Literature DB >> 35877653

The central role of arginine in Haemophilus influenzae survival in a polymicrobial environment with Streptococcus pneumoniae and Moraxella catarrhalis.

Alexandra Tikhomirova1, Peter S Zilm2, Claudia Trappetti1, James C Paton1, Stephen P Kidd1,3.   

Abstract

Haemophilus influenzae, Streptococcus pneumoniae and Moraxella catarrhalis are bacterial species which frequently co-colonise the nasopharynx, but can also transit to the middle ear to cause otitis media. Chronic otitis media is often associated with a polymicrobial infection by these bacteria. However, despite being present in polymicrobial infections, the molecular interactions between these bacterial species remain poorly understood. We have previously reported competitive interactions driven by pH and growth phase between H. influenzae and S. pneumoniae. In this study, we have revealed competitive interactions between the three otopathogens, which resulted in reduction of H. influenzae viability in co-culture with S. pneumoniae and in triple-species culture. Transcriptomic analysis by mRNA sequencing identified a central role of arginine in mediating these interactions. Arginine supplementation was able to increase H. influenzae survival in a dual-species environment with S. pneumoniae, and in a triple-species environment. Arginine was used by H. influenzae for ATP production, and levels of ATP generated in dual- and triple-species co-culture at early stages of growth were significantly higher than the combined ATP levels of single-species cultures. These results indicate a central role for arginine-mediated ATP production by H. influenzae in the polymicrobial community.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35877653      PMCID: PMC9312370          DOI: 10.1371/journal.pone.0271912

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Otitis media (OM) is one of the most prevalent paediatric diseases, affecting 80% of children before the age of 3 [1]. OM frequently manifests as a chronic or recurrent infection [2], where conventional treatments such as antibiotic therapies [3], and tympanostomy tube placement [4] are often ineffective. The most common aetiologic agents of OM are the bacterial species Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis [5]. It is common that these species are present in the middle ear as a polymicrobial infection or in a polymicrobial biofilm [5,6]. They also regularly co-colonise the nasopharynx asymptomatically [7]. Concurrent carriage of all three pathogens has also been associated with clinical pneumonia [8]. We have previously identified the potential for both synergistic and competitive interactions between S. pneumoniae and H. influenzae in a dual-species polymicrobial environment, with the outcome of the interactions governed by environmental conditions, and characterised by a specific transcriptomic response [9,10]. However, the interactions between all three species, and the molecular aspects governing these interactions, have not been well defined [11], with current data showing both positive and negative interaction outcomes. M. catarrhalis colonisation in children has been positively correlated to colonisation with H. influenzae [12], and another study has displayed positive associations of S. pneumoniae colonisation with co-colonisation by M. catarrhalis or H. influenzae [13]. However, a negative association between H. influenzae and S. pneumoniae has been reported during clinical studies of upper respiratory tract infection [14,15]. In addition, clinical studies have shown strain specificity to affect inter-species interactions [16], as well as significant variation in inter-species associations and species abundance between anatomical sites [5]. In a mouse colonisation model, co-infection of S. pneumoniae with M. catarrhalis was found to influence OM more significantly in comparison to co-infection of S. pneumoniae with H. influenzae [17]. In the context of antibiotic resistance of OM, M. catarrhalis has been shown to protect amoxicillin-susceptible H. influenzae and S. pneumoniae [18]. However, S. pneumoniae has also been shown to inhibit M. catarrhalis growth in a manner dependent on H2O2 and bacteriocin production [19]. The current study aims to elucidate the interactions between H. influenzae, S. pneumoniae and M. catarrhalis, and to assess the transcriptomic response of H. influenzae to growth in a triple-species co-culture with S. pneumoniae and M. catarrhalis.

Materials and methods

Bacterial growth and storage

All bacterial strains were stored at -80°C in 30% glycerol. For all assays the H. influenzae isolate 86-028NP from the nasopharynx of a pediatric patient with OM, or laboratory strain Rd KW20, S. pneumoniae serotype 3 OM middle ear isolate strain 11, and M. catarrhalis reference strain QC (23240) obtained from SA Pathology laboratory (originating from a lung infection) were used for analyses. H. influenzae was grown on heart infusion (HI) agar plates supplemented with 10% levinthals, S. pneumoniae was pre-cultured on blood agar plates and M. catarrhalis was pre-cultured on HI agar supplemented with 5% defibrinated horse blood [9]. For pre-culture, all three bacterial species were grown until mid-log phase. H. influenzae was cultured in 10 mL of HI medium supplemented with 10 μg/mL hemin and 2 μg/mL β-NAD, with shaking at 100 rpm. M. catarrhalis was pre-cultured in 5 mL HI media supplemented with hemin and β-NAD, as above. S. pneumoniae was pre-cultured HI media supplemented with hemin and β-NAD statically [10].

