Literature DB >> 35881569

Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus.

Meilipaiti Yusufu1, Ayipairi Abula1, Boyong Jiang1, Jiayinaguli Zhumabai1, Fei Deng2, Yijie Li1, Yujiang Zhang3, Juntao Ding1, Surong Sun1.   

Abstract

Guertu virus (GTV), a newly discovered member of the genus Banyangvirus in the family Phenuiviridae, poses a potential health threat to humans and animals. The viral glycoprotein (GP) binds to host cell receptors to induce a neutralizing immune response in the host. Therefore, identification of the B-cell epitopes (BCEs) in the immunodominant region of the GTV Gc protein is important for the elucidation of the virus-host cell interactions and the development of GTV epitope assays and vaccines. In this study, an improved overlapping biosynthetic peptide method and rabbit anti-GTV Gc polyclonal antibodies were used for fine mapping of the minimal motifs of linear BCEs of the GTV Gc protein. Thirteen BCE motifs were identified from eleven positive 16mer-peptides, namely EGc1 (19KVCATTGRA27), EGc2 (58KKINLKCKK66), EGc3 (68SSYYVPDA75), EGc4 (75ARSRCTSVRR84), EGc5 (79CTSVRRCRWA88), EGc6 (90DCQSGCPS97), EGc7 (96PSHFTSNS103), EGc8 (115AGLGFSG121), EGc9 (148ENPHGVI154), EGc10 (179KVFHPMS185), EGc11 (230QAGMGVVG237), EGc12 (303RSHDSQGKIS312), and EGc13 (430DIPRFV435). Of these, 7 could be recognized by GTV IgG-positive sheep sera. Three-dimensional structural analysis revealed that all 13 BCEs were present on the surface of the Gc protein. Sequence alignment of the 13 BCEs against homologous proteins from 10 closely related strains of severe fever with thrombocytopenia syndrome virus from different geographical regions revealed that the amino acid sequences of EGc4, EGc5, EGc8, EGc11, and EGc12 were highly conserved, with 100% similarity. The remaining 8 epitopes (EGc1, EGc2, EGc3, EGc6, EGc7, EGc9, EGc10, and EGc13) showed high sequence similarity in the range of 71.43%-87.50%. These 13 BCEs of the GTV Gc protein provide a molecular foundation for future studies of the immunological properties of GTV glycoproteins and the development of GTV multi-epitope assays and vaccines.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35881569      PMCID: PMC9321374          DOI: 10.1371/journal.pone.0271878

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Ticks, the species of which are either generalist or specialist parasites, are responsible for transmission of a variety of pathogens to animals and humans [1]. The incidence of tick-borne viral diseases has increased over the past few decades, thereby compromising the health of humans significantly. In recent years, tick-borne severe fever with thrombocytopenia syndrome virus (SFTSV) and heartland virus (HRTV) infections have been shown to be associated with serious human diseases and fatalities in the USA and East Asian countries [2-4]. Studies on SFTSV and HRTV indicate that novel tick-borne viruses may pose a significant threat to public health. Therefore, the discovery and investigation of novel tick-borne viruses are of great importance for ensuring the control and prevention of potential disease outbreaks. Guertu virus (GTV), which is a member of the newly defined genus Banyangvirus belonging to the family Phenuiviridae of Order Bunyavirales [5], was first isolated in 2014 from Dermacentor nuttalli, a tick found in the Guertu mountain region of Wusu, Xinjiang, China [6]. Researchers reported the morphological characteristics of GTV for the first time, and phylogenetic analysis showed that it was closely related to SFTSV [7-10]. The genome of GTV consists of the following three single-stranded RNA segments: an S segment that contains open reading frames that encode a nonstructural (NS) protein and a nucleoprotein (NP); an L segment that encodes an RNA-dependent RNA polymerase; and M segment that encodes a glycoprotein precursor that is cleaved into two mature envelope proteins (Gn and Gc) during co-translational modification [6]. Studies have shown that viral expression of the Gn protein is directly correlated with the Gc protein-facilitated binding of the viral particles to the host cell surface and that the Gc protein is efficiently translated from the Gn/Gc-encoding mRNA, thus driving the fusion between the virus and the host cell membrane [11]. At present, presumable N-glycosylation sites is located on SFTSV Gc glycoproteins [10, 11]. DC-SIGN has been identified as the receptor factor on the host cell membrane [10]. Some studies have also shown that HS and NMMHC-IIA may also be the entry factors related to cell entry of SFTSV [12]. Additionally, Gn and Gc facilitate viral entry into the target cells and are the primary targets of neutralizing antibodies [13]. B-cell epitopes (BCEs), which are recognized by B-cell receptors, induce cellular and humoral immune responses in the host [14]. Therefore, the identification of viral BCEs would deepen our understanding of the host immune response, provide candidate epitope peptides for the development of epitope vaccines or the establishment of disease diagnostic methods, and help to reveal the mechanisms of therapeutic antibodies [15, 16]. Specifically, the identification of BCEs of the conserved domain or immunodominant region of the Gc protein of GTV is crucial for the elucidation of the virus–host cell interactions and development of GTV assays and vaccines [17]. However, up to date, there are no reports on epitope mapping of GTV Gc segment and their fine localization. The currently available epitope mapping methods include recombinant DNA techniques, biosynthetic peptide (BSP) methods, chemically synthesized peptides or peptide microarrays, and phage-display libraries [18-22]. The BSP method developed by Xu et al. in 2009 was used for the identification of linear BCEs and minimal epitope motifs, and they successfully mapped linear of BCEs of three structural proteins of human papillomavirus type 58, using anti-recombinant protein pAbs [23, 24]. In our previous study, this method was used to identify the linear BCEs of structural proteins from a strain of Crimean-Congo hemorrhagic fever virus that was isolated in Xinjiang, where its feasibility for epitope identification was demonstrated [25-27]. Additionally, Zhang et al. [17] used pAbs and the BSP method to identify nine BCEs on the Gn protein of GTV. However, the identification of BCEs on the Gc protein of GTV has not been reported thus far. Therefore, this study was performed to identify the minimal BCEs on the Gc protein of GTV, using biosynthetic peptide (BSP) methods [14], and rabbit anti-GTV-Gc pAbs. Subsequently, 13 minimal epitope motifs were obtained and their antigenicity was confirmed using positive sera from sheep naturally infected with GTV. Python 2.7 was used to analyze the three-dimensional (3D) conformation of the Gc protein, thus revealing that the identified BCEs were all located on the protein surface. This study provides fundamental data that can be used in future studies aimed at elucidating the immunological properties of the Gc protein of GTV and for developing diagnostic reagents and vaccines for infection prevention and control.

Materials and methods

Ethical statement

This study was approved by the Animal Ethics Committee of the Key Laboratory of Bioresources and Genetic Engineering, Xinjiang University (Approval number: BRGE-AE001). The animal serum samples were collected using a random sampling method that did not involve sacrifice of the animals, and serum collection was performed according to this approved animal protocol [14].

Antibodies

The rabbit pAbs raised against GTV Gc1 (aa 1–291) and Gc2 (aa 252–549) were prepared by the Wuhan Institute of Virology, Chinese Academy of Sciences. His-tag mouse monoclonal antibody, goat anti-mouse horseradish peroxidase-conjugated IgG (IgG-HRP), and goat anti-rabbit IgG-HRP were purchased from Beijing Solarbio Science & Technology Co., Ltd. The serum samples from sheep infected or not infected with GTV were previously identified by indirect immunofluorescence assay and reverse transcription-polymerase chain reaction (RT-PCR) assay [6].

Construction of the truncated Gc fragments for recombinant plasmid expression

The prokaryotic expression plasmid pET-32a (+) containing the full-length Gc gene fragment of GTV strain DXM (GenBank accession no. KT328592.1) was stored at our laboratory. The prokaryotic expression vector pXXGST-3 was provided by Professor Xu Wanxiang of the Shanghai Institute for Biomedical Pharmaceutical Technologies, China. The Gc protein of GTV was divided into two truncated fragments Gc1 and Gc2 (Fig 1). These fragments were then PCR-amplified using the previously constructed pET-32a-GTV-Gc plasmid as a template [28] for the design of the following primers: GcI F: CGGGATCCATGAAACTGGTTCGCTTAACC; GcI R: AATGCGGCCGCTTATGATTTCAGTTCTTCAATTTCAC; GcII F: CGGGATCCATGAGTGGTGTTCCGACCCAG; and GcII R: AATGCGGCCGCTTAGGTCAGCAGCACGCCT.
Fig 1

Schematic of epitope mapping strategy.

