, 72], as it induces calcium influx in mouse platelets in a TRPC6-dependent manner, with Trpc6 platelets demonstrating a significantly larger response compared to wild-type platelets [44]. GSK failed to induce any significant change in Fura-2 fluorescence compared to vehicle control. ADP, ATP, and thrombin, utilized as positive controls, all induced Fura-2 responses in these cells, consistent with prior reports [73-77]. In sum, we have been unable to demonstrate the presence of TRPC6 protein, by western blot, immunofluorescence microscopy, or GSK-induced calcium influx in murine glomeruli. We cannot exclude the possibility of low levels of TRPC6 channel, which are not responsive to GSK, being present.
Fig 6
Characterization of TRPC6 expression and GSK1702934A response in murine podocytes.
A, platelet and glomerular lysates from wild-type (WT) and Trpc6 (KO) female animals were analyzed by SDS-PAGE and Western blot. Anti-TRPC6 antibodies (top) detected a major band around 105 kD in WT, but not KO, platelets. No corresponding specific band is seen in glomerular lysates. A faint band of a size similar to TRPC6 is seen in both WT and KO glomerular samples, suggesting a non-specific signal. Podocalyxin (Podxl, middle) and Erk1/2 (bottom) blots are shown as loading controls. B, time-course of Fura-2 fluorescence ratio (340/380) in primary podocytes cultured from Trpc6 (KI) glomeruli. After 30 seconds (dashed vertical line), cells were stimulated with vehicle (Veh), GSK1702934A (GSK; 50 μM), ADP (100 μM), ATP (100 μM), thrombin (Thr; 0.5 u/ml), or thapsigargin (Thap; 1 μM). Shown are mean ± SD; n = 4 using podocytes from 2 different animals. Post-stimulation (C) peak Fura-2 fluorescence ratio, and (D) area under the curve (AUC, arbitrary units) were calculated. Shown are the mean and values from individual experiments. RM one-way ANOVA with Dunnett’s multiple comparisons test to vehicle control.
Characterization of TRPC6 expression and GSK1702934A response in murine podocytes.
A, platelet and glomerular lysates from wild-type (WT) and Trpc6 (KO) female animals were analyzed by SDS-PAGE and Western blot. Anti-TRPC6 antibodies (top) detected a major band around 105 kD in WT, but not KO, platelets. No corresponding specific band is seen in glomerular lysates. A faint band of a size similar to TRPC6 is seen in both WT and KO glomerular samples, suggesting a non-specific signal. Podocalyxin (Podxl, middle) and Erk1/2 (bottom) blots are shown as loading controls. B, time-course of Fura-2 fluorescence ratio (340/380) in primary podocytes cultured from Trpc6 (KI) glomeruli. After 30 seconds (dashed vertical line), cells were stimulated with vehicle (Veh), GSK1702934A (GSK; 50 μM), ADP (100 μM), ATP (100 μM), thrombin (Thr; 0.5 u/ml), or thapsigargin (Thap; 1 μM). Shown are mean ± SD; n = 4 using podocytes from 2 different animals. Post-stimulation (C) peak Fura-2 fluorescence ratio, and (D) area under the curve (AUC, arbitrary units) were calculated. Shown are the mean and values from individual experiments. RM one-way ANOVA with Dunnett’s multiple comparisons test to vehicle control.