Growth analysis

HI media supplemented with hemin and β-NAD and, where specified, adjusted to pH 8, or unadjusted (pH 7) was used for growth analyses. Cultures were grown until mid-log phase for each species (OD600 = 0.2–0.25 for H. influenzae, 0.25 for S. pneumoniae and 0.2 for M. catarrhalis). Mono-culture, dual-culture and triple-culture inoculums contained 1/20 dilution of each species [20]. Cultures were grown statically in a 96-well microtitre plate. After 18 h of growth, mono- and co-cultures were collected, and plated onto HI agar or selective blood agar plates containing gentamicin (selecting for S. pneumoniae) at a concentration of 5 μg/mL, bacitracin (selecting for H. influenzae) at a concentration of 300 μg/mL, and HI agar supplemented with blood and vancomycin at a concentration of 3 μg/mL (selecting for M. catarrhalis). All growth assays were performed in triplicate.

Growth analysis with arginine

To assess H. influenzae growth with arginine, H. influenzae was inoculated into 10 mL of HI media containing no supplemented arginine or supplemented with an additional 2 or 4 g/L L-arginine (Sigma). The pH of the media with and without arginine was adjusted to pH 8 or 7 as specified, and cultures were grown statically or with shaking at 100 rpm for 18 h. For growth analysis OD600 was measured every 30 min for 18h on a SPECTRAmax spectrophotometer (Molecular Devices).

ATP production assay

ATP production was measured using the BacTiter-Glo Microbial Cell Viability Assay (Promega, Australia). To measure H. influenzae ATP production in the absence and presence of arginine, H. influenzae 86-028NP was pre-cultured to mid-log phase. Subsequently, the pre-culture was inoculated in a 1/20 dilution into 5 mL of HI media with 0, 2, 4 or 6 g/L arginine. Every 15 min, 50 μL of the culture was added to 50 μL of the BacTiter Glo reagent in a white 96-well plate, and luminescence was measured on the Synergy HTX Spectrophotometer (Biotek). OD600 of the culture was concurrently measured to ensure ATP production was not related to growth. ATP production in single-species, dual-species and triple-species cultures was also measured using BacTiter-Glo Microbial Cell Viability Assay on the PHERAstar Spectrophotometer. Cultures were inoculated for 2h, following which ATP production was measured. Cultures were concurrently plated on selective media to ensure ATP production was unrelated to growth.

Intracellular pH assay

Intracellular pH was determined using the pH sensitive dye BCECF-AM (Invitrogen) using a protocol established for measuring intracellular pH in bacteria [21]. Cells were resuspended in PBS containing 1 μM BCECF-AM, followed by 30 min incubation at 37°C [21], washed in PBS to remove extracellular dye, and subsequently resuspended in 5 mL PBS. Fluorescence was measured using an excitation wavelength of 490nm and an emission wavelength of 530 nm on the (PHERAstar spectrophotometer, BMG LabTech). An intracellular pH standard curve was generated by using the intracellular pH calibration buffer kit (Invitrogen), according to the manufacturer’s guidelines.

RNA preparation

RNA sequencing was performed on cultures following 2 h of growth. Following pre-culture, 4 mL aliquots of mono-species, dual-species and triple-species cultures were prepared, in triplicate, as biological replicates of cell growth. Cultures were grown at 37°C for 2 h. Following this, cultures were transferred directly to an equal volume of RNA Protect Bacterial Reagent (Qiagen), vortexed, incubated for 5 min at room temperature, and centrifuged (4000 × g for 10 min) [9,10]. The resulting cell pellet was stored at −80°C. For the RNA extraction, a combination of the hot phenol extraction method and a commercial RNA extraction kit (Qiagen, RNeasy Mini Kit) were utilised, as we have previously performed [9,10].

Transcriptomics analysis

RNA from each biological replicate was supplied to the Adelaide Cancer Genomic Research Facility (Adelaide, Australia) for library preparation and sequencing (RNAseq) using the Illumina NextSeq platform (Illumina). The fastq files were aligned to the reference genome of 86-028NP (for H. influenzae Genbank: NC_007146), using bowtie2 in the local mode. The resulting sam files were converted to bam file format, and then to the bed file format. Subsequently, the bed files were aligned to the reference genomes in gff format. The statistical analysis was performed with the DESeq package in R, to identify H. influenzae genes with the largest shift in expression in co-culture conditions compared to mono-culture conditions [9,10]. Differentially expressed genes presented in S1–S4 Tables display statistically significantly differentially expressed genes (p<0.01), which display a fold change in expression >2. The raw transcriptomic data has been made publicly available on the NCBI SRA database with accession number PRJNA820503 and submission ID SUB11224062.

Gene expression confirmation by qRT-PCR

Gene expression of artM was confirmed by a one-step relative qRT-PCR in a Roche LC480 real-time cycler, as we have performed previously [22]. RNA extracted as previously described from bacterial single-species, dual-species and triple species cultures following 2 h of growth was used to confirm gene expression by qualitative real-time PCR. Primers used to amplify H. influenzae artM (CAAGAATATTTAAGCGTGATCG; AGTAAGGTATAAATTGACCGCA) and 16SrRNA (TGGCAACAAAGGATAAGGGTT; TCCTAAGAAGAGCTCAGAGAT) were used at a final concentration of 200 nM. H. influenzae artM and 16S rRNA primers were tested for absence of amplification of artM and 16S rRNA of mono-species S. pneumoniae and M. catarrhalis cultures. Amplification data was analysed using the comparative critical threshold method, as previously described and is presented as a percentage of total expression relative to 86-028NP [22]. Assays were performed in triplicate in two experiments. Statistical analyses were performed using the t-test, *p<0.05.