(A) The black band indicates the full-length sequence of GTV-Gc, and the gray bands indicate two of truncated GcⅠ and GcⅡ segments. (B) Schematic of epitope mapping strategy involves 57 overlapping 16mer-peptides spanning Gc sequences.

Schematic of epitope mapping strategy.

(A) The black band indicates the full-length sequence of GTV-Gc, and the gray bands indicate two of truncated GcⅠ and GcⅡ segments. (B) Schematic of epitope mapping strategy involves 57 overlapping 16mer-peptides spanning Gc sequences.

Strategy for designing GTV Gc overlapping peptides

To map the linear BCEs of the GTV Gc protein, we designed 16mer-peptides with eight overlapping amino acid residues for the first round of antigenic peptide mapping (Fig 1). Additionally, a series of 8mer-peptides with seven overlapping amino acid residues that spanned every positive 16mer-peptides sequence were also designed for the second round of fine mapping of the BCE motif [29]. The GTV Gc protein was designed into fifty-seven 16mer-peptides using modified overlapping peptide biosynthesis. These 16mer-peptides were further shortened into a total of seventy-nine 8mer-peptides overlapping 7mer-peptides. The BSP method had the following features: (1) By selecting the truncated GST188 protein as the fusion tag for the recombinant expression of short peptides, the fragment size of the expressed fusion peptide was maintained within 21.5–22.5 kDa, which allowed its easy identification by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and subsequent western blot analysis. This also facilitated the easy distinction of the short peptides from the proteins expressed by the host (Escherichia coli); (2) The antigenic proteins were first divided into 16mer-peptides with eight overlapping amino acid residues, following which basic and complete screening was performed for those containing BCEs; (3) Further truncation of the positive 16mer-peptides into 8mer-peptides with seven overlapping amino acid residues allowed the precise determination of the minimal epitope motif for each linear BCE [14].

Construction and prokaryotic expression of the GTV Gc overlapping peptides

A suspension of bacterial cells harboring the empty prokaryotic expression plasmid pXXGST-3 was added to 10 mL of liquid medium containing 0.1% ampicillin and incubated overnight. The plasmid was then extracted using the Plasmid Mini-Prep Kit. The DNA fragments intended for incorporation into the plasmid were first digested with BamH I and Sal I at a constant temperature of 37°C for 4–5 h. According to the biosynthesis report of the biotechnology company, we considered the final concentration of each synthesized DNA fragment as 5 μM per tube. These fragments were mixed and heated to 95°C for 5 min in a constant temperature bath and then annealed by natural cooling to ambient temperature. The annealed oligonucleotides were mixed with the digested pXXGST-3 plasmid and then ligated at 16°C for 12–15 h. The vector was transfected into E. coli BL21(DE3) competent cells and cultured overnight, following which single clones were added to ampicillin-containing Luria broth and incubated overnight at 37°C under shaking conditions. On the next day, 1% of the overnight culture was inoculated into new Luria broth and cultured at 30°C under shaking conditions until the OD600 reached 0.6–0.8. Heat induction at 42°C was then conducted for another 4 h [29].

SDS-PAGE and western blot analysis of the GTV Gc overlapping peptides

The bacterial culture was centrifuged at 12000 rpm for 1 min, and the supernatant was discarded. After resuspending the cells in 160 μL of 1×phosphate-buffered saline, 40 μL of 5×loading buffer was added and the mixture was boiled at 100°C for 15 min and then centrifuged at 12000 rpm for 15 min. The protein samples were then separated by 15% SDS-PAGE. The plasmids expressing the correct protein size were send to Shanghai Sangon for sequencing. Western blot analysis was performed on the recombinant proteins, using rabbit anti-Gc pAbs to analyze their antigenicity. The proteins from strains with the correct sequencing results were separated by 15% SDS-PAGE. Polyvinylidene difluoride (PVDF) membranes were purchased from Whatman International Limited. The separation gel was then removed with a transfer clamp and placed in an electrophoresis tank for electrotransfer of the proteins onto a PVDF membrane at 90 V for 90 min. Thereafter, the PVDF membrane was immersed in blocking buffer at 37°C for 2 h, washed with Tris-buffered saline-Tween 20 (TBS-T), and then incubated with rabbit serum (1:300) at 4°C overnight. Subsequently, the PVDF membrane was first rinsed with the washing buffer for 1 h and then incubated with HRP-labeled secondary antibody (1:2000) at 37°C for 1 h. Finally, after rinsing the membrane with the washing buffer for 1 h, the ECL (Wuhan Boster Biological Technology Ltd.) chromogenic reagent was added and the membrane was imaged using the LAS-4000 chemiluminescence imaging system.

Analyses of the similarities of the conformational antigenic epitopes and their localization on Gc by three-dimensional modeling

To analyze the similarity of each BCE with homologous proteins, Gc sequences of SFTSV strains from different countries and genetic lineages were downloaded from the GenBank database on the basis of the phylogenetic tree of SFTSV strains [9]. The BCE locations were experimentally identified from the 3D structure of the Gc protein using the PyMOL software (https://pymol.org/2/). Predictions of the secondary structure were conducted according to the Garnier-Robson [30] and Chou-Fasman [31] methods. The hydrophilicity, flexibility, surface accessibility, and antigenicity indices were also analyzed and predicted.

Results

Induced expression of the overlapping 16mer-peptides and western blot analysis of their antigenicity

The SDS-PAGE results showed that the 57 overlapping 16mer-peptides spanning the GTV Gc1-549 fragment were successfully expressed under the 42°C heat induction conditions (Fig 2A and 2C). The corresponding western blot analysis of their antigenicity showed that P3 (Gc17-32), P8 (Gc57-72), P9 (Gc65-80), P10 (Gc73-89), P12 (Gc89-104), P15 (Gc113-128), P19 (Gc145-160), P23 (Gc177-192), P29 (Gc225-240), P38 (Gc297-312), and P54 (Gc425-440) could bind specifically to the rabbit pAbs (Fig 2B and 2D) and were therefore potential linear antigenic epitope motifs.
Fig 2

SDS-PAGE and Western blot analysis of expressed 16mer-peptides.

(A and C) SDS-PAGE analysis of expressed 16mer-peptides. The numbers of P1-P57 indicate each 16mer-peptides in cell total proteins. The cell proteins of each recombinant clone were resolved by 12% SDS-PAGE and stained with Coomassie brilliant blue. M, the protein molecular marker; PC, Positive control of expressed 16mer peptide in GTV-NP; NC, Negative control of GST188 carrier protein expressed by pXXGST-2. (B and D) Western blot analysis for mapping reactive 16mer-peptides in P1-P57. The rabbit antiserum (1:300 dilution) against GTV-Gc was used in Western blot analysis. The reactive bands in Western blot analysis were visualized by enhanced chemiluminescence.

SDS-PAGE and Western blot analysis of expressed 16mer-peptides.

(A and C) SDS-PAGE analysis of expressed 16mer-peptides. The numbers of P1-P57 indicate each 16mer-peptides in cell total proteins. The cell proteins of each recombinant clone were resolved by 12% SDS-PAGE and stained with Coomassie brilliant blue. M, the protein molecular marker; PC, Positive control of expressed 16mer peptide in GTV-NP; NC, Negative control of GST188 carrier protein expressed by pXXGST-2. (B and D) Western blot analysis for mapping reactive 16mer-peptides in P1-P57. The rabbit antiserum (1:300 dilution) against GTV-Gc was used in Western blot analysis. The reactive bands in Western blot analysis were visualized by enhanced chemiluminescence.

