Literature DB >> 35887267

Glycine Nano-Selenium Enhances Immunoglobulin and Cytokine Production in Mice Immunized with H9N2 Avian Influenza Virus Vaccine.

Zhihua Ren1, Samuel Kumi Okyere1, Ming Zhang1, Xin Zhang1, Hongxuan He2, Yanchun Hu1.   

Abstract

This study was performed to investigate the immune enhancement effect of glycine nano-selenium, a microelement on H9N2 avian influenza virus vaccine (H9N2 AIV vaccine) in mice. Fifty (50) Specific Pathogen Free Kunming mice aged 4-6 weeks (18-20 g Body weight) were randomly divided into five groups: control normal group, which received no immunization + 0.5 mL 0.9% normal saline, positive control group, which received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline, 0.25 mg/kg selenium group, which received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution, 0.5 mg/kg selenium group, which received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution, and 1 mg/kg selenium group, which received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution. Hematoxylin and eosin staining, enzyme linked immunosorbent assay (ELISA), and quantitative real time polymerase chain reaction (qRT-PCR) methods were used to investigate the pathological changes, immunoglobulin levels, and cytokine gene expressions in this study. The results showed that all tested doses (0.25 mg/kg, 0.5 mg/kg and 1.00 mg/kg) of glycine nano-selenium did not lead to poisoning in mice. In addition, when compared to the positive control group, glycine nano-selenium increased the immunoglobin indexes (IgA, IgG, IgM and AIV-H9 IgG in serum) as well as the mRNA levels of IL-1β, IL-6 and INF-γ in the liver, lungs, and spleen (p < 0.05). In summary, glycine nano-selenium could enhance the efficacy of avian influenza vaccine.

Entities:  

Keywords:  Antivirus; immunity; immunization; nano-selenium; trace element

Mesh:

Substances:

Year:  2022        PMID: 35887267      PMCID: PMC9317336          DOI: 10.3390/ijms23147914

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   6.208


1. Introduction

Some avian influenza subtypes cause acute infectious disease which results in huge economic losses to the poultry industry [1,2]. In recent years, the number of cases of avian influenza virus in China has gradually increased [3,4,5,6]. The H9N2 subtype avian influenza virus is a low pathogenic avian influenza virus [7]. After infection, it generally does not cause disease or death of poultry, but can reduce the production performance of sick poultry [8]. The first H9N2 influenza virus was isolated from turkeys in Wisconsin in 1996 [9]. Since then, the H9N2 subtype virus has been isolated from a variety of poultry species [10,11,12,13,14]. In addition, the H9N2 virus has also been found in mammalian pigs [15,16], which was genetically recombined with other subtypes of avian influenza viruses such as H5 and H7 to provide genes for new influenza viruses [17,18]. In addition, a mice model has been used by numerous studies to investigate the pathogenicity and vaccine efficacy of H9N2 virus and vaccines [19,20,21,22,23]. More importantly, some H9N2 viruses have obtained typical specific receptors of human influenza viruses and can directly cause mild respiratory diseases and pose a great threat to human health [24]. In recent years, gene recombination and the antigen drift of the H9N2 subtype avian influenza virus have been reported. The hemagglutinin (HA) gene can form genetic branches which enhances its pathogenicity [25]. Moreover, the H9N2 influenza virus co-infection with other infectious viral, bacterial, and immunosuppressive agents also causes variable mortality rates in poultry [26,27]. Therefore, the transfer of H9N2 influenza virus between different organisms may cause a pandemic of avian influenza and a human epidemic [28,29]. The H9N2 subtype of influenza can constantly occur from mutation and gene recombination in the host posing a big threat to the poultry industry in the 21st century [30]. Currently, the common vaccine and vaccine adjuvants of avian influenza on the human and animal markets cannot fully achieve the desired immune effects due to the genetic drift of the HA gene [31,32]; therefore, there is the need for a rapid identification of novel strategies such as development of novel vaccines or adjuvants to enhance the efficacy of already developed vaccines. Glycine nano-selenium is one of the safest organic selenium reported at present [33]. Numerous studies have showed the immune enhancement properties of selenium. For example, a study by Wei et al. [34] found that the Newcastle disease vaccine containing selenium oil adjuvant significantly improved the level of HI antibody. Another study also showed that selenium carrageenan as an adjuvant can also enhance the humoral immune response of mice induced by a live attenuated hepatitis A vaccine [35]. Hence, we speculated that selenium might have great potential in enhancing the efficacy of vaccines; therefore, in this study, we investigated the effects of glycine nano-selenium on the efficacy of H9N2 AIV vaccine in mice.

2. Results

2.1. Effect of Glycine Nano-Selenium on Weight Gain and Organ Indices of Liver, Spleen, and Lungs of Mice Immunized with H9N2 Avian Influenza Virus Vaccine

Based on our observations, all the treatment groups appeared healthy and active. No deaths or signs of gastrointestinal upset such as diarrhea occurred in the treatment groups (data not shown). The results showed that there was no significant difference in body weight and organ indices among all treatment groups (Table 1, p > 0.05).
Table 1

The effect of Glycine nano-selenium on weight gain and organ index.