Results

There is strain-specific competition with H. influenzae in a dual-species environment with S. pneumoniae and in a triple-species environment with S. pneumoniae and M. catarrhalis

Our work has previously assessed the co-existence of H. influenzae strain Rd KW20 and S. pneumoniae in a polymicrobial environment and has identified both competitive and synergistic interaction outcomes [9,10]. In this study we aimed to assess the interactions of H. influenzae in a triple-species environment harbouring M. catarrhalis as well as S. pneumoniae. We have previously identified the interactions between H. influenzae and S. pneumoniae to result in either a synergistic or competitive outcome, as a consequence of specific parameters, including pH, growth phase and nutrient availability [9,10]. Hence, four analyses in this study, we used a pH of 8 for the growth media, conditions which we have previously shown resulted in reduced species competition [9]. For our current research we assessed both the H. influenzae laboratory strain Rd KW20 as was used in our previous analysis, as well as the genetically distinct, nontypeable, clinical OM isolate 86-028NP. Determination of CFUs following 18 h growth in mono- or co-culture, showed that both strains were negatively affected by co-culture with S. pneumoniae and by co-culture in a triple-species environment, both in planktonic and biofilm form (Fig 1). However, strain 86-028NP was more severely affected than Rd KW20, reaching cell numbers below the detection limit in planktonic co-culture with S. pneumoniae (Fig 1A), and significantly lower cell numbers compared to Rd KW20 in triple-species co-culture. While Rd KW20 was affected to a similar level by co-culture in planktonic and biofilm state, 86-028NP was more affected by co-culture in the planktonic state, whereas in a biofilm, it had a better capacity to co-exist in dual- and triple-species culture (Fig 1).
Fig 1

Growth of H. influenzae in dual- and triple-species co-cultures with S. pneumoniae and M. catarrhalis after 18 h.

Growth in (A) planktonic and (B) biofilm state of H. influenzae middle ear isolate 86-028NP and laboratory strain Rd KW20 in mono-culture, in co-culture with S. pneumoniae strain 11, in co-culture with M. catarrhalis strain QC, and in triple-species co-culture with S. pneumoniae 11 and M. catarrhalis QC after 18h is represented as CFU/mL. * p<0.05, *** p<0.001.

Growth of H. influenzae in dual- and triple-species co-cultures with S. pneumoniae and M. catarrhalis after 18 h.

Growth in (A) planktonic and (B) biofilm state of H. influenzae middle ear isolate 86-028NP and laboratory strain Rd KW20 in mono-culture, in co-culture with S. pneumoniae strain 11, in co-culture with M. catarrhalis strain QC, and in triple-species co-culture with S. pneumoniae 11 and M. catarrhalis QC after 18h is represented as CFU/mL. * p<0.05, *** p<0.001.

Competitive interactions with H. influenzae in dual- and triple-species environments are time-point specific

As we have previously shown that there were time-dependent competitive interactions between H. influenzae Rd KW20 and S. pneumoniae [9], to assess whether the inhibitory effects of S. pneumoniae or a triple-species environment on strain 86-028NP were also time-dependent, growth of each species was assessed in planktonic culture at early log phase, following 2 h of growth (Fig 2). The results showed that all three species displayed an equivalent growth in mono-, dual- and triple-species co-culture (Fig 2).
Fig 2

Growth dynamics of dual- and triple-species co-cultures of H. influenzae, S. pneumoniae and M. catarrhalis after 2 h.

Growth in mono-, dual- and triple-species co-culture of (A), H. influenzae 86-028NP, (B), S. pneumoniae 11, and (C), M. catarrhalis QC in the planktonic state after 2h of growth are demonstrated as CFU/mL.

Growth dynamics of dual- and triple-species co-cultures of H. influenzae, S. pneumoniae and M. catarrhalis after 2 h.

Growth in mono-, dual- and triple-species co-culture of (A), H. influenzae 86-028NP, (B), S. pneumoniae 11, and (C), M. catarrhalis QC in the planktonic state after 2h of growth are demonstrated as CFU/mL.