Induced expression and western blot analysis of the overlapping 8mer-peptides

To identify the minimal antigenic epitopes that could bind specifically to the rabbit pAbs, the eleven positive 16mer peptide fragments were further designed as 8mer-peptides with seven overlapping amino acids. The SDS-PAGE and sequencing results showed that all overlapping 8mer-peptides with a GST188 tag were correctly expressed in E. coli. Moreover, the western blot analysis confirmed that P9-3 (Gc68-75) in the P9 epitope was specifically recognized by the rabbit pAbs, indicating that the minimal motif of the P9 epitope was “SSYYVPDA” (named EGc3). Similarly, in the P12, P15, P19, P23, and P54 epitopes, the minimal motifs recognized by the rabbit pAbs were found to be P12-1 (Gc90-97), P12-7 (Gc96-103), P15-1 (Gc114-121), P15-2 (Gc115-122), P19-2 (Gc147-154), P19-3 (Gc148-155), P23-1 (Gc178-185), P23-2 (Gc179-186), P54-3 (Gc428-435), P54-4 (Gc429-436), and P54-5 (Gc430-437). Interestingly, none of the overlapping 8mer-peptides generated from the other five positive 16mer-peptides (i.e., P3, P8, P10, P29, and P38) showed a positive reaction, suggesting that their minimal epitope motifs might contain longer antigenic fragments. Finally, as shown in Fig 3, seven BCEs were identified, namely EGc3 (68SSYYVPDA75), EGc6 (90DCQSGCPS97), EGc7 (96PSHFTSNS103), EGc8 (115AGLGFSG121), EGc9 (148ENPHGVI154), EGc10 (179KVFHPMS185), and EGc13 (430DIPRFV435).
Fig 3

SDS-PAGE and Western blot analysis of expressed 8mer-peptides.

(A, C, E and G) SDS-PAGE analysis of expressed 8mer-peptides. It indicates each 8mer peptide of P3, P8, P9, P10, P12, P15, P19, P23, P29, P38 and P54. The cell proteins of each recombinant clone were resolved by 12% SDS-PAGE and stained with Coomassie brilliant blue. M, the protein molecular marker. NC, Negative control of GST188 protein. PC, Positive control of mapped reactive P3. (B, D, F and H) Western blot analysis for mapping fine epitopes in each reactive 8-mer-peptides. The rabbit antiserum against GTV-Gc (1:300 dilution) was used in Western blot analysis. The reactive bands in Western blot analysis were visualized by enhanced chemiluminescence.

SDS-PAGE and Western blot analysis of expressed 8mer-peptides.

(A, C, E and G) SDS-PAGE analysis of expressed 8mer-peptides. It indicates each 8mer peptide of P3, P8, P9, P10, P12, P15, P19, P23, P29, P38 and P54. The cell proteins of each recombinant clone were resolved by 12% SDS-PAGE and stained with Coomassie brilliant blue. M, the protein molecular marker. NC, Negative control of GST188 protein. PC, Positive control of mapped reactive P3. (B, D, F and H) Western blot analysis for mapping fine epitopes in each reactive 8-mer-peptides. The rabbit antiserum against GTV-Gc (1:300 dilution) was used in Western blot analysis. The reactive bands in Western blot analysis were visualized by enhanced chemiluminescence.

Induced expression and western blot analysis of the overlapping 10mer-peptides

To identify the minimal antigenic epitope motifs of the positive 16mer-peptides P3, P8, P10, P29, and P38 that could bind specifically to rabbit pAbs, we designed them as 10mer-peptides with seven overlapping amino acid residues for validation. The SDS-PAGE and sequencing results showed that all overlapping 10mer-peptides with a GST188 tag were correctly expressed in E. coli, and western blot analysis showed that P3-9 (Gc18-27), P3-10 (Gc19-28), P8-8 (Gc57-66), P8-9 (Gc58-67), P10-14 (Gc76-85), P10-17 (Gc79-88), P29-11 (Gc228-237), P29-12 (Gc229-238), P29-13 (Gc230-239), and P38-16 (Gc303-312) were specifically recognized by the rabbit pAbs. The minimal motifs in these epitopes were EGc1 (19KVCATTGRA27), EGc2 (58KKINLKCKK66), EGc4 (75ARSRCTSVRR84), EGc5 (79CTSVRRCRWA88), EGc11 (230QAGMGVVG237), and EGc12 (303RSHDSQGKIS312) (Fig 4). Thus, a total of 13 minimal antigenic epitope motifs were identified in GTV Gc1-549. The overlapping 16/10/8mer peptide sequences and their corresponding locations on the Gc protein are shown in Fig 5.
Fig 4

SDS-PAGE and Western blot analysis of expressed 10mer-peptides.

(A and C) SDS-PAGE analysis of expressed 10mer-peptides for P3, P8, P10, P29 and P38. The cell proteins of each recombinant clone were resolved by 12% SDS-PAGE and stained with Coomassie brilliant blue. M, the protein molecular marker; NC, Negative control of GST188 carrier protein. PC, Positive control of P3. (B and D) Western blot analysis for mapping fine epitopes in each reactive 10mer peptide. The rabbit antiserum against GTV-Gc (1:300 dilution) was used in Western blot analysis. The reactive bands in Western blot analysis were visualized by enhanced chemiluminescence.

Fig 5

The bio-synthetic overlapping peptides derived from IgG-reactive peptides of Gc1-459.

The yellow highlighting represents the common sequences among immunodominant peptides that react with pAbs according to western blot analysis.

SDS-PAGE and Western blot analysis of expressed 10mer-peptides.

(A and C) SDS-PAGE analysis of expressed 10mer-peptides for P3, P8, P10, P29 and P38. The cell proteins of each recombinant clone were resolved by 12% SDS-PAGE and stained with Coomassie brilliant blue. M, the protein molecular marker; NC, Negative control of GST188 carrier protein. PC, Positive control of P3. (B and D) Western blot analysis for mapping fine epitopes in each reactive 10mer peptide. The rabbit antiserum against GTV-Gc (1:300 dilution) was used in Western blot analysis. The reactive bands in Western blot analysis were visualized by enhanced chemiluminescence.

The bio-synthetic overlapping peptides derived from IgG-reactive peptides of Gc1-459.

The yellow highlighting represents the common sequences among immunodominant peptides that react with pAbs according to western blot analysis.

Validation of the antigenicity of the peptides using GTV-positive sheep sera

To investigate whether BCE screening with a rabbit anti-GTV Gc polyclonal antiserum could detect the IgG antibodies present naturally in livestock, the 13 short peptides of BCEs identified in this experiment were analyzed by western blot analysis using the positive serum of a sheep naturally infected with GTV and the negative serum of an uninfected sheep. The results showed that all 13 short peptides containing BCEs were correctly expressed (Fig 6A). Among the 13 minimal BCE motifs identified, only EGc2, EGc3, EGc4, EGc9, EGc10, EGc11, and EGc12 were specifically recognized by the positive sheep serum (Fig 6B). None of the BCEs identified could be recognized by the negative sheep serum (Fig 6C). The Western blot results showed that there was a good consistency between the immune response of rabbit and sheep to GTV GC protein.
Fig 6

Western blot analysis of mapped BCEs using sheep sera.

(A) SDS-PAGE analysis of expressed BCEs. (B) Using a positive serum from a sheep confirmed GTV-infection. (C) Using a serum from healthy sheep with no history of GTV infection as a negative control. PC, Positive control of GTV-Gc1.

Western blot analysis of mapped BCEs using sheep sera.

(A) SDS-PAGE analysis of expressed BCEs. (B) Using a positive serum from a sheep confirmed GTV-infection. (C) Using a serum from healthy sheep with no history of GTV infection as a negative control. PC, Positive control of GTV-Gc1.

Sequence conservation analysis and three-dimensional modeling

Using the Gendoc software, the amino acid sequences of the 13 BCEs were aligned with those of homologous proteins from 10 genetically closely related SFTSV strains from different regions (Japan, Accession no. AB817987.1; Japan, Accession no. AB985297.1; China, Accession no. HQ141605.1; China, Accession no. HQ830167.1; China, Accession no. HQ830167.1; China, Accession no. JQ670931.1; China, Accession no. KC505127.1; South Korea, Accession no. KF358692.1; China, Accession no. KP202164.1; China, Accession no. KX302598.1; and South Korea, Accession no. KY789438.1). The results revealed that EGc4 (75ARSRCTSVRR84), EGc5 (79CTSVRRCRWA88), EGc8 (115AGLGFSG121), EGc11 (230QAGMGVVG237), and EGc12 (303RSHDSQGKIS312) were identical among the representative SFTSV strains and showed 100% conserved sequences (Fig 7). Thus, they can be used as candidates for broad-spectrum multi-epitope vaccine design.
Fig 7

Sequence comparison between GTV-Gc1-549 and 10 SFTSV strains.

The GenBank codes and sources are shown at left and the sequence analysis was based on the ClustalW program. The nine of fine BCEs and APs recognized by pAbs are highlighted, and the variable aa residue within the BCE motif are highlighted in red. Dots (.) indicate identical aa residue in ten SFTSV strains (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article).

Sequence comparison between GTV-Gc1-549 and 10 SFTSV strains.