Organ IndexControlPositive(Dose of Se (mg/kg))
0.250.501.00
BW33.42 ± 2.4232.56 ± 0.5534.90 ± 2.1533.00 ± 1.8734.80 ± 2.36
HI5.89 ± 0.276.25 ± 0.145.90 ± 0.426.24 ± 0.186.21 ± 0.47
SI0.58 ± 0.020.58 ± 0.040.58 ± 0.060.60 ± 0.080.62 ± 0.03
LI0.62 ± 0.050.64 ± 0.010.62 ± 0.060.58 ± 0.040.60 ± 0.04

The table is represented as means value ± standard deviation (SD). Values in the same row with different superscripts a-d are statistically different (n = 5, p < 0.05 or p < 0.01). BW-Body weight, HI-Hepatic index, SI-spleen index, LI-Lung index.

2.2. Effect of Glycine Nano-Selenium on Pathological Changes of Liver and Lung Tissues of Mice Immunized with H9N2 Avian Influenza Virus Vaccine

The histopathological results were shown in Figure 1 and Figure 2. For the lungs, we observed that the lung texture of mice in each group was clear, the alveolar structure was complete, and there was no obvious pathological change. Similarly, we observed that the liver tissue structure of mice in each group was complete, the hepatic cord was in a cord shape, the outline of hepatocytes was clear, and no obvious pathological changes were found. The above results indicated that the immunization of mice with avian influenza vaccine and the gavage of high (1.00 mg/kg), medium (0.50 mg/kg), and low (0.25 mg/kg) doses of glycine nano-selenium did not lead to the damage of liver and lung in mice.
Figure 1

Effect of Glycine nano-selenium on pathological changes of lung tissue (A–E, 200×). The lung texture of mice in each group was clear, the alveolar structure was complete, and there were no obvious pathological changes (n = 5). Control, received no immunization + 0.5 mL normal saline; positive received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

Figure 2

Effect of Glycine nano-selenium on pathological changes of liver tissue(A–E, 400×). We observed that the liver tissue structure of mice in each group was complete, the hepatic cord was in a cord shape, the outline of hepatocytes was clear, and there were no obvious pathological changes (n = 5). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

2.3. Effect of Glycine Nano-Selenium on IgG, IgM, IgA, and Specific IgG Immunoglobulin Concentrations in the Serum of Mice Immunized with H9N2 Avian Influenza Virus Vaccine

In order to verify whether glycine nano-selenium can improve the immune effect of H9 subtype avian influenza vaccine, the serum of mice in each group was collected at random at the end of the experiment, and the serum immunoglobulin IgG, IgM, IgA, and specific immunoglobulin aiv-h9 IgG were measured. The results revealed that after gavage of glycine nano-selenium, the serum levels of IgG, IgM, IgA, and aiv-h9 IgG increased compared with the control blank group (Table 2, p < 0.05). However, compared to the positive control group, the 0.5 and 1 mg/kg selenium groups showed a significantly higher levels of IgG, IgM, IgA, and AIV-H9 IgG (p < 0.05). There was no difference between the positive control group and the 0.25 mg/kg selenium group for all the serum immunoglobulins (except for IgM) (p > 0.05). Therefore, we stipulated that all immunized mice produced antibodies during the test, and gavage of glycine nano selenium improved the immune effect.
Table 2

The effect of Glycine nano-selenium on immunoglobulin content.

ImmunoglobulinControlPositive(Dose of Se (mg/kg))
0.250.501.00
IgG (mg/mL)15.45 ± 1.28 c23.02 ± 2.84 b24.68 ± 2.33 ab27.22 ± 1.62 a26.25 ± 1.29 a
IgM (µg/mL)1945.79 ± 55.91 e2073.18 ± 12.01 d2124.67 ± 12.67 c2386.21 ± 46.96 a2213.32 ± 10.28 b
IgA (µg/mL)153.89 ± 8.79 d174.86 ± 2.55 c179.04 ± 3.40 c212.84 ± 2.96 a192.52 ± 3.66 b
AIV-H9 IgG (ng/mL)21.74 ± 2.58 c22.76 ± 2.21 bc27.67 ± 0.94 a24.64 ± 2.03 b

The table is represented as means value ± standard deviation (SD). Values in the same row with different superscripts a–d are statistically different (n = 5, p < 0.05 or p < 0.01).

2.4. Effect of Glycine Nano-Selenium on mRNA Expressions of Inflammatory Cytokines in Liver, Lungs, and Spleen of Mice Immunized with H9N2 Avian Influenza Virus Vaccine

As represented in Figure 3, Figure 4 and Figure 5, the results showed that there was no significant difference in IL-4 and IL-10 among the treatments for all the tissues (liver, spleen, and lung) (p > 0.05). In addition, the levels of IL-1β, IL-6 and INF-γ in the selenium treatments groups for all the tissues (liver, spleen, and lung) were higher compared to the positive control group (p < 0.05).
Figure 3

Expression of (A) IL-1β; (B) IL-4; (C) IL-6; (D) IL-10; and (E) INF-γ in the liver of mice administered with avian influenza virus H9N2 vaccine and glycine nano-selenium. Bars are represented as mean ± SD. Bars with same && or & are statistically the same (n = 5, p < 0.05 or p < 0.01). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

Figure 4

Expression of (A) IL-1β; (B) IL-4; (C) IL-6; (D) IL-10 and (E) INF-γ in the spleen of mice administered with avian influenza virus H9N2 vaccine and glycine nano-selenium. Bars are represented as mean ± SD. Bars with same && or & are statistically the same (n = 5, p < 0.05 or p < 0.01). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

Figure 5

Expression of (A) IL-1β; (B) IL-4; (C) IL-6; (D) IL-10; and (E) INF-γ in the lungs of mice administered with avian influenza virus H9N2 vaccine and glycine nano-selenium. Bars are represented as mean ± SD. Bars with same && or & are statistically the same (n = 5, p < 0.05 or p < 0.01). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

These experimental data show that the exogenous supplement of glycine nano-selenium did not only affect the secretion of immunoglobulin, but also affected the expression of cytokines, hence, enhancing the immune effects of the vaccine.