H. influenzae up-regulates arginine uptake in dual- species co-culture with S. pneumoniae, and in triple-species co-culture

Our previous analysis of the H. influenzae Rd KW20 transcriptome in co-culture with S. pneumoniae has identified molecular factors central to polymicrobial co-existence in distinct environmental conditions [9,10]. As 86-028NP was more affected by dual- and triple- polymicrobial co-culture than Rd KW20, in this study we endeavoured to characterise the strain-specific H. influenzae 86-028NP transcriptome, but within a triple-species context which is relevant to the OM scenario. For the transcriptomic assessment of molecular events facilitating H. influenzae survival in the dual- and triple-species conditions, we performed a transcriptomic analysis following 2 h of growth, a timepoint in which all the bacterial species were viable and prior to competition affecting inter-species interactions. Transcriptomic analysis identified H. influenzae genes up- and down-regulated in dual- and triple-species co-culture compared to monoculture (S1–S4 Tables), and importantly, showed a consistent up-regulation of genes of the arginine uptake system artM-artP (artM, artQ, artI and artP) in H. influenzae in dual-species culture with S. pneumoniae, as well as in the triple-species co-culture (S1–S3 Tables). No genes were significantly differentially expressed in H. influenzae when in dual-species co-culture with M. catarrhalis. The expression of the first gene of the artM-artP operon, artM, following H. influenzae growth for 2 h in dual-species and triple-species conditions was confirmed by qRT-PCR (S1 Fig), supporting H. influenzae having a requirement for arginine in a dual- and triple species environment.

Arginine supplementation does not impact H. influenzae growth, but restores its survival in co-culture with S. pneumoniae, and in the triple-species culture

Assessment of arginine supplementation on growth phenotype of the mono-, dual- and triple-species cultures showed that the presence of exogenous supplemented arginine did not affect growth of H. influenzae or M. catarrhalis, but did produce a biphasic growth for S. pneumoniae, which was also reflected in the dual- and triple-species growth curves containing S. pneumoniae (S2 Fig). To assess a necessity for arginine in conditions of polymicrobial culture, H. influenzae 86-028NP and Rd KW20 were separately grown in dual- and triple-species co-cultures in the absence and presence of exogenous arginine supplemented at 4 g/L (Fig 3), and viable cell counts were determined following 18 h growth. In both strains the presence of exogenous arginine enabled the recovery of H. influenzae survival in co-culture with S. pneumoniae, and in triple-species culture. However, the recovery effect of arginine was significantly more pronounced for strain 86-028NP than for Rd KW20 (Fig 3), and was greater in the planktonic lifestyle (Fig 3A and 3B) than in the biofilm lifestyle (Fig 3C and 3D).
Fig 3

Arginine restores H. influenzae survival in dual- and triple-species co-culture.

Viable cell numbers of H. influenzae Rd KW20 or H. influenzae 86-028NP in planktonic (A,B) and biofilm (C,D) growth in mono-culture, dual-culture with S. pneumoniae 11, dual-culture with M. catarrhalis QC, and in triple-species culture for 18h, with and without supplementation with exogenous arginine at a concentration of 4g/L. Dotted line indicates the limit of detection. *, p<0.05.

Arginine restores H. influenzae survival in dual- and triple-species co-culture.

Viable cell numbers of H. influenzae Rd KW20 or H. influenzae 86-028NP in planktonic (A,B) and biofilm (C,D) growth in mono-culture, dual-culture with S. pneumoniae 11, dual-culture with M. catarrhalis QC, and in triple-species culture for 18h, with and without supplementation with exogenous arginine at a concentration of 4g/L. Dotted line indicates the limit of detection. *, p<0.05.

Arginine enhances H. influenzae ATP production

Uptake of arginine by H. influenzae could serve to enhance ATP production at a particular time-point during polymicrobial co-culture. We therefore measured ATP production (BacTiter Glo kit, Promega, Australia) at 15 min intervals with varying concentrations of exogenously supplemented arginine. Arginine significantly increased ATP production in 86-028NP during early lag phase of growth. Addition of higher arginine concentrations showed a trend for higher ATP production, although this was not statistically significant (Fig 4).
Fig 4

Arginine supplementation enhances H. influenzae ATP production.

Relative ATP production measured by luminescence (relative light units, RLU), of H. influenzae without supplementation of arginine (black), and with supplementation of 2 g/L (black dotted line), 4 g/L arginine (grey filled line) and 6 g/L arginine (grey dotted line). Luminescence (ATP production) is significantly higher in all concentrations of arginine, compared to no arginine supplementation. Significant differences were determined with a student t-test (*** p ≤ 0.001, ** p ≤ 0.01).

Arginine supplementation enhances H. influenzae ATP production.

Relative ATP production measured by luminescence (relative light units, RLU), of H. influenzae without supplementation of arginine (black), and with supplementation of 2 g/L (black dotted line), 4 g/L arginine (grey filled line) and 6 g/L arginine (grey dotted line). Luminescence (ATP production) is significantly higher in all concentrations of arginine, compared to no arginine supplementation. Significant differences were determined with a student t-test (*** p ≤ 0.001, ** p ≤ 0.01).

ATP production is increased in dual- and triple-species cultures

As H. influenzae ATP production was related to the presence of arginine, we then assessed the ATP production in the dual- and triple-species polymicrobial culture after 2 h of growth, correlating to the time-point arginine uptake was up-regulated, in comparison to the single-species cultures. Comparisons were performed in a growth medium at pH 8, as well as a growth medium at pH 7, conditions we have previously reported to result in higher levels of species competition [9]. ATP production was significantly higher for the H. influenzae and S. pneumoniae dual-species culture (86-028NP+11), and in the triple-species culture, compared to the H. influenzae single-species culture (86-028NP) (Fig 5). Importantly, the 86-028NP+11 dual-species culture, produced a significantly higher amount of ATP than the combined ATP for 86-028NP and 11 in single-species culture, and this was more pronounced at pH 7 (Fig 5B). The ATP production in triple-species culture was also significantly higher than the combined ATP production of the 86-028NP+11 in co-culture and QC in mono-culture or 86-028NP+QC dual-species culture and 11 in mono-culture (Fig 5). The presence of exogenously supplemented arginine did not significantly affect ATP production.
Fig 5

ATP production is enhanced in dual- and triple-species cultures.