The GenBank codes and sources are shown at left and the sequence analysis was based on the ClustalW program. The nine of fine BCEs and APs recognized by pAbs are highlighted, and the variable aa residue within the BCE motif are highlighted in red. Dots (.) indicate identical aa residue in ten SFTSV strains (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article). As shown in Fig 7, there was variability between the other epitopes and the SFTSV sequences. The sequence similarities of EGc1, EGc2, EGc3, EGc6, EGc7, EGc9, EGc10, and EGc13 were 87.50%, 87.50%, 87.50%, 87.50%, 87.50%, 85.71%, 71.43%, and 71.43%, respectively. In EGc1 (19KVCATTGRA27), “V” was changed to “E” at position Gc20; in EGc2 (58KKINLKCKK66), “V” was changed to “R” at position Gc59; in EGc3 (68SSYYVPDA75), “Y” was changed to “F” at position Gc71; in EGc6 (90DCQSGCPS97) and EGc7 (96PSHFTSNS103), “S” was changed to “P” at position Gc97; in EGc9 (148ENPHGVI154), “V” was changed to “I” at position Gc153; in EGc10 (179KVFHPMS185), “K” was changed to “V” and “R” was changed to “T” at positions Gc179 and Gc180; and in EGc13 (430DIPRFV435), “I” was changed to “R” and “V” was changed to “K” at positions Gc431 and Gc433. The 3D structure of the Gc protein of GTV strain DXM was modeled using the Python 2.7 software, where different color markers were used to locate the BCEs in the model. As shown in Fig 8B, all the identified antigenic epitopes were located on the surface of the Gc protein. Moreover, the 13 BCEs were located at positions that were easily accessible for antibody chimerization and thus could facilitate the binding of specific antibodies.
Fig 8

Prediction of Gc secondary structure and 3D localization of each BCEs.

(A) Epitope prediction for GTV-Gc using DNAStar-Protean software. The secondary structure, flexibility plot, hydrophilicity, surface probability, and antigenicity index for GTV-Gc were taken into consideration. (B) Location distribution on 3D structure of mapped BCEs and APs on molecular surface were shown in different colors. EGc1 (red), EGc2 (salmon), EGc3 (blue), EGc4 (slate), EGc5 (yellow), EGc6 (wheat), EGc7 (hot pink), EGc8 (light magenta), EGc9 (brown),EGc10 (firebrick), EGc11 (gray), EGc12 (orange), EGc13 (white). The figures were generated using the PyMOL™ molecular graphics system (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

Prediction of Gc secondary structure and 3D localization of each BCEs.

(A) Epitope prediction for GTV-Gc using DNAStar-Protean software. The secondary structure, flexibility plot, hydrophilicity, surface probability, and antigenicity index for GTV-Gc were taken into consideration. (B) Location distribution on 3D structure of mapped BCEs and APs on molecular surface were shown in different colors. EGc1 (red), EGc2 (salmon), EGc3 (blue), EGc4 (slate), EGc5 (yellow), EGc6 (wheat), EGc7 (hot pink), EGc8 (light magenta), EGc9 (brown),EGc10 (firebrick), EGc11 (gray), EGc12 (orange), EGc13 (white). The figures were generated using the PyMOL™ molecular graphics system (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article). The secondary structure of Gc1-549 was predicted using the DNASTAR Protean software (DNASTAR Inc., Madison, WI, USA), which showed that the identified epitopes formed part of the β-sheet and α-helix regions (Fig 8B). Moreover, the identified epitopes were predicted to be located on the surface of the GTV Gc protein with a high antigenic index and hydrophilicity, suggesting that they might be important BCEs of this glycoprotein (Fig 8A). The 3D modeling and protein secondary structure analysis indicated that the predictions were consistent with the identified epitopes and that the identified BCEs were all located in the hydrophilic region.