2.5. Effect of Glycine Nano-Selenium on Weight Gain and Organ Indices of Liver, Spleen, and Lungs of Mice Immunized with H9N2 Avian Influenza Virus Vaccine and Challenged with H9N2 Avian Influenza Virus

As represented in Table 3, the results showed that compared with the control group, the positive control, low dose (0.25 mg/kg), medium dose (0.5 mg/kg), and high dose (1 mg/kg) groups showed a significant or extremely significant difference in organ indices (p < 0.05). There was no significant difference between the middle dose group, the low dose group, and the high dose group (p > 0.05). It is preliminarily determined that the immunity produced by the positive control, the low, medium, and high dose groups can resist the invasion of this subtype of avian influenza virus.
Table 3

The effect of Glycine nano-selenium on organ index after challenge experiment.

Organ IndexControlPositive(Dose of Se (mg/kg))
0.250.501.00
BW35.58 ± 1.9137.34 ± 2.1638.20 ± 2.4038.12 ± 1.9637.06 ± 1.80
HI4.62 ± 0.59 a3.98 ± 0.20 b3.97 ± 0.38 b3.94 ± 0.12 b4.07 ± 0.24 b
SI0.56 ± 0.14 a0.36 ± 0.06 b0.39 ± 0.06 b0.33 ± 0.08 b0.37 ± 0.13 b
LI0.65 ± 0.06 a0.48 ± 0.05 c0.49 ± 0.07 bc0.55 ± 0.02 bc0.55 ± 0.01 b

The table is represented as means value ± standard deviation (SD). Values in the same row with different superscripts a-d are statistically different (n = 5, p < 0.05 or p < 0.01). BW-Body weight, HI-Hepatic index, SI-spleen index, LI-Lung index.

2.6. Effect of Glycine Nano-Selenium on Pathological Changes of Liver and Lung Tissues of Mice Immunized with H9N2 Avian Influenza Virus Vaccine and Challenged with H9N2 Avian Influenza Virus

In order to further confirm whether non-immunized mice are infected by avian influenza virus, we collected the lungs and livers 14 days after the challenge with avian influenza virus to make pathological sections and observe the results. In the lungs, the pathological sections of the control group showed obvious symptoms of virus infection, thickening of lung texture, thickening of lung septum, alveolar atrophy, proliferation of connective tissue, and increase of inflammatory cells (the lesion site was marked by yellow arrow) (Figure 6A), whereas the positive control, low, medium, and high dose groups showed clear lung texture, complete alveolar structure, and no obvious pathological change (Figure 6B–E).
Figure 6

Effect of Glycine nano-selenium on pathological changes of lung tissue in mice immunized with H9N2 avian influenza virus vaccine and challenged with H9N2 avian influenza virus (A–E, 200×); (A) Control challenged group showed obvious symptoms of virus infection, thickening of lung texture, thickening of lung septum, alveolar atrophy, proliferation of connective tissue, and increase of inflammatory cells (the lesion site was marked by yellow arrow); (B–E) The lung texture of mice in the positive, low, medium, and high dose challenged groups was clear, the alveolar structure was complete, and there were no obvious pathological changes (n = 5).

However, the pathological sections of the liver were similar to those of the lung. In the control challenged group, we observed amyloidosis in some hepatocytes, swelling of hepatocytes, disappearance of hepatic cord, and inflammatory cell infiltration (the lesion site is marked by yellow arrow) (Figure 7A). Moreover, in the positive control, low, medium, and high dose groups, the hepatic cords were arranged neatly, and the outline of hepatocytes was clear. No obvious pathological changes were found (Figure 7B–E). The above pathological studies showed that the immune protection of mice immunized with the vaccine could effectively resist the invasion of the subtype of avian influenza virus.
Figure 7

Effect of Glycine nano-selenium on pathological changes of liver tissue in mice immunized with H9N2 avian influenza virus vaccine and challenged with H9N2 avian influenza virus (A–E, 200×); (A) Control challenged group showed amyloidosis in some hepatocytes, swelling of hepatocytes, disappearance of hepatic cord, and inflammatory cell infiltration (the lesion site is marked by yellow arrow) (Figure 7A); (B–E) The liver of mice in the positive, low, medium, and high dose challenged groups showed arranged neatly hepatic cords, and clear outline of hepatocytes. No obvious pathological changes were found (n = 5).

2.7. Effect of Glycine Nano-Selenium on IgG, IgM, IgA, and Specific IgG Immunoglobulin Concentrations in the Serum of Mice Immunized with H9N2 Avian Influenza Virus Vaccine and Challenged with H9N2 Avian Influenza Virus

In order to confirm whether the immunity formed in the positive control, high, middle, and low experimental groups can provide effective protection, the serum of mice after the challenge was collected to determine the content of immunoglobulin. The results showed that there were significant differences in all the tested immunoglobulin between the positive control, the low, middle, and high dose groups compared to the control group (Table 4, p < 0.05, p < 0.01). The IgG, IgM, and AIV-H9 IgG in the medium dose (0.5 mg/kg) group were significantly higher than those in the positive control group (p < 0.01), and the IgA level was significantly higher than that in the positive control group (p < 0.05). There were significant or extremely significant differences in the four indicators between the middle dose group and the low dose group Table 4, (p < 0.05, p < 0.01); however, compared to the high dose, the medium doses showed significant difference in the levels of IgM and AIV-H9 IgG (Table 4, p < 0.05).
Table 4

The effect of Glycine nano-selenium on immunoglobulin after challenge experiment.