ATP production measured by luminescence (relative light units, RLU), of H. influenzae 86-028NP (86), S. pneumoniae 11 and M. catarrhalis QC following 2 h of incubation in single-species culture, dual-species culture, and triple species culture at A) pH 8, with and without arginine supplementation, and B) in pH 7, without arginine supplementation. Significant differences were observed between H. influenzae alone (86), in dual-species culture with S. pneumoniae (86+11), and in triple-species culture (Triple). Statistical significance was evaluated with a student’s t-test (** p<0.01, *** p<0.001, **** p≤0.0001).

ATP production is enhanced in dual- and triple-species cultures.

ATP production measured by luminescence (relative light units, RLU), of H. influenzae 86-028NP (86), S. pneumoniae 11 and M. catarrhalis QC following 2 h of incubation in single-species culture, dual-species culture, and triple species culture at A) pH 8, with and without arginine supplementation, and B) in pH 7, without arginine supplementation. Significant differences were observed between H. influenzae alone (86), in dual-species culture with S. pneumoniae (86+11), and in triple-species culture (Triple). Statistical significance was evaluated with a student’s t-test (** p<0.01, *** p<0.001, **** p≤0.0001).

Arginine does not impact H. influenzae intracellular pH

In other bacterial species, arginine has been shown to serve different cellular roles such as regulating the intracellular pH. Using the BCECF-AM intracellular pH dye, we performed an analysis of intracellular pH in H. influenzae following incubation with exogenously supplemented arginine. Supplementation with arginine did not result in a significant alteration of intracellular pH (S3 Fig).

Discussion

In this study, we have utilized a model for the polymicrobial culture of H. influenzae, S. pneumoniae and M. catarrhalis, which has enabled the analysis of planktonic and biofilm cells within their mono-, dual- and triple-species communities. This expands on our previous publications on the co-culture of H. influenzae and S. pneumoniae [9,10]. For each species within dual- and triple-species conditions, growth was equivalent after 2 h of culture compared to mono-species culture. However, inter-species competition was observed at 18 h of growth in both the planktonic and biofilm state, where H. influenzae was reduced in co-culture with S. pneumoniae and in the triple-species culture (Fig 1). This competitive effect was strain-specific; the H. influenzae clinical isolate 86-028NP was significantly more affected by dual-species culture with S. pneumoniae, and by triple-species culture, in comparison to the laboratory strain Rd KW20. This result suggests a specific importance of competition for clinical H. influenzae isolates within the polymicrobial community. We had previously established the H. influenzae Rd KW20 transcriptional response to co-culture with S. pneumoniae. In the current study we assessed the transcriptional response of H. influenzae 86-028NP in the presence of S. pneumoniae and M. catarrhalis in dual- and triple-species co-culture [9,10]. Genes of the arginine uptake operon were consistently up-regulated in H. influenzae both in dual-species co-culture with S. pneumoniae, and in the triple-species co-culture (S1 and S2 Tables). While H. influenzae is known to have a requirement for arginine and lacks the initial 5 steps of the arginine biosynthesis pathway, the role of arginine for H. influenzae survival in a polymicrobial environment has not been established [23]. Addition of exogenous arginine was able to partially reverse the competitive effect of co-culture on H. influenzae. Interestingly, arginine had a greater effect in recovering the survival of 86-028NP in co-culture compared to Rd KW20, and a more pronounced effect was observed in planktonic co-culture, compared to the biofilm state (Fig 3). These results highlight a critical role for arginine in enabling the co-existence of H. influenzae, S. pneumoniae and M. catarrhalis, and strain-specificity of this role. These results imply that arginine may have a previously unrecognised role in nutrient sharing between the bacterial species. M. catarrhalis is unable to utilise extracellular carbohydrates [24], and is reliant on alternative carbon sources, including amino acids. While M. catarrhalis possesses genes for the synthesis of most amino acids, it does not possess pathways for the biosynthesis of arginine [24]. S. pneumoniae also lacks a complete pathway of arginine metabolism [25], and H. influenzae likewise lacks the initial 5 steps of the arginine biosynthesis pathway [23]. Therefore, it seems likely that competition driven by the ability to uptake arginine may result in this polymicrobial environment. Despite potential for such competition, growth phenotype analysis showed that only S. pneumoniae growth was different in the presence of exogenous arginine, resulting in a biphasic growth phenotype. This suggested arginine utilisation in S. pneumoniae following utilisation of a preferred nutrient source, but showed that arginine did not increase mono-species growth of H. influenzae or M. catarrhalis (S2 Fig). Conceivably, arginine could be important for additional reasons, including ATP generation, or acidity regulation. In other bacterial species, arginine was found to enhance acid tolerance and/or generate ATP via the arginine deiminase pathway [26]. The arginine deiminase pathway comprises a three-step reaction, catalysed by arginine deiminase, ornithine transcarbamoylase and carbamate kinase, respectively [27] (Fig 6). The reaction converts arginine to ornithine, ammonia and carbon dioxide, generating 1 mol of ATP per 1 mol of arginine. In this context, ammonia acts to buffer the environmental pH (25). However, while H. influenzae possesses both the ornithine transcarbamoylase and carbamate kinase, it does not possess the arginine deiminase gene [27], therefore in the absence of an orthologous enzyme which could catalyse the reaction, H. influenzae would not be expected to produce ammonia or ATP through this pathway (Fig 6).
Fig 6