Discussion
TRPC6 mutations are a cause of autosomal dominant FSGS in humans [12, 13]. The plurality of these mutations lead to a gain-of-function phenotype at the level of the channel [12–17, 22]. In the current study, we report on the renal phenotype of mice carrying a mutation encoding for a gain-of-function alteration in the TRPC6 protein. Even in the homozygous state and at advanced age, these animals show minimal renal pathology relative to their wild-type counterparts, and no segmental glomerular sclerosis. Furthermore, compared to wild-type animals, they display only mild or no significant differences in their response to several renal stress models. Specifically, they demonstrate slightly delayed resolution of albuminuria in the albumin overload model, only transiently higher albuminuria and a trend toward more glomerular lesions in response to angiotensin II infusion, no enhanced susceptibility to PAN, and no significantly different response to folate-induced AKI and subsequent fibrosis. In sum, these findings suggest that the Trpc6 mutant mouse does not readily phenocopy the renal pathology associated with gain-of-function TRPC6 mutations in humans.Angiotensin II signaling through AT1 receptor is thought to be a central driver in the development of proteinuria and renal injury [78]. In vitro, TRPC6 has been shown to be activated downstream of Gαq-coupled receptors [20], and AT1 receptor in particular [13, 57–61]. In a prior study, Trpc6 mice demonstrate slightly lower albuminuria compared to wild-type animals after 2 weeks of ATII infusion, a difference that is no longer significant after 4 weeks; and a non-statistically significant trend toward less glomerular injury [39]. The results presented here, comparing wild-type and Trpc6 murine responses to ATII infusion, neatly complement these previous results in Trpc6 knockout animals. Trpc6 mice show an increase in proteinuria compared to wild-type animals 2 weeks, but not 4 weeks, after the initiation of ATII treatment. Furthermore, there was a trend toward more glomerular lesions in the mutant mice, though the difference did not meet statistical significance. We did not perform blood pressure studies, and so are unable to address whether, as the earlier study [39] did, there was no effect of Trpc6 genotype on the development of hypertension. Taken together, these results suggest that TRPC6 channel activity contributes, at least transiently, to the development of proteinuria and glomerular lesions in response to high levels of angiotensin II.TRPC6 has been implicated in the development of fibrosis in several organs [35, 62–66, 79]. In the kidney, both genetic [35, 64], and pharmacologic [63], inhibition of TRPC6 is reported to dampen the fibrotic response in the unilateral ureteral obstruction model. We were therefore somewhat surprised that the Trpc6 mice do not show an increased fibrotic reaction after folate-induced AKI. It is possible that mechanistically, the effects of the gain-of-function Trpc6 mutation on kidney function are not simply the opposite of deleting Trpc6. This has been our experience in platelets [44]. Alternatively, TRPC6-dependent fibrosis pathways may be activated specifically downstream of ureteral obstruction, and not involved in the models tested here. Consistent with this possibility, Trpc6 knockout in rats does not alter the age-related development of tubulointerstitial fibrosis [80]. Future studies in other fibrosis models will be needed to address these questions.Genetically recapitulating autosomal dominant forms of FSGS in mice has frequently failed to induce glomerular pathology. In addition to the Trpc6 mutation described here, neither the Actn4 [81, 82], nor the Inf2 [52], mutations induce a renal phenotype when present in heterozygous form in mice. Homozygous Actn4 animals, though, do develop severe glomerular pathology [81]. And both heterozygous and homozygous Inf2 mutant mice show enhanced sensitivity to injury in several injury models [52, 56]. In the case of Trpc6, the homozygous knock-in animals show only a transient, and slightly, higher degree of albuminuria in the albumin overload and angiotensin II infusion models. The Trpc6 mutation, unlike the Inf2 mutation [56], does not induce susceptibility to PAN. Of note, transgenic overexpression of Trpc6 mutants, including E896K, in podocytes induces only minimal albuminuria in mice, which is not significantly different from that seen upon overexpression of wild-type Trpc6 [32]. The reason for the relative lack of a renal phenotype in the Trpc6 animals remains unclear. The E896K mutation is a gain-of-function mutant, as we have separately demonstrated in platelets [44]. There is a report of differences in Trpc6 mRNA expression between mouse strains [33], and strain-specific susceptibility to kidney, and glomerular, injury are well known [55, 83–85]. It is certainly plausible that a different genetic background, or environmental insult, is necessary to elicit the pathologic effects of Trpc6 mutations. Alternatively, it is possible that glomerular or renal TRPC6 expression differs between humans and mice, and accounts for our findings. Review of single cell RNA expression data speaks to this possibility [70, 86, 87]. And although we did not examine TRPC6 expression in human samples, we were unable to detect the protein in murine glomeruli, or detect a GSK-inducible, Fura-2 measurable, calcium influx in murine glomerular outgrowths. Future studies comparing glomerular TRPC6 expression in different mammalian species could prove informative.In summary, introducing a gain-of-function mutation, corresponding to a human FSGS disease mutation, into murine Trpc6 fails to recapitulate the human glomerular disease pathology. Homozygous Trpc6 mice do demonstrate transiently, and mildly, higher albuminuria in the albumin overload and angiotensin II infusion models, but do not display a predilection for PAN, or increased interstitial fibrosis after recovery from folate-induced AKI. It remains unclear if Trpc6 mutations require an as yet unidentified environmental or genetic hit to induce glomerular disease in mice, or if mice are intrinsically not suitable to model TRPC6-mediated human FSGS.