ImmunoglobulinControlPositive(Dose of Se (mg/kg))
0.250.501.00
IgG (mg/mL)20.37 ± 1.30 d24.29 ± 0.76 c26.21 ± 1.18 b29.08 ± 1.49 a27.82 ± 0.45 a
IgM (µg/mL)1956.46 ± 27.15 d2140.59 ± 50.01 c2190.64 ± 17.22 c2441.41 ± 129.69 a2313.64 ± 112.67 b
IgA (µg/mL)165.60 ± 7.64 c187.13 ± 8.00 b189.27 ± 4.22 b225.75 ± 17.18 a193.26 ± 4.37 ab
AIV-H9 IgG (ng/mL)19.49 ± 1.32 e23.34 ± 0.24 d24.97 ± 0.41 c30.36 ± 1.47 a26.27 ± 0.23 b

The table is represented as means value ± standard deviation (SD). Values in the same row with different superscripts a–d are statistically different (n = 5, p < 0.05 or p < 0.01).

2.8. Effect of Glycine Nano-Selenium on mRNA Expressions of Inflammatory Cytokines in Liver, Lungs, and Spleen of Mice Immunized with H9N2 Avian Influenza Virus Vaccine and Challenged with H9N2 Avian Influenza Virus

As shown in Figure 8, Figure 9 and Figure 10, we observed no significant difference for IL-1β in the liver and spleen of all the treatment groups (Figure 8A, Figure 9A and Figure 10A, p > 0.05). However, in the lungs, compared with the other groups, the middle dose group showed a significant reduced level of IL-1β (Figure 11A, p < 0.01). IL-6 in all the tissues of the middle dose group was significantly lower than that of control, positive control, and low dose groups (Figure 9, Figure 10 and Figure 11C, p < 0.01). IL-4, IL-10, and INF-γ in the middle dose group of three organs were significantly or extremely significantly higher than those in the control group (Figure 8B, Figure 9B and Figure 10B,D,E, p < 0.05, p < 0.01). It can be seen that the expression of cytokines in the control group is closely related to tissue damage.
Figure 8

Expression of (A) IL-1β; (B) IL-4; (C) IL-6; (D) IL-10; and (E) INF-γ in the liver of immunized mice administered with glycine nano-selenium and challenged with H9N2 avian influenza virus. Bars are represented as mean ± SD. Bars with same && or & are statistically the same (n = 5, p < 0.05 or p < 0.01). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

Figure 9

Expression of (A) IL-1β; (B) IL-4; (C) IL-6; (D) IL-10; and (E) INF-γ in the spleen of immunized mice administered with glycine nano-selenium and challenged with H9N2 avian influenza virus. Bars are represented as mean ± SD. Bars with same && or & are statistically the same (n = 5, p < 0.05 or p < 0.01). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

Figure 10

Expression of (A) IL-1β; (B) IL-4; (C) IL-6; (D) IL-10; and (E) INF-γ in the lungs of immunized mice administered with glycine nano-selenium and challenged with H9N2 avian influenza virus. Bars are represented as mean ± SD. Bars with same && or & are statistically the same (n = 5, p < 0.05 or p < 0.01). Control, received no immunization + 0.5 mL normal saline; positive, received H9N2 AIV vaccine + 0.5 mL 0.9% normal saline; 0.25 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.25 mg/kg selenium solution; 0.5 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 0.5 mg/kg selenium solution; 1 mg/kg group, received H9N2 AIV vaccine + 0.5 mL 1 mg/kg selenium solution.