Discussion

Bunyavirales are the largest order of RNA viruses with the ability to infect a wide range of hosts, including humans, arthropods, and plants [32]. Several emerging bunyaviruses, such as the Rift Valley fever virus [33], Crimean-Congo hemorrhagic fever virus [34], HRTV [7], and SFTSV [35], have been shown to pose a serious threat to human health. SFTSV can be transmitted from ticks to humans, with human-to-human transmission occurring in rare instances [36-38], and can lead to the manifestation of diseases characterized by fever, gastrointestinal symptoms, leukopenia, and thrombocytopenia. SFTSV and its related viruses are important emerging pathogens for which there are currently no specific antiviral drugs or vaccines [32]. As a novel bunyavirus, GTV belongs to the genus Banyangvirus together with HRTV and SFTSV [5]. Shen et al. [6]. performed in vitro and in vivo experiments to characterize the infection properties of GTV in human- and animal-derived cells. They found that infection of C57BL/6 mice with GTV could cause viremia or organopathological changes, indicating that this virus was a potential pathogen capable of infecting humans and animals. Serological testing of local residents in the Guertu area of Wusu City, Xinjiang revealed that 19.8% were positive for anti-GTV antibodies, and three of them had neutralizing antibody activity against the virus, which further suggested the potential risk of this pathogen to human health. Studies have shown that viral glycoproteins are the targets of neutralizing antibodies and that the envelope glycoproteins are responsible for the binding of the virus particles to cellular receptors and subsequent viral fusion [39]. In viral infections, almost all neutralizing polyclonal or monoclonal antibodies are specific to the Gn and Gc glycoproteins [40, 41]. Therefore, the identification of BCE domains in GTV glycoproteins will provide new targets for the design and development of vaccines and diagnostic reagents for this virus. Although several studies on the identification of BCEs of the GTV Gn protein have been reported [17], there are no published studies on epitope mapping of the GTV Gc protein or of its IgG motif recognition sites. In this study, an improved BSP method was used to map linear BCEs spanning the full length of the GTV Gc protein. Using the overlapping BSP method, the Gc protein was divided into 57 overlapping 16mer-peptides. Of these, 11 positive 16mer-peptides were selected through western blot analysis using rabbit anti-GTV-Gc pAbs and were further divided into 79 overlapping 8mer-peptides and 35 overlapping 10mer-peptides. Using immunoblot analysis, the following 13 antigenic epitope motifs were finally identified: EGc1 (19KVCATTGRA27), EGc2 (58KKINLKCKK66), EGc3 (68SSYYVPDA75), EGc4 (75ARSRCTSVRR84), EGc5 (79CTSVRRCRWA88), EGc6 (90DCQSGCPS97), EGc7 (96PSHFTSNS103), EGc8 (115AGLGFSG121), EGc9 (148ENPHGVI154), EGc10 (179KVFHPMS185), EGc11 (230QAGMGVVG237), EGc12 (303RSHDSQGKIS312), and EGc13 (430DIPRFV435). Amino acid sequence alignment of the BCEs with homologous proteins from 10 closely related SFTSV strains showed that EGc4, EGc5, EGc8, EGc11, and EGc12 were the most conserved epitopes (i.e., with 100% sequence identity) and could be used as candidates for the future design of broad-spectrum multi-epitope vaccines against GTV and SFTSV. EGc1, EGc2, EGc3, EGc6, EGc7, EGc9, and EGc13 differed more significantly from the SFTSV Gc sequences, showing differences of 1–2 amino acids, and thus could be used for the serological verification of GTV infection in patients in the future. Since no GTV-infected patients have been identified thus far, it is not possible to confirm whether these epitopes are specific to this virus. In the future, detection of serum antibodies to SFTSV and GTV simultaneously in patients will remain necessary to compare the specificity and sensitivity of these epitopes and to establish a theoretical basis for the development of broad-spectrum and specific detection methods and vaccines for bunyaviruses. Additionally, the 13 BCEs identified in this study were all confirmed by secondary and 3D structural analyses to be located on the surface of the protein structure and showed good antigenicity. The prediction results included most of the experimentally identified epitope motifs, indicating that the epitope prediction tool combined with the BSP method was a reliable approach for epitope identification and mapping and could reduce the experimental workload and costs of epitope mapping and immunodiagnosis [14, 26, 27]. Moreover, none of the 13 BCEs required purification, mainly because the recombinant fusion peptide expressed by the pXXGST-3 vector was larger than the protein in the empty vector, and the expression products were located in the weak antigenic region of E. coli. Therefore, the expression products could be used directly for western blot analysis without a purification step, thereby reducing the time needed for screening of the recombinant bacteria and the workload [23, 24]. Among study limitations, this study only identified linear epitopes of the Gc protein. Also, there are currently no B cell epitopes predicted to be affected by different MHC haplotypes. The mechanism of virus neutralization by anti-Gc protein antibodies remains unknown, and neutralization through identified linear epitopes of Gc protein has not been characterized. Notably, improved BSP method adopted is only suitable for screening simple linear epitopes. In the future, peptide microarray high-throughput screening, mass spectrometry, and other techniques may be necessary to identify conformational epitopes in order to avoid missing the detection of specific epitopes of SFTSV and GTV that could be used to distinguish the two viruses. In the future, serological validation of GTV should be conducted to investigate whether these epitopes are specific to this virus and whether they can be used to detect SFTSV and GTV antibodies or to design broad-spectrum vaccines.The epitopes of the GTV Gc protein obtained in this study can serve as fundamental data for future research works aimed at elucidating the immunological properties of the GTV glycoproteins and for developing multi-epitope diagnostic reagents and vaccines. (PDF) Click here for additional data file. 18 May 2021 PONE-D-21-02919 Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus PLOS ONE Dear Dr. Sun, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Jul 02 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at  https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols . We look forward to receiving your revised manuscript. Kind regards, Florian Krammer, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: [ This work was supported by Science Foundation of China (No.81690369,81760365 to S.R.S.), and the Science Research Key Project of Xinjiang Education Department (No.XJEDU2019I002 to S.R.S.).The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. ] We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: [This work was supported partly by grants from the National Natural Science.] Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed: - https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0223978 - https://pubmed.ncbi.nlm.nih.gov/31618247/ The text that needs to be addressed involves the Results section. In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Yusufu et al describe linear BCEs of the Guertu virus Gc proteins using polyclonal serum they generated in animals. While the work done is important, there is not much relevance to the real world and infection in humans. The authors did find BCEs which is not surprising because the serum was polyclonal. In addition, numerous studies are needed to see if neutralization is crucial at these epitopes or not. The authors should discuss in detail in the discussion section how their work will lead to new discoveries in the field and how they will move forward. How does this work relate to vaccine design? What are the lessons learned? Line 74: The authors should discuss if this virus is a BSL2 or BSL3 pathogen and the limitations that exist in studying this virus in the labLine 89: The authors should discuss receptors for entry and other entry factors known. Line 90: It is unclear for a naive reader whether its Gc or Gn that mediates fusion or entry?Line 100-112: Discussion of methodology used seems excessive. It may be easier to just discuss the benefits of the approach used in the paper. Line 130: Since this method only allows for elucidation of linear BCEs, are the authors concerned that the majority of the novel neutralizing epitopes may be overlooked? A proper folded and stable glycoprotein is key to eliciting neutralizing antibodies in terms of vaccine design. Line 432: Does disease caused by the virus vary from person to person? Reviewer #2: Yusufu M et. al provided a study on fine epitope mapping of the Gc glycoprotein of Guertu virus. They were able to identify 13 B-cell epitopes, of whom 7 could be recognized by GTV IgG positive sheep sera. Moreover, they could show that BCE´s motifs are highly conserved among 10 SFTSV strains from different countries and lineages. Altogether, this study is an interesting work on elucidation of immunologic properties of GTV glycoproteins and expands the knowledge in this field. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 1 Jul 2021 Reviewer #1: Yusufu et al describe linear BCEs of the Guertu virus Gc proteins using polyclonal serum they generated in animals. While the work done is important, there is not much relevance to the real world and infection in humans. The authors did find BCEs which is not surprising because the serum was polyclonal. In addition, numerous studies are needed to see if neutralization is crucial at these epitopes or not. The authors should discuss in detail in the discussion section how their work will lead to new discoveries in the field and how they will move forward. How does this work relate to vaccine design? What are the lessons learned? Response: Thanks for the good remind. Since GTV is a virus that requires BSL2 laboratory operation, the use of attenuated vaccine in vaccine design may cause biosafety risks, and GTV glycoprotein Gn and Gc are large and can not be expressed in tandem, it is difficult to operate in vaccine design. The epitope of GTV Gn has also been identified, the B cell linear epitopes on Gn and Gc may be the epitope recognized by GTV neutralizing antibody. In that case, we will make a safe and convenient multi-epitope vaccine that easy to operate all the B cell linear epitopes after tandem expression. It can be used as a new target for GTV vaccine design. Line 74: The authors should discuss if this virus is a BSL2 or BSL3 pathogen and the limitations that exist in studying this virus in the lab Line 89: The authors should discuss receptors for entry and other entry factors known. Response: Thanks for the good remind. This virus is a BSL2 pathogen and the limitations that exist in studying this virus in the lab. According to your suggestion, we added “At present, the virus cell receptor binding domain of SFTSV, which is most closely related to GTV evolution, is located on glycoprotein Gc [11]. DC-SIGN has been identified as the receptor factor on the host cell membrane [12]. Some studies have also shown that HS and NMMHC-IIA may also be the entry factors related to cell entry of SFTSV [13].” in the introduction on section in Line 65-68. Line 90: It is unclear for a naive reader whether its Gc or Gn that mediates fusion or entry?Line 100-112: Discussion of methodology used seems excessive. It may be easier to just discuss the benefits of the approach used in the paper. Response: Thanks for the kind remind and suggestion.At present, the virus cell receptor binding domain of SFTSV, which is most closely related to GTV evolution, is located on glycoprotein Gc. According to your suggestion, we deleted other methods for identifying B cell epitopes that are not related to this study from the original manuscript, and we just discuss the benefits of the approach used in the paper. Line 130: Since this method only allows for elucidation of linear BCEs, are the authors concerned that the majority of the novel neutralizing epitopes may be overlooked? A proper folded and stable glycoprotein is key to eliciting neutralizing antibodies in terms of vaccine design. Response: Thanks for the good remind. Improved BSP method adopted is only suitable for screening simple linear epitopes. In the future, peptide microarray high-throughput screening, mass spectrometry, and other techniques may be necessary to identify conformational epitopes in order to avoid missing the detection of specific epitopes of SFTSV and GTV that could be used to distinguish the two viruses. Line 432: Does disease caused by the virus vary from person to person? Response: Thanks for the kind remind. There is no case of GTV infection, but the genetic relationship between GTV and SFTSV is similar in Philadelphia. It is predicted that the disease caused by GTV may have symptoms similar to SFTSV. Reviewer #2: Yusufu M et. al provided a study on fine epitope mapping of the Gc glycoprotein of Guertu virus.They were able to identify 13 B-cell epitopes, of whom 7 could be recognized by GTV IgG positive sheep sera.Moreover, they could show that BCE´s motifs are highly conserved among 10 SFTSV strains from different countries and lineages.Altogether, this study is an interesting work on elucidation of immunologic properties of GTV glycoproteins and expands the knowledge in this field. 29 Nov 2021
PONE-D-21-02919R1
Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus
PLOS ONE Dear Dr. Sun, Thank you for submitting your revised manuscript to PLOS ONE. We invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== We have tried to contact the reviewers who reviewed the original version of your manuscript in the past weeks. However, after many attempts, we failed to get their responses. We were unable to obtain additional reviewers to review your revised manuscript. This happens these days during the pandemic, a difficult time for many, and we apologize for the delayed process of your revised manuscript. There are several issues to be addressed: In your point-by-point response to reviewer’s comments, you need to indicate whether you’ve revised your manuscript accordingly, and how and where. Expression for lack of epitope response in sheep serum: Amino acid sequences of B-cell epitopes are not universal among species. Epitopes need to be processed by proteases and recognized by the MHC complex for presentation to the surface of cell membrane in antigen presenting cells. Differences in protease processing and MHC presentation of antigen epitopes (either B or T cell epitope) exist naturally among different species of animals. Your explanation does not make much sense (Lines 279-81). Figure 7 & 8 are missing. Somehow we can’t find them. Carefully edit the manuscript to remove errors in spelling, expression, and gramma. Minor Issues: There are many errors with spelling, expression, or English gramma. These errors need to be corrected. Please carefully edit the manuscript before resubmission. For example: Line 66: “… which is most closely related to GTV 66 evolution” Line 77: “… are as no…” Line 144: “…the GTV Gc protein was designed as fifty-seven 16-mer peptides…” Line 208: 16mer-peptide or 16mer peptide, with or without hyphen? Be consistent in the text and all figure legends. Please check. Line 209: SDS-PAGE gel electrophoresis: GE in PAGE represents gel electrophoresis, No need to repeat. Correct this in all figure legends. Please check. Line 210: blue.M :You need a space between the two words (letters). There are several other places with similar spelling errors in the text or figure legends. Please check. Line 212: Western blot (212), Western blotting (213, 214), western blot analysis (221), or western blotting analysis (269)? Be consistent in the text and all figure legends. Please check. Line 209: What is r-clone? Line 253: EGc11 and EGc12 should not have the same aa numbers from 230 to 237. Line 259: expressed10mer-peptides Line 259: “It indicates each short peptide for numbers 10mer…” Correct expression? ============================== Page numbers must be inserted on each page for submitted manuscripts. Please submit your revised manuscript by Jan 13 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Zheng Xing Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 29 Dec 2021 1.In your point-by-point response to reviewer’s comments, you need to indicate whether you’ve revised your manuscript accordingly, and how and where. Expression for lack of epitope response in sheep serum: Amino acid sequences of B-cell epitopes are not universal among species. Epitopes need to be processed by proteases and recognized by the MHC complex for presentation to the surface of cell membrane in antigen presenting cells. Differences in protease processing and MHC presentation of antigen epitopes (either B or T cell epitope) exist naturally among different species of animals. Your explanation does not make much sense (Lines 279-81). Response: Sorry, a paragraph in lines 279-281 is not accurate enough and has been deleted. The specific amendments are as follows: the Western blot results showed that there was a good consistency between the immune response of rabbit and sheep to GTV GC protein. 2.Figure 7 & 8 are missing. Somehow we can’t find them. Response: Thanks for the good remind. Figure 7 & 8 have been attached to files. 3.Carefully edit the manuscript to remove errors in spelling, expression, and gramma. Response: Thanks for the suggestion. We have removed all errors in the Manuscript. For example, "fifine" revised as "fine" in line 77, "immunedominant" revised as " immunodominant" in line 266, and so on. Minor Issues: 1.There are many errors with spelling, expression, or English gramma. These errors need to be corrected. Please carefully edit the manuscript before resubmission. For example: Line 66: “… which is most closely related to GTV 66 evolution” Response: Thanks, we have rewritten “which is most closely related to GTV 66 evolution” as “At present, the virus cell receptor binding domain of SFTSV is located on glycoprotein Gc” in line 65 in the revised manuscript. Line 77: “… are as no…” Response: Thanks, we have rewritten this sentence in line 77 of the revised manuscript. Line 144: “…the GTV Gc protein was designed as fifty-seven 16-mer peptides…” Response: Thanks, we have rewritten “The GTV Gc protein was truncated into fifty-seven 16mer-peptides using modifified overlapping peptide biosynthesis” as “The GTV Gc protein was designed into fifty-seven 16mer-peptides using modified overlapping peptide biosynthesis” in line 143 of the revised manuscript. Line 208: 16mer-peptide or 16mer peptide, with or without hyphen? Be consistent in the text and all figure legends. Please check. Response: Thanks, we have changed all “16/10/8mer peptide” as “16/10/8mer-peptide” in the manuscript to with hyphen. Line 209: SDS-PAGE gel electrophoresis: GE in PAGE represents gel electrophoresis, No need to repeat. Correct this in all figure legends. Please check. Response: Thanks, we have deleted gel electrophoresis, and revised all the “SDS-PAGE gel electrophoresis” as “SDS-PAGE” in the manuscript. Line 210: blue.M : You need a space between the two words (letters). There are several other places with similar spelling errors in the text or figure legends. Please check. Response: Spaces have been added and the whole manuscript been checked and corrected. For example, " blue.M " revised as " blue. M " in line 210, " bufferedsaline " revised as " buffered saline " in line 180, and so on. Line 212: Western blot (212), Western blotting (213, 214), western blot analysis (221), or western blotting analysis (269)? Be consistent in the text and all figure legends. Please check. Response: Thanks, all Western blot (212), Western blotting (213, 214), western blot analysis (221), or western blotting analysis (269) in the manuscript has been unified as “Western blot analysis”. Line 209: What is r-clone? Response: Thanks for the good reminding, “r-clone” revised as “recombinant clone” in lines 207, 234, and 258 in the revised manuscript. Line 253: EGc11 and EGc12 should not have the same aa numbers from 230 to 237. Response: Thanks, “EGc11 (230QAGMGVVG237), and EGc12 (230RSHDSQGKIS237)” revised as “EGc11 (230QAGMGVVG237), and EGc12 (303RSHDSQGKIS312)” in line 251 in the revised manuscript. Line 259: expressed10mer-peptides Response: Thanks, “expressed10mer peptides” revised as “expressed 10mer-peptides” with hyphen on line 257 in the revised manuscript. Line 259: “It indicates each short peptide for numbers 10mer…” Correct expression? Response: Thanks, we have rewritten “SDS-PAGE analysis of expressed 10mer peptides. It indicates each 10mer peptide for numbesr P3, P8, P10, P29 and P38” as “SDS-PAGE analysis of expressed 10mer-peptides for P3, P8, P10, P29 and P38” in line 257 of the revised manuscript. 2. Page numbers must be inserted on each page for submitted manuscripts. Response: We have been inserted on each page for submitted manuscripts. Submitted filename: Response to Reviewers.docx Click here for additional data file. 19 May 2022
PONE-D-21-02919R2
Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus
PLOS ONE Dear Dr. Sun, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
 