Arginine import and catabolic pathways in H. influenzae 86-028NP as determined from KEGG pathway analysis.

Pathways for which genes have been identified in 86-028NP are indicated with black line, and pathways for which genes are missing in 86-028NP are indicated with dashed line.

Arginine import and catabolic pathways in H. influenzae 86-028NP as determined from KEGG pathway analysis.

Pathways for which genes have been identified in 86-028NP are indicated with black line, and pathways for which genes are missing in 86-028NP are indicated with dashed line. Despite the lack of a complete arginine deiminase pathway, the presence of supplemented arginine did result in enhanced ATP production in H. influenzae (Fig 4). In the context of nutrient limitation and competition in a polymicrobial environment, ATP production in H. influenzae may be critical to continue to survive in both a dual-species and triple-species environment. Indeed, ATP production was shown to increase in the dual-species and triple-species environment of H. influenzae, S. pneumoniae and M. catarrhalis (Fig 5). This indicates that the condition of polymicrobial co-culture stimulates ATP production in H. influenzae, and potentially also stimulates ATP production in S. pneumoniae and M. catarrhalis. Supplementation with exogenous arginine did not enhance ATP production, suggesting that the polymicrobial community and not arginine levels drives the ATP production in co-culture. The increase in ATP generation in S. pneumoniae and H. influenzae dual-species culture and triple-species culture was greater at pH 7, where competitive interactions have previously been observed to be greater, suggesting that early ATP generation may be necessary for H. influenzae viability in the polymicrobial environment [9]. In other bacterial species, ATP production from arginine utilisation is achieved primarily through the arginine deiminase pathway. The arginine deiminase pathway is also important in the pH regulation of bacteria, as ammonia is produced in the last step, resulting in alkalisation of the intracellular pH (25). As arginine utilisation was induced in H. influenzae in conditions of co-culture with S. pneumoniae, where we have previously shown acid stress to play a role [9], arginine, through a modified arginine deiminase pathway, could potentially result in alkalization of intracellular pH. However, our results have indicated that the presence of supplemented arginine did not affect the intracellular pH of H. influenzae (S3 Fig). Importantly, our transcriptomic data showed a concurrent increase in expression of an aspartate ammonia lyase in co-culture with S. pneumoniae, and in triple species co-culture (S3 Table), as well as artM. Aspartate ammonia lyase can neutralise the produced ammonia, by catalysing the conversion of ammonia and fumaric acid to aspartate [28], therefore utilisation of arginine through a similar pathway may not necessarily result in detectable increases in intracellular pH. In addition, in a dual-species or triple species environment harbouring H. influenzae, the potential release of ammonia to the extracellular environment could provide temporary neutralisation of organic acids produced as a result of S. pneumoniae fermentation. Our results reveal the importance of arginine in the polymicrobial environment and strongly suggest the presence of a modified arginine deiminase pathway in H. influenzae, necessitating future investigations for a candidate gene with orthologous function to the arginine deiminase. Arginine and ornithine, a product of arginine catabolism through the arginine deiminase pathway, have been increasingly shown to play an important role in other bacterial inter-species interactions. In the context of oral bacteria, co-aggregation of Actinomyces naeslundii has been shown to enable Streptococcus gordonii to survive in a arginine restricted environment [29]. Ornithine has been shown to function as a signalling molecule, and to drive the formation of a polymicrobial biofilm of S. gordonii and Fusobacterium nucleatum [30]. Therefore, it is possible that arginine plays a broader role in bacterial communication and in driving transition from planktonic to biofilm state for the otitis media polymicrobial biofilm. Our results, particularly with strain 86-028NP, showed a less pronounced growth inhibition in polymicrobial environments in a biofilm state compared to the planktonic state (Fig 3), suggesting that arginine may have a distinct role in the polymicrobial biofilm. Overall, our analysis of the triple-species polymicrobial environment of H. influenzae, S. pneumoniae and M. catarrhalis has shown time-dependent competitive interactions between these bacterial species, and a strong requirement for arginine in permitting H. influenzae survival in a dual-species environment with S. pneumoniae, and in a triple-species environment. Arginine was shown to drive ATP production in H. influenzae, and increased ATP production was seen in dual-species and triple-species environments. These results highlight the critical role of arginine in the polymicrobial community and strongly suggest the presence of an arginine deiminase pathway in H. influenzae, which should be investigated in future studies.

artM expression is increased in H. influenzae during co-culture with S. pneumoniae, and during triple-species culture.