3. Discussion

Viral diseases cause severe damage to the health of animals, resulting in high mortality and economic losses in animal producers and breeders [36]. Avian influenza is a zoonotic epidemic disease, which brings disastrous losses to a country [37]. The World Health Organization (OIE) lists avian influenza as a major threat to human and animal health. At present, vaccines are the most adopted strategies used by most countries to prevent and control avian influenza; however, both the traditional and commercial vaccines have not been effective due to the genetic drift associated with the HA gene in the body. Therefore, the development of a cheap, safe, and efficient immune adjuvant has great application prospects. The glycine nano-selenium studied in this experiment is an organic selenium with the lowest acute toxicity, and many physiological functions, such as anti-aging, anti-cancer, and immune enhancement [38]. From the experiment, we observed no abnormal behavior such as loss of appetite and drinking desire, there was no changes in weight and the organ index (liver, spleen, and lung), as well as no pathological changes in various tissues after immunization and gavage with glycine nano-selenium, indicating that there was no poisoning in mice. This is similar to the study by Cheng et al. [39]. However, after the challenge with the H9N2 avian influenza virus, the control group showed elevated immune indices as well as showed signs of injury or infection in tissues compared to the other groups. The results also showed that both the glycine nano-selenium and positive control group formed effective protection against virus invasion. This result was similar to the study by Raahati et al. [40] who reported that selenium nanoparticles could induce potent protective immune responses against Vibrio cholerae WC vaccine and protected against the bacteria invasion in mice. Immunoglobulin is secreted by plasma cells and can bind to specific antigens to provide immune protection to the body [41]. Selenium administration boosts both cellular and humeral immune response [42,43]. For example, nano-selenium was reported to be able to enhance both cellular and antibody-mediated immune response by increasing T lymphocytes and immunoglobulin G (IgG) and immunoglobulin M (IgM) antibodies [44,45,46]. The serum IgG, IgM, and IgA in the positive control group were significantly higher than those in the control group, indicating that the experimental mice were successfully immunized and produced specific antibodies. Moreover, we also observed that the administration of glycine nano-selenium solution of 0.50–1 mg/kg body weight on the basis of vaccine injection significantly improve IgG, IgM, and IgA compared to the positive control group, which is consistent with previous study [47]. The content of serum AIV-H9 IgG in the medium and high dose (0.50 mg/kg) groups were also significantly higher than that in the control groups, indicating that a specific dose of glycine nano-selenium could indeed improve both specific and non-specific immunity of the body. In addition, we observed no statistical difference in IgG among all the immunized groups and this may be because the IgG kit used in this study contained AIV-H9 IgG. However, 7 days after challenge with H9N2 avian influenza virus, we observed the levels immunoglobulin in the control challenged group were lower as compared to the positive control and selenium groups. In addition, the immunoglobulin level of the medium group (0.5 mg/kg) was higher than that of the positive group, indicating that the administration of nano-selenium enhanced the immune effect. A similar result was obtained in the study by Shojadoost et al. [48] that found dietary selenium supplementation could enhance antiviral immunity in chickens challenged with the low pathogenic avian influenza virus subtype H9N2. It has been reported that Se supplementation maintains immunity by decreasing inflammation [49]. Inflammatory response is a vital mechanism of H9N2 AIV pathogenicity [50]. Previous studies have found that selenium does not only affect the secretion of specific cytokines by phagocytes [51], but also directly acts on lymphocytes to enhance their function [52,53]. IL-1β and IFN-γ are linked with the initiation and regulation of cellular immune responses [54,55], whereas IL-6 (pro-inflammatory cytokine) is associated with the final maturation of B lymphocytes into antibody-secreting plasma cells [56] and development of T cell memory to influenza virus [57]. Antioxidants such vitamins A, C, and E and selenium have been reported to significantly induce humoral and cellular immunity and phagocytosis when administered at their recommended levels [58]. From our study, we observed that, IL-1β, IL-6, and INF- γ in the selenium groups were significantly higher than that in the control groups in all the tissues; however, there was no difference in mRNA levels of IL-4 and IL-10 among all the groups, which may be because in the immune enhancement test stage, mice are subject to too many external stimuli except immunity and gavage, so the expression of anti-inflammatory factors in the body did not change significantly. The significant upregulation of IL-2, IL-6, and IFNγ in the lungs upon glycine nano-selenium solution supplementation reveals the localized function of cellular immunity, which is the reduction of viral shedding and inflammatory reaction. Furthermore, the higher expression of IL-2, IL-6, and IFN-γ in the spleen which acts as a secondary lymphoid organ where the maturation and activation of B and T lymphocytes take place after glycine nano-selenium solution administration indicated improved immune response. This results were consistent the studies by Luan et al. [59], Sun et al. [60], and Tian et al. [61] which reported that various types of selenium could improve the production of IL-1β, IL-6, and INF-γ cytokines. Furthermore, after the challenge experiment, IL-6 levels in the three tissues and IL-1β levels in the lung of the control group was significantly higher than the medium group, clearly showing a stronger inflammatory effect in the lungs than in the spleen and liver. This observation may be as a results of the virus first attacking the lungs through nasal drip before invading other tissues. In addition, the medium selenium added experimental group in all the tissues showed elevated levels of anti-inflammatory cytokine (IL-4 and IL-10) and immune cytokine (INF-γ) compared to the positive control and the control groups. This indicated that the administration of nano-selenium together with the vaccine enhanced the production of anti-inflammatory and immune factors in H9N2 avian influenza virus-vaccine-immune mice better than using the vaccine alone. This result was similar to the study by Awadin et al. [58], who reported that vitamin E as an antioxidant, similar to selenium, could enhance the production of immune cytokine (such as IL-2 and INF- γ) and anti-inflammatory cytokines in chickens experimentally infected with the avian influenza virus H9N2. In the study, we also observed that mice who got the 1 mg/kg dose of glycine nano-selenium showed lower antibody and cytokines production levels compared with the mice administered with 0.5 mg/kg nano-selenium or similar to the 0.25 mg/kg. The reason for this observation is that selenium at certain levels are toxic to animals and the dose selection for the current study was based on our previous studies [33], which used rats as the animal model; therefore, we speculate that 1 mg/kg nano-selenium would have exceeded the optimal dose for glycine nano selenium in mice, thus the reason for the observation of lower antibody and cytokines production in the 1 mg/kg group compared to the 0.5 mg/kg. In addition, the increase in the mRNA expression of IL-1beta and IL-6 before the challenge experiment is as a result of immunity enhancement by nano-selenium; however, the reduced levels of the mRNA expression of IL-1beta and IL-6 after challenge experiment may be as a result of no administration of the nano-selenium after the virus challenge experiment. This therefore confirms the immune enhancement of vaccine by nano-selenium. However, there is the need for further studies to vividly explain the major cause for these changes. In summary, from the results, we concluded that glycine nano-selenium at the concentration of 0.50 mg/kg did not cause poisoning in mice and improved the content of serum immunoglobulin as well as the expression level of specific immune cytokines in different tissues in immunized mice; therefore, supplementing glycine nano-selenium after immunization can effectively improve the immune efficacy of H9N2 AIV vaccines.