Your manuscript and responses to previous comments have been critically assessed by academic editor. 
 
Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. Specific comments: Major comments In Discussion, authors should clearly describe the limitations of presented study, which identified only linear epitopes of Gc proteins. It should include (1) current study does not predict B cell epitopes affected by different MHC haplotypes, (2) the mechanism of virus neutralization via Gc proteins remains unknown, and (3) the neutralizing role via identified linear epitopes of Gc proteins has not been characterized. Minor comments Line 21 to 22: Gc proteins are shielded by Gn protein in virions. Gn protein is responsible to receptor binding, while Gc protein serves as a fusion protein upon entry with low pH in endosomes. Although Gc proteins encode neutralizing epitope, authors should describe the role of Gc accurately with appropriate citations. Line 47: “tick bite-transmitted” should be “tick-borne”. Line 49: “Research studies on..” should be “Studies on..” Line 55: “The researchers” should be “Researchers” Line 60 – 61: Gn and Gc proteins are considered to be cleaved co-translationally, but not post-translationally. Line 65: “At present, the virus cell receptor binding domain of SFTSV is located on glycoprotein Gc [11].” This description is not supported by cited reference. Line 78 – 98: This paragraph describes the method for this study, which is a standard strategy to test overlapped peptides as fusion recombinants with GST. Therefore, this paragraph should be removed from introduction section. Line 100: “using the improved BSP strategy and rabbit anti-GTV-Gc pAbs” should be written as “using biosynthetic peptide (BSP) methods (Ref) and rabbit anti-GTV-Gc pAbs”. Line 80: “The BSP method developed by Xu et al. in 2009 was created for the…” should be “The BSP method developed by Xu et al. in 2009 was used for the…” Line 81 – 82: “the research group led by Xu Wanxiang successfully improved upon their method to conduct fine mapping..” should be “the same research group successfully mapped linear…” Line 111 – 113: “The animal serum samples were collected using a random sampling method that did not involve sacrifice of the animals [15].” This description should clarify the following point: “serum collection was performed according to this approved animal protocol.” Line 114: “Vectors, strains and antibodies” section requires to be separated: “Plasmids”, and “Antibodies”. PDVF membrane or ECL explanations should be moved to western blot section. “Plasmids” section should combine “Construction of the truncated Gc fragments for recombinant plasmid expression (line 129 – 137). Line 116: “GenBank accession no. ALQ33264.1” is for protein sequence. It should be GenBank accession no. KT328592.1 (same with line 131). Line 119: Authors should define “Gc1 and Gc2” at their first occurrence in text. Line 120 – 121: ” Taq DNA polymerase, DNA marker, and T4 ligase (TaKaRa Co., Ltd, Dalian, China)”. This partial sentence should be corrected. Line 120: “License number” may be removed from the text. Line 152 – 167: “Construction” of plasmid should be combined to “Plasmid” section. Line 166: “Heat induction at 45°C was then conducted for another 4 h.” This description requires a citation to justify the protein induction via pET plasmid in BL21 by changing incubation temperature to 45°C, rather than using standard induction using IPTG. Line 173 – 174: “The strains expressing the correct protein size were provided to Shanghai Sangon for sequencing and strain preservation.” Authors should clarify the meaning of sentence: e.g., strains? Strain preservation? Line 216 and 243: “To identify the minimal antigenic epitopes” should be written as “To identify the minimal linear antigenic epitopes”. Line 237: Although text indicated that this analysis shows 8-mer peptides, whereas the legend explains that B, D, F, and H are 16-mer peptides. Authors should provide further clarification. Line 313 – 315: “In future, serological….” This sentence should be removed from Result section. Line 340: “Bunyaviruses are the largest family of RNA viruses…” should be corrected: e.g., “family Bunyaviridae” no longer exists. Line 350 – 351: “could cause murine viremia, organopathological changes, and murine lesions,…” should be “could cause viremia or organopathological changes,…” Line 396: Use of monoclonal antibody panels for SFTSV and GTV will likely map the distinct epitopes. Please submit your revised manuscript by Jul 03 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Tetsuro Ikegami Academic Editor PLOS ONE [Note: HTML markup is below. Please do not edit.] Reviewers' comments: [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 20 Jun 2022 1.In Discussion, authors should clearly describe the limitations of presented study, which identified only linear epitopes of Gc proteins. It should include (1) current study does not predict B cell epitopes affected by different MHC haplotypes, (2) the mechanism of virus neutralization via Gc proteins remains unknown, and (3) the neutralizing role via identified linear epitopes of Gc proteins has not been characterized. Response: Thanks for the good remind. In the Discussion section we describe in detail the limitations of this study, and described in lines 394-397 as “Among study limitations, this study only identified linear epitopes of the Gc protein. Also, there are currently no B cell epitopes predicted to be affected by different MHC haplotypes. The mechanism of virus neutralization by anti-Gc protein antibodies remains unknown, and neutralization through identified linear epitopes of Gc protein has not been characterized.” 2.Line 21 to 22: Gc proteins are shielded by Gn protein in virions. Gn protein is responsible to receptor binding, while Gc protein serves as a fusion protein upon entry with low pH in endosomes. Although Gc proteins encode neutralizing epitope, authors should describe the role of Gc accurately with appropriate citations. Response: Thanks for the good remind. We have added corresponding references in lines 21-25. 3.Line 47: “tick bite-transmitted” should be “tick-borne”. Response: Thanks for the suggestion. We have revised “tick bite-transmitted” as "tick-borne" in line 47. 4.Line 49: “Research studies on..” should be “Studies on..” Response: Thanks, we have rewritten “Research studies on” as “Studies on” in line 49 in the revised manuscript. 5.Line 55: “The researchers” should be “Researchers” Response: Thanks, we have rewritten “The researchers” as “Researchers” in line 55 in the revised manuscript. 6. Line 60–61: Gn and Gc proteins are considered to be cleaved co-translationally, but not post-translationally. Response: Thanks, we have revised “M segment that encodes a glycoprotein precursor that is cleaved into two mature envelope proteins (Gn and Gc) during  post-translationally modification” as “M segment that encodes a glycoprotein precursor that is cleaved into two mature envelope proteins (Gn and Gc) during co-translational modification” in line 60–61 of the revised manuscript. 7. Line 65: “At present, the virus cell receptor binding domain of SFTSV is located on glycoprotein Gc [11].” This description is not supported by cited reference. Response: Thanks, we have added other related referencs in the revised manuscript. 8.Line 78 – 98: This paragraph describes the method for this study, which is a standard strategy to test overlapped peptides as fusion recombinants with GST. Therefore, this paragraph should be removed from introduction section. Line 100: “using the improved BSP strategy and rabbit anti-GTV-Gc pAbs” should be written as “using biosynthetic peptide (BSP) methods (Ref) and rabbit anti-GTV-Gc pAbs”. Response: Thanks for the good suggestion, we have removed the description “The BSP method had the following features: (1) By selecting the truncated GST188 protein as the fusion tag for the recombinant expression of short peptides, the fragment size of the expressed fusion peptide was maintained within 21.5-22.5 kDa, which allowed its easy identification by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and subsequent western blot analysis. This also facilitated the easy distinction of the short peptides from the proteins expressed by the host (Escherichia coli); (2) The antigenic proteins were first divided into 16mer-peptides with eight overlapping amino acid residues, following which basic and complete screening was performed for those containing BCEs; (3) Further truncation of the positive 16mer-peptides into 8mer-peptides with seven overlapping amino acid residues allowed the precise determination of the minimal epitope motif for each linear BCE [15].”, and put it in the methods section under “Strategy for designing GTV Gc overlapping peptides”. And “using the improved BSP strategy and rabbit anti-GTV-Gc pAbs” rewritten as “using biosynthetic peptide (BSP) methods and rabbit anti-GTV-Gc pAbs” in lines 80–90 in the manuscript. 9.Line 80: “The BSP method developed by Xu et al. in 2009 was created for the…” should be “The BSP method developed by Xu et al. in 2009 was used for the…”. Response: Tanks, we revised as " The BSP method developed by Xu et al. in 2009 was created for the…” as “The BSP method developed by Xu et al. in 2009 was used for the” in line 80. 10.Line 81–82: “the research group led by Xu Wanxiang successfully improved upon their method to conduct fine mapping..” should be “the same research group successfully mapped linear…”. Response: Thanks, we revised “the research group led by Xu Wanxiang successfully improved upon their method to conduct fine mapping..” as “the same research group successfully mapped linear…”in line 81-82. 11.Line 111 – 113: “The animal serum samples were collected using a random sampling method that did not involve sacrifice of the animals [15].” This description should clarify the following point: “serum collection was performed according to this approved animal protocol.” Response: Thanks for the good reminding, we added “serum collection was performed according to this approved animal protocol.” in “Ethical statement” section in line 103 in the revised manuscript. 12.Line 114: “Vectors, strains and antibodies” section requires to be separated: “Plasmids”, and “Antibodies”. PDVF membrane or ECL explanations should be moved to western blot section. “Plasmids” section should combine “Construction of the truncated Gc fragments for recombinant plasmid expression (line 129 – 137). Response: Thanks, the “Vectors, strains and antibodies” section was separated as “Antibodies” and other method section, “Plasmids” section was combined with “Construction of the truncated Gc fragments for recombinant plasmid expression” (line 113-116) in the revised manuscript. 13.Line 259: Line 116: “GenBank accession no. ALQ33264.1” is for protein sequence. It should be GenBank accession no. KT328592.1 (same with line 131). Response: Thanks, we revised the GenBank accession no as “KT328592.1” line 114 in the revised manuscript. 14.Line 119: Authors should define “Gc1 and Gc2” at their first occurrence in text. Response: Thanks, we have defined “Gc1 and Gc2” as “Gc1 (aa 1-291) and Gc2 (aa 252-549) ” in line 105 of the revised manuscript. 15. Line 120-121: “Taq DNA polymerase, DNA marker, and T4 ligase (TaKaRa Co., Ltd, Dalian, China)”. This partial sentence should be corrected. Response: We have corrected the description in the methods section in manuscripts. 16. Line 120: “License number” may be removed from the text. Response: We have removed from the manuscripts. 17. Line 152-167: “Construction” of plasmid should be combined to “Plasmid” section. Response: We have constructed “Plasmid” with “Construction of the truncated Gc fragments for recombinant plasmid expression” in lines 113-116 in revised manuscript. 18. Line 166: “Heat induction at 45°C was then conducted for another 4 h.” This description requires a citation to justify the protein induction via pET plasmid in BL21 by changing incubation temperature to 45℃, rather than using standard induction using IPTG. Response: We have revised the induction temperature “45℃” as “42℃” in lines 160 and 194 in revised manuscript. However, thermal induction was for pXXGST-3 plasmid, not pET plasmid.We have added the corresponding reference in line 161. 19. Line 173-174:“The strains expressing the correct protein size were provided to Shanghai Sangon for sequencing and strain preservation.” Authors should clarify the meaning of sentence: e.g., strains? Strain preservation? Response: We have revised “The strains expressing the correct protein size were provided to Shanghai Sangon for sequencing and strain preservation” as “The plasmids expressing the correct protein size were send to Shanghai Sangon for sequencing” in lines 167-168 in revised manuscript. 20. Line 216 and 243: “To identify the minimal antigenic epitopes” should be written as “To identify the minimal linear antigenic epitopes”. Response: We have revised “To identify the minimal antigenic epitopes” as “To identify the minimal linear antigenic epitopes” in line 211 in revised manuscript. 21. Line 237: Although text indicated that this analysis shows 8-mer peptides, whereas the legend explains that B, D, F, and H are 16-mer peptides. Authors should provide further clarification. Response: Thanks for the good remind. We have corrected “16-mer peptides” as “8-mer peptides” in line 232 in revised manuscript. 22. Line 313-315: “In future, serological….” This sentence should be removed from Result section. Response: Thanks for the good remind. We have removed the prescription “In the future, serological validation of GTV should be conducted to investigate whether these epitopes are specific to this virus and whether they can be used to detect SFTSV and GTV antibodies or to design broad-spectrum vaccines.” to lines 394-397 in revised manuscript. 23. Line 340: “Bunyaviruses are the largest family of RNA viruses…” should be corrected: e.g., “family Bunyaviridae” no longer exists.. Response: Thanks for the good remind. We have revised “Bunyaviruses are the largest family of RNA viruses” as “Bunyavirales are the largest order of RNA viruses” in line 333 in revised manuscript. 24. Line 350-351: “could cause murine viremia, organopathological changes, and murine lesions,…” should be “could cause viremia or organopathological changes,…”. Response: Thanks for the good remind. We have revised “could cause murine viremia, organopathological changes, and murine lesions” as “could cause viremia or organopathological changes” in lines 343-344 in revised manuscript. 25. Line 396: Use of monoclonal antibody panels for SFTSV and GTV will likely map the distinct epitopes. Response: Thanks for the good remind. We have revised the conscription in line 396 according to the comments in revised manuscript. Submitted filename: Response to reviewers.docx Click here for additional data file. 21 Jun 2022
PONE-D-21-02919R3
Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus
PLOS ONE Dear Dr. Sun, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Specific points: Line 22 (Abstract), and line 65 (text): Ref. 10 and 12: No experiments showed that SFTS Gc itself can bind to receptor molecules. Ref 11: Although N-glycosylation sites in Gc protein were described, the functional roles in receptor-mediated entry are speculative. Thus, there is no clear evidence to describe that “virus cell receptor binding domain of SFTSV is located on glycoprotein Gc”.  If authors just describe “N-glycosylation sites is located on SFTSV Gc glycoproteins”, and their hypothetical roles is argued, it might be fine. Glycosylation of proteins plays a role in protein folding and Golgi trafficking, which also supports virus maturation/assembly process. Line 81-82: “More recently, the same research group successfully mapped linear of the linear BCEs of three structural proteins…” needs to be corrected. Line 349: Authors should also mention viral fusion, which is a major role of Gc proteins. Others: It should be clarified whether N-glycosylation sites of SFSTV Gn and Gc have been demonstrated (requiring citations) or still presumptive. If it has not been shown, all description should be written as “presumable N-glycosylation sites”.
Please submit your revised manuscript by Aug 05 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Tetsuro Ikegami Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
4 Jul 2022 1.Line 22 (Abstract), and line 65 (text): Ref. 10 and 12: No experiments showed that SFTS Gc itself can bind to receptor molecules. Ref 11: Although N-glycosylation sites in Gc protein were described, the functional roles in receptor-mediated entry are speculative. Thus, there is no clear evidence to describe that “virus cell receptor binding domain of SFTSV is located on glycoprotein Gc”.  If authors just describe “N-glycosylation sites is located on SFTSV Gc glycoproteins”, and their hypothetical roles is argued, it might be fine. Glycosylation of proteins plays a role in protein folding and Golgi trafficking, which also supports virus maturation/assembly process. Response: Thanks for the good remind. Indeed, there is no report proving that there is SFTSV cell receptor binding region on GC. According to your suggestion, we have revised “The viral glycoprotein Gc” as "The viral glycoprotein (GP) " in Line 22 (Abstract), and revised “the virus cell receptor binding domain of SFTSV is located on glycoprotein Gc” as “presumable N-glycosylation sites is located on SFTSV Gc glycoproteins” in line 65 (text). 2.Line 81-82: “More recently, the same research group successfully mapped linear of the linear BCEs of three structural proteins…” needs to be corrected. Response: Thanks for the good remind. We have rewritten “More recently, the same research group successfully mapped linear of the linear BCEs of three structural proteins…” as “and they successfully mapped linear of the linear BCEs of three structural proteins” in line 81. 3.Line 349: Authors should also mention viral fusion, which is a major role of Gc proteins. Response: Thanks for the suggestion. Virtual fusion has been added to the manuscript (line 348). 4.Others: It should be clarified whether N-glycosylation sites of SFSTV Gn and Gc have been demonstrated (requiring citations) or still presumptive. If it has not been shown, all description should be written as “presumable N-glycosylation sites”. Response: Thanks for the suggestion. We have rewritten as “presumable N-glycosylation sites” in line 65. Submitted filename: Response to Reviewers.docx Click here for additional data file. 11 Jul 2022 Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus PONE-D-21-02919R4 Dear Dr. Sun, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Tetsuro Ikegami Academic Editor PLOS ONE Additional Editor Comments: A few more points are noted for authors' corrections of English sentences before acceptance. Line 81: “linear of the linear BCE” should be corrected. Line 348: “the envelope glycoproteins are responsible for the binding and fusion of the virus particles to cellular receptors and play a protective role in passive immunization” Fusion does not occur to cellular receptors. Therefore, this sentence should be corrected: “….the binding of the virus particles to cellular receptors and subsequent viral fusion.”  “play a protective role in passive immunization” is redundant to the “Studies have shown that viral glycoproteins are the targets of neutralizing antibodies”, and can be deleted. Reviewers' comments: 14 Jul 2022 PONE-D-21-02919R4 Fine mapping of the antigenic epitopes of the Gc protein of Guertu virus Dear Dr. Sun: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Tetsuro Ikegami Academic Editor PLOS ONE
  39 in total