Differential gene expression of artM in H. influenzae 86-028NP (86), H. influenzae in co-culture with S. pneumoniae (86+11), H. influenzae in co-culture with M. catarrhalis (86+QC), and H. influenzae in triple-species culture (Triple). Gene expression in presented as % gene expression relative to artM expression in 86-028NP in mono-culture. The data represents the average of 2 independent experiments, each performed in triplicate (*, p<0.1). (DOCX) Click here for additional data file.

Arginine supplementation results in biphasic growth of S. pneumoniae, but does not impact H. influenzae or M. catarrhalis growth.

Planktonic growth of mono-, dual- and triple-species cultures of H. influenzae 86-028NP, S. pneumoniae 11 and M. catarrhalis QC at pH 8 over 18h, with (grey) and without (black) supplementation of exogenous arginine at a concentration of 4g/L. Growth is shown for H. influenzae 86-028NP in mono-culture (A), S. pneumoniae 11 in mono-culture (B), M. catarrhalis QC in mono-culture (C), dual-species culture of H. influenzae 86-028NP and S. pneumoniae 11 (D), dual-species culture of H. influenzae 86-028NP and M. catarrhalis QC (E), dual-species culture of S. pneumoniae 11 and M. catarrhalis QC (F), and triple-species culture (G). (DOCX) Click here for additional data file.

Arginine supplementation does not affect intracellular pH of H. influenzae.

Intracellular pH of H. influenzae following 30min incubation in the presence of 0, 2 or 4g/L of supplemented arginine. (DOCX) Click here for additional data file.

Genes up-regulated in H. influenzae 86-028NP following 2 h growth in co-culture with S. pneumoniae 11.

(DOCX) Click here for additional data file.

Genes up-regulated in H. influenzae 86-028NP following 2 h growth in triple species co-culture with S. pneumoniae 11 and M. catarrhalis QC.

(DOCX) Click here for additional data file.

Genes down-regulated in H. influenzae 86-028NP following 2 h co-culture with S. pneumoniae 11.

(DOCX) Click here for additional data file.

Genes down-regulated in H. influenzae 86 following 2 h growth in triple-species co-culture with S. pneumoniae 11 and M. catarrhalis QC.