4. Materials and Methods

4.1. Experimental Materials

A total of 50 male Specific Pathogen Free Kunming mice aged 4–6 weeks, (weighing 18–20 g) were purchased from the experimental animal center of the Institute of zoology, Chinese Academy of Sciences (IOZ-15042). The avian influenza (H9 subtype) inactivated vaccine was purchased from Harbin Vico Biotechnology Co., Ltd., Harbin, China. Glycine nano-selenium was purchased from Zhejiang Weifeng Biotechnology Company, Hangzhou, China. The animals were housed in an experimental animal house at Sichuan Agricultural University at a constant temperature (22 ± 2 °C) and humidity (65 ± 5%) under a 12-h light/12-h dark cycle with free access to food and water. This study was approved by the Institutional Animal Care and Use Committee of Sichuan Agricultural University, Sichuan, China, under the permit number DKY-B2019603005.

4.2. Recovery of H9N2 Virus and Determination of eid50

Recovery of H9N2 Virus

The H9N2 recovery was performed following the procedure listed below: The positioning of diaphragmatic chamber and egg test chamber: the position of diaphragmatic chamber of chicken embryo was checked at 9–12 days. Chicken embryo (s) which was dead, unfertilized, cracked, underdeveloped, or had many water seepage holes on the surface was discarded. The judging scale used for checking the position of diaphragmatic chamber in the chicken embryo is represented as follows: ① blood vessels: the blood vessels of live embryo are clear, the dead embryo is fuzzy, and there are congestion zones or blood clots; ② fetal movement: the live embryo has obvious natural movement, and the dead embryo has no fetal movement: ③ the development boundary of chorioallantoic membrane. The blind end of the chicken embryo was placed on the egg plate with the air chamber facing upward; then, the concentration of virus to be inoculated and the number of chicken embryo on the eggshell were recorded. The chicken embryo was sterilized with 75% alcohol cotton ball, and a hole was drilled with a punch at the end of the air chamber and 0.5 cm above the edge of the chicken embryo’s allantoic membrane on the side of the chicken head. Using a 1 mL syringe, 100 µL of virus was sucked and injected into the allantoic cavity of chicken embryo from the drill hole to the chicken head. The pinhole on the eggshell was then completely sealed with wax. After disinfecting the surface with 75% alcohol, the chicken embryo was removed from the biosafety cabinet and cultured in a 37 °C incubator for 2–3 days. The growth of chicken embryos was observed every day. Chicken embryos that die within 24 h were considered to be non-specific deaths and were discarded. Chicken embryo harvesting: After culturing, chicken embryos were stored at 4 °C overnight before harvesting. A sterile10 mL tube labeled with the corresponding chicken embryo number was used for harvesting the embryos. The air chamber end of chicken embryo was also disinfected with 70–75% alcohol. Using sterile tweezers, the eggshell of chicken embryo air chamber and the allantoic membrane were broken or teared. Then, using a sterile 10 mL pipette, chicken embryo allantoic fluid was sucked and place in the corresponding collection tube. The chicken embryo harvest fluid was then centrifuge at 3000 R/min for 5 min to remove blood and cells. Then, the erythrocyte agglutination test was carried out to determine the virus titer of the collected allantoic fluid. The allantoic fluid was stored in the refrigerator at −80 °C.

4.3. Determination of eid50 of H9N2 Virus

The virus solution was logarithmically diluted with sterile PBS solution to form 10−1, 10−2, 10−3, 10−4, 10−5, 10−6, 10−7, 10−8, 10−9, and 10−10. After this, forty 9-day-old chicken embryos were randomly divided into 10 groups with 4 in each group, which were recorded as group 1, group 2, group 3, group 4, group 5, group 6, group 7, group 8, group 9, and group 10, respectively. In total, 0.1 mL of virus solution of each dilution was inoculated respectably each group of chicken embryos. Then, 72 h after infection, we observed and recorded the number of dead chicken embryo(s). The eid50 was calculated according to the method by Reed and Muench [62].

4.4. Experimental Grouping and Treatment

The experimental design is shown in Figure 11. After one-week adaptive feeding and two times immunization (day 0 and day 14 respectively), the mice were randomly divided into five groups: control normal group, which received no immunization + 0.5 mL of normal saline once every 2 days in 14 days (n = 10), positive control group, which received H9N2 AIV vaccine + 0.5 mL of 0.9% normal saline once every 2 days in 14 days (n = 10), 0.25 mg/kg selenium group, which received H9N2 AIV vaccine + 0.5 mL of 0.25 mg/kg selenium solution once every 2 days in 14 days (n = 10), 0.5 mg/kg selenium group, which received H9N2 AIV vaccine + 0.5 mL of 0.5 mg/kg selenium solution once every 2 days in 14 days (n = 10), and 1 mg/kg selenium group, which received H9N2 AIV vaccine + 0.5 mL of 1 mg/kg selenium solution once every 2 days in 14 days (n = 10). The experimental dosage for nano-selenium was selected based on our previous study (Yue et al., 2021). The mice in each group (the blank group exception) were immunized twice (at day 0 and day 14, respectively) by intramuscular injection (IM) of H9N2 AIV vaccine (100 µL per mouse) and nano-selenium was administered orally just after the day 14 immunization. Feed and clean water were provided ad libitum. Composition of normal diet can be found in the study by Ren et al. [63]. Water bottles were washed every week and fresh drinking water was placed in it for the next week’s administration. The bedding material (wood shavings) was also changed weekly.
Figure 11