Review 1.  Mapping the epitopes of antibodies.

Authors:  Robert C Ladner
Journal:  Biotechnol Genet Eng Rev       Date:  2007

2.  GOR method for predicting protein secondary structure from amino acid sequence.

Authors:  J Garnier; J F Gibrat; B Robson
Journal:  Methods Enzymol       Date:  1996       Impact factor: 1.600

3.  Fine mapping epitope on glycoprotein-Gn from Crimean-Congo hemorrhagic fever virus.

Authors:  Alai Shalitanati; Huan Yu; Dongliang Liu; Wan-Xiang Xu; Xihong Yue; Rong Guo; Yijie Li; Fei Deng; Jianhua Yang; Yujiang Zhang; Surong Sun
Journal:  Comp Immunol Microbiol Infect Dis       Date:  2018-09-11       Impact factor: 2.268

Review 4.  Current approaches to fine mapping of antigen-antibody interactions.

Authors:  W Mark Abbott; Melissa M Damschroder; David C Lowe
Journal:  Immunology       Date:  2014-08       Impact factor: 7.397

Review 5.  Prediction of the secondary structure of proteins from their amino acid sequence.

Authors:  P Y Chou; G D Fasman
Journal:  Adv Enzymol Relat Areas Mol Biol       Date:  1978

Review 6.  The ecology of ticks and epidemiology of tick-borne viral diseases.

Authors:  Agustín Estrada-Peña; José de la Fuente
Journal:  Antiviral Res       Date:  2014-06-09       Impact factor: 5.970

7.  Replication and transcription of eukaryotic DNA in Escherichia coli.

Authors:  J F Morrow; S N Cohen; A C Chang; H W Boyer; H M Goodman; R B Helling
Journal:  Proc Natl Acad Sci U S A       Date:  1974-05       Impact factor: 11.205

8.  Structure of a phleboviral envelope glycoprotein reveals a consolidated model of membrane fusion.

Authors:  Steinar Halldorsson; Anna-Janina Behrens; Karl Harlos; Juha T Huiskonen; Richard M Elliott; Max Crispin; Benjamin Brennan; Thomas A Bowden
Journal:  Proc Natl Acad Sci U S A       Date:  2016-06-20       Impact factor: 11.205

Review 9.  Emerging phleboviruses.

Authors:  Richard M Elliott; Benjamin Brennan
Journal:  Curr Opin Virol       Date:  2014-02-28       Impact factor: 7.090

10.  Fine level epitope mapping and conservation analysis of two novel linear B-cell epitopes of the avian infectious bronchitis coronavirus nucleocapsid protein.

Authors:  Zongxi Han; Fei Zhao; Yuhao Shao; Xiaoli Liu; Xiangang Kong; Yang Song; Shengwang Liu
Journal:  Virus Res       Date:  2012-11-02       Impact factor: 3.303

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.