(DOCX) Click here for additional data file. 29 Jun 2022
PONE-D-22-10862
The central role of arginine in Haemophilus influenzae survival in a polymicrobial environment with Streptococcus pneumoniae and Moraxella catarrhalis.
PLOS ONE Dear Dr. Kidd, Thank you for submitting your manuscript to PLOS ONE and our apologies for the delay in the review process. Your manuscript was reviewed by two expert reviewers whose comments are included at the bottom of this message. Based on their recommendation, we feel that the manuscript has merit but does not yet fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript with minor revisions that address the points raised by the reviewers. Please submit your revised manuscript by Aug 13 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Hendrik W. van Veen, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following financial disclosure: “This work was supported by the Garnett Passe and Rodney Williams Memorial Foundation Research Training Fellowship to A.T., and a National Health and Medical Research Council (NHMRC) Investigator Grant 1174876 to J.C.P.” Please state what role the funders took in the study.  If the funders had no role, please state: "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." If this statement is not correct you must amend it as needed. Please include this amended Role of Funder statement in your cover letter; we will change the online submission form on your behalf. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: “This work was supported by the Garnett Passe and Rodney Williams Memorial Foundation Research Training Fellowship to A.T., and a National Health and Medical Research Council (NHMRC) Investigator Grant 1174876 to J.C.P” We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: “This work was supported by the Garnett Passe and Rodney Williams Memorial Foundation Research Training Fellowship to A.T., and a National Health and Medical Research Council (NHMRC) Investigator Grant 1174876 to J.C.P.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 5. You should list all authors and all affiliations as per our author instructions and clearly indicate the corresponding author. 6. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript, Tikhomirova and colleagues have studied in vitro competitive interactions among Haemophilus influenzae, Streptococcus pneumoniae and Moraxella catarrhalis, three pathogens that co exist in the human upper respiratory tract and also cause otitis media. They show decreased viability of H. influenzae in co-culture with S. pneumoniae and in triple-species cultures. They demonstrate a key role for arginine in mediating these interactions and further show that arginine stimulates production of ATP by H. influenzae in competitive cultures. Overall the work is straightforward and well done and the data support the conclusions. A limitation of the work is that a limited numbers strains was studied. Individual strains of H. influenzae show substantial variability in growth characteristics and growth requirements between strains. The present work lays a good foundation to assess a broader range of clinical isolates of all three species as different results are likely to be seen. Just the two strains of H. influenzae yielded different results in the present study. The work also establishes observations and methods that will guide work under conditions that better simulate those in the human respiratory tract. Reviewer #2: The authors present an interesting and well-conducted study describing the role of arginine for survival of Haemophilus influenzae in polymicrobial co-existence with S. pneumoniae and M. catarrhalis, relevant co-habitants of the upper respiratory tract and the inner ear, of importance for the development of otitis media. A major comment: In none of the clinical studies I have been involved in focused on bacterial colonization and co-occurrence in the upper respiratory tract I have ever observed a negative correlation between S. pneumoniae and H. influenzae (as opposed to the combination S. pneumoniae and S. aureus), in contrast we have found quite some evidence for synergy. In quite some other clinical studies this observation is also found. Why do the authors focus on the competition and observe reduction in viability when cultures of the different species are combined, while there is hardly or no evidence from human colonization studies for competition rather for inter-dependence? How do the authors explain this important difference between their in vitro results and the in vivo results described by others? Minor comments: -The sentence ‘conditions we previously identified resulted in reduced species competition’ (163-164) is not clear (despite the reference) the authors should elaborate a bit more to explain which conditions they refer to. -It is not entirely clear why two unencapsulated H. influenzae strains were used. It is important to motivate this choice. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Marien I. de Jonge ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
6 Jul 2022 Tikhomirova et al Rebuttal PONE-D-22-10862 The central role of arginine in Haemophilus influenzae survival in a polymicrobial environment with Streptococcus pneumoniae and Moraxella catarrhalis. PLOS ONE Reviewer #1 In this manuscript, Tikhomirova and colleagues have studied in vitro competitive interactions among Haemophilus influenzae, Streptococcus pneumoniae and Moraxella catarrhalis, three pathogens that co-exist in the human upper respiratory tract and also cause otitis media. They show decreased viability of H. influenzae in co-culture with S. pneumoniae and in triple-species cultures. They demonstrate a key role for arginine in mediating these interactions and further show that arginine stimulates production of ATP by H. influenzae in competitive cultures. Overall the work is straightforward and well done and the data support the conclusions. A limitation of the work is that a limited numbers strains was studied. Individual strains of H. influenzae show substantial variability in growth characteristics and growth requirements between strains. The present work lays a good foundation to assess a broader range of clinical isolates of all three species as different results are likely to be seen. Just the two strains of H. influenzae yielded different results in the present study. The work also establishes observations and methods that will guide work under conditions that better simulate those in the human respiratory tract. Response; The point the Reviewer is making is very valuable. This study was performed as a focussed work aiming to establish an in-depth molecular characterisation of the interactions between S. pneumoniae, H. influenzae and M. catarrhalis, and it was unfortunately not within the scope of this work to include a deeper characterisation of a larger number of strains. However, the interesting results presented provide an alluring basis for the analysis of strain variation on the outcomes of the interactions between these three species, which we are eager to pursue in the future. Reviewer #2: The authors present an interesting and well-conducted study describing the role of arginine for survival of Haemophilus influenzae in polymicrobial co-existence with S. pneumoniae and M. catarrhalis, relevant co-habitants of the upper respiratory tract and the inner ear, of importance for the development of otitis media. A major comment: In none of the clinical studies I have been involved in focused on bacterial colonization and co-occurrence in the upper respiratory tract I have ever observed a negative correlation between S. pneumoniae and H. influenzae (as opposed to the combination S. pneumoniae and S. aureus), in contrast we have found quite some evidence for synergy. In quite some other clinical studies this observation is also found. Why do the authors focus on the competition and observe reduction in viability when cultures of the different species are combined, while there is hardly or no evidence from human colonization studies for competition rather for inter-dependence? How do the authors explain this important difference between their in vitro results and the in vivo results described by others? Response: We thank the reviewer for this interesting and thoughtful comment. There certainly are numerous studies suggesting cooperation between these bacterial otopathogens. However, it is worth noting that there are indeed opposing studies. We discuss this in lines 43-57. This is not only from in vitro and animal studies (ref 14, ref 16) but some indication from clinical studies. This has now been added into the revised introduction – line 51-55. For example, in children with upper respiratory tract infections, an antagonistic relationship between S. pneumoniae and H. influenzae has been suggested (ref 15 - Littorin et al, 2021). Ref 14 -Pettigrew et al, 2008 also observed negative associations between S. pneumoniae and H. influenzae during respiratory tract infection. In addition, clinical studies have shown strain specificity to affect inter-species interactions (ref 16 - Dagan et al, 2013), as well as significant variation in inter-species associations between anatomical sites, where although a high dominance of all three species was observed in the nasopharynx, the ear displayed increased dominance and abundance of H. influenzae compared to S. pneumoniae or M. catarrhalis (Smith-Vaughan et al, 2013 – ref 5). Clearly, in a clinical setting if there is a competitive outcome (such as, as a consequence of hydrogen peroxide being generated by S. pneumoniae inhibiting growth of the other bacterial species, as has been suggested, (ref 19 Ikryannikova et al, 2017)) then there will only be isolation and identification of S. pneumoniae from that sample, seemingly as a mono-culture colonisation or infection. The other bacteria that have not been cultured, exactly because they were outcompeted. There would seem to be opportunities for either synergistic or competitive interactions. This field has been equivocal, the outcomes of the interplay between bacteria seems to be dependent on specific factors