Experimental design. Control, normal group, positive, mice received H9N2 AIV vaccine + 0.5 mL of 0.9% normal saline once every 2 days in 14 days; 0.25 mg/kg, mice received H9N2 AIV vaccine + 0.5 mL of 0.25 mg/kg selenium solution once every 2 days in 14 days; 0.5 mg/kg, mice received H9N2 AIV vaccine + 0.5 mL of 0.5 mg/kg selenium solution once every 2 days in 14 days; 1 mg/kg, mice received H9N2 AIV vaccine + 0.5 mL of 1 mg/kg selenium solution once every 2 days in 14 days.

4.5. Challenge Experiments

To assess protective immunity, challenge experiments were performed on a half of the mice (n = 5). After the last day of oral administration of nano-selenium, the remaining mice in all the groups (control group inclusive) were intranasally challenged with 50 μL of H9N2 virus (104eid50/0.1 mL) [64]. Death and health of mice were recorded every 4 h.

4.6. Organ Index of Liver, Spleen, and Lung Determination

Mice were weighed and euthanized by CO2 asphyxiation; all mice were fasted for 12 h prior to being euthanized. Mice sacrifices were performed 14 days after injection of the second immunization or after seven times administration of nano-selenium (n = 5) and 7 days after mice were challenged with virus (n = 5). At necropsy, blood from the abdominal aorta was collected into anticoagulant-coated tubes; the liver, lungs, and spleen were then aseptically removed, washed in normal saline, and weighed with analytical balance. The organ index was calculated according to the formula by Ren et al. [63]:Liver index% = (liver weight/mouse weight) × 100 Spleen index% = (spleen weight/mouse weight) × 100 Lung index% = (lung weight/mouse weight) × 100

4.7. Pathological Examination of Liver and Lung

Liver and lungs were fixed in 4% paraformaldehyde and embedded in paraffin and sectioned to be 5 μm thick. Hematoxylinensin (H&E) staining was used for liver pathological evaluation. H&E staining kits were purchased from Jiancheng Bioengineering Institute (Nanjing, China). All kits were used according to the corresponding manufacturers’ instructions. After dyeing, we observed the histopathological changes under the microscope and took photos of normal tissues or obvious lesions with the microscopic imaging system to describe the pathological changes [65].

4.8. Enzyme-Linked Immunosorbent Assay for Determination of IgG, IgM, IgA, and Specific IgG Immunoglobulin in Serum of Mice

The concentrations of IgG, IgM, IgA, and specific IgG immunoglobulin in serum of mice were determined using a commercial mouse ELISA kit (Jiangsu Jingmei Biological Technology Co., Ltd., Jiangsu, China), respectively.

4.9. Reverse Transcription-Quantitative Polymerase Chain Reaction (RT-qPCR)

Samples of liver, spleen, and lung tissues (30 mg/mouse) were snap-frozen with liquid N2 and then immediately ground into powder using a ceramic mortar. Total RNA from each sample was extracted using an Animal Total RNA Isolation Kit (Sagon Biotech, Shanghai, China) according to manufacturer’s instructions. After confirming the isolated RNA concentration and purity using a NanoDrop One system (Thermo Fisher Scientific, Waltham, MA, USA; OD260/280 ≈ 1.9–2.0), triplicate aliquots (each 1 µg) were removed, loaded into wells, and cDNA was prepared using a PrimeScrip RT reagent kit (Takara, Tokyo, Japan). Thereafter, qRT-PCR was performed using a SYBR Premix ExTaq (Takara) and a CFX96 thermal cycler (BioRad, Hercules, CA, USA). The PCR conditions were shown as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C, 15 s for denaturation, 60 °C, 60 s for annealing at, and 70 °C, 25 s for extension. Each qRT-PCR reaction was performed with volumes of 10 µL containing 5 µL TB Green TM Premix (Takara), 1 µL forward and reverse primers, 1 µL cDNA, and 2 µL DNase/RNase-Free Deionized Water (Tiangen, Beijing, China). The primers used to analyze the genes of interest were designed from NCBI genBank and are shown in Table 5. Relative gene expression in each sample was normalized to an internal control (β-actin); data analysis was performed using the 2−ΔΔCt method. All samples were evaluated in triplicate [66].
Table 5

The Primers sequences used for qRT-PCR.