Trpc6 genotype does not influence kidney and heart weight after angiotensin II treatment.
Kidney (A) and heart (B) weights, normalized to total body weight, did not differ between control wild-type male animals (Ctrl), and wild-type and Trpc6 (KI) males subjected to ATII infusion for 4 weeks. Shown are median and individual values (n = 4-10/group); no pairwise comparison showed a statistically significant difference by one-way ANOVA with Tukey’s multiple comparisons test.(TIF)Click here for additional data file.
Gene expression in folate-nephropathy kidneys.
The relative mRNA expression levels of several fibrosis and renal injury related genes, and Trpc6, was compared in WT and KI male folate-nephropathy kidney samples (n = 6/group). There were no statistically significant differences between genotypes for any of the genes; multiple unpaired t-tests.(TIF)Click here for additional data file.
Immunofluorescence microscopy of wild-type and Trpc6 kidneys.
A, kidney sections from wild-type (i, iii), and Trpc6 (ii, iv) mice stained with rabbit anti-TRPC6 antibody (ACC-017, Alomone). Wheat germ agglutinin (WGA), and Hoechst were used as counterstains. TRPC6 staining specific to the wild-type kidney could not be identified. B, wild-type kidney sections were stained with TRPC6 antibody (i, iii) or with anti-rabbit secondary antibody only (ii, iv). Green channel signal was not due to non-specific secondary antibody staining or tissue auto-fluorescence.(TIF)Click here for additional data file.(PDF)Click here for additional data file.
Authors: David A Ishola; Dionne M van der Giezen; Brunhilde Hahnel; Roel Goldschmeding; Wilhelm Kriz; Hein A Koomans; Jaap A Joles Journal: Nephrol Dial Transplant Date: 2005-12-02 Impact factor: 5.992
Authors: Katharina Hofmann; Susanne Fiedler; Sarah Vierkotten; Jonas Weber; Stephan Klee; Jie Jia; Wolfgang Zwickenpflug; Veit Flockerzi; Ursula Storch; Ali Önder Yildirim; Thomas Gudermann; Melanie Königshoff; Alexander Dietrich Journal: Biochim Biophys Acta Mol Basis Dis Date: 2016-12-06 Impact factor: 5.187
Authors: Hua Sun; Chandra Perez-Gill; Johannes S Schlöndorff; Balajikarthick Subramanian; Martin R Pollak Journal: J Am Soc Nephrol Date: 2020-12-22 Impact factor: 10.121
Authors: Yuhei Kirita; Haojia Wu; Kohei Uchimura; Parker C Wilson; Benjamin D Humphreys Journal: Proc Natl Acad Sci U S A Date: 2020-06-22 Impact factor: 11.205
Authors: Jonathan M Street; Ana Carolina P Souza; Alejandro Alvarez-Prats; Taro Horino; Xuzhen Hu; Peter S T Yuen; Robert A Star Journal: Physiol Rep Date: 2014-07-22