PrimerSequence 5′-3′Product Size
IL-1βForwardTCGCAGCAGCACATCAACAAGAG97
ReverseAGGTCCACGGGAAAGACACAGG
IL-4ForwardTACCAGGAGCCATATCCACGGATG139
ReverseTGTGGTGTTCTTCGTTGCTGTGAG
IL-6ForwardACTTCCAGCCAGTTGCCTTCTTG110
ReverseTGGTCTGTTGTGGGTGGTATCCTC
IL-10ForwardTCCCTGGGTGAGAAGCTGAAGAC96
ReverseCACCTGCTCCACTGCCTTGC
INF-γForwardGGCTCTGGAGGCTGGAGGAAG126
ReverseTGATAGGCGGTGAGGCTACAAGG
ActbForwardCCTCACTGTCCACCTTCC120
ReverseGGGTGTAAAACGCAGCTC

4.10. Statistical Analysis

The test data were statistically analyzed by SPSS 26.0 software. The one-way ANOVA module in SPSS 26.0 software was used for Tukey one-way ANOVA. The final result is expressed by means of mean ± standard deviation (SD), and the analysis result p > 0.05 or p > 0.01 indicates that the difference is not significant; p < 0.05 or p < 0.01 indicates significant difference.
  56 in total

1.  Influenza A Virus in Backyard Pigs and Poultry in Rural Cambodia.

Authors:  K Osbjer; M Berg; S Sokerya; K Chheng; S San; H Davun; U Magnusson; B Olsen; S Zohari
Journal:  Transbound Emerg Dis       Date:  2016-08-02       Impact factor: 5.005

2.  Epidemiology of avian influenza A H7N9 virus in human beings across five epidemics in mainland China, 2013-17: an epidemiological study of laboratory-confirmed case series.

Authors:  Xiling Wang; Hui Jiang; Peng Wu; Timothy M Uyeki; Luzhao Feng; Shengjie Lai; Lili Wang; Xiang Huo; Ke Xu; Enfu Chen; Xiaoxiao Wang; Jianfeng He; Min Kang; Renli Zhang; Jin Zhang; Jiabing Wu; Shixiong Hu; Hengjiao Zhang; Xiaoqing Liu; Weijie Fu; Jianming Ou; Shenggen Wu; Ying Qin; Zhijie Zhang; Yujing Shi; Juanjuan Zhang; Jean Artois; Vicky J Fang; Huachen Zhu; Yi Guan; Marius Gilbert; Peter W Horby; Gabriel M Leung; George F Gao; Benjamin J Cowling; Hongjie Yu
Journal:  Lancet Infect Dis       Date:  2017-06-02       Impact factor: 25.071

3.  Supplemental dietary selenium enhances immune responses conferred by a vaccine against low pathogenicity avian influenza virus.

Authors:  Bahram Shojadoost; Khaled Taha-Abdelaziz; Tamiru Negash Alkie; Alexander Bekele-Yitbarek; Neda Barjesteh; Adrianna Laursen; Trevor K Smith; Janan Shojadoost; Shayan Sharif
Journal:  Vet Immunol Immunopathol       Date:  2020-06-25       Impact factor: 2.046

4.  Immunological and pathological effects of vitamin E with Fetomune Plus® on chickens experimentally infected with avian influenza virus H9N2.

Authors:  Walaa F Awadin; Abdelfattah H Eladl; Reham A El-Shafei; Mohamed A El-Adl; Hanaa S Ali
Journal:  Vet Microbiol       Date:  2019-02-20       Impact factor: 3.293

5.  Selenium deficiency inhibits differentiation and immune function and imbalances the Th1/Th2 of dendritic cells.

Authors:  Zhepeng Sun; Zhe Xu; Dongxu Wang; Haidong Yao; Shu Li
Journal:  Metallomics       Date:  2018-05-23       Impact factor: 4.526

6.  A cell culture-derived whole-virus H9N2 vaccine induces high titer antibodies against hemagglutinin and neuraminidase and protects mice from severe lung pathology and weight loss after challenge with a highly virulent H9N2 isolate.

Authors:  Walter Wodal; Falko G Falkner; Astrid Kerschbaum; Claudia Gaiswinkler; Richard Fritz; Stefan Kiermayr; Daniel Portsmouth; Helga Savidis-Dacho; Sogue Coulibaly; Christina Piskernik; Christine Hohenadl; M Keith Howard; Otfried Kistner; P Noel Barrett; Thomas R Kreil
Journal:  Vaccine       Date:  2012-05-10       Impact factor: 3.641

7.  Glycine nano-selenium prevents brain oxidative stress and neurobehavioral abnormalities caused by MPTP in rats.

Authors:  Dong Yue; Chaorong Zeng; Samuel Kumi Okyere; Zhengli Chen; Yanchun Hu
Journal:  J Trace Elem Med Biol       Date:  2020-11-12       Impact factor: 3.849

8.  Insertions of codons encoding basic amino acids in H7 hemagglutinins of influenza A viruses occur by recombination with RNA at hotspots near snoRNA binding sites.

Authors:  Alexander P Gultyaev; Monique I Spronken; Mathis Funk; Ron A M Fouchier; Mathilde Richard
Journal:  RNA       Date:  2020-11-13       Impact factor: 4.942

9.  Infectious Bronchitis Virus Infection Increases Pathogenicity of H9N2 Avian Influenza Virus by Inducing Severe Inflammatory Response.

Authors:  Lingchen Kong; Renrong You; Dianchen Zhang; Qingli Yuan; Bin Xiang; Jianpeng Liang; Qiuyan Lin; Chan Ding; Ming Liao; Libin Chen; Tao Ren
Journal:  Front Vet Sci       Date:  2022-02-08

10.  Bacillus toyonensis SAU-19 and SAU-20 Isolated From Ageratina adenophora Alleviates the Intestinal Structure and Integrity Damage Associated With Gut Dysbiosis in Mice Fed High Fat Diet.

Authors:  Samuel Kumi Okyere; Juan Wen; Yujing Cui; Lei Xie; Pei Gao; Ming Zhang; Jianchen Wang; Shu Wang; Yinan Ran; Zhihua Ren; Yanchun Hu
Journal:  Front Microbiol       Date:  2022-02-17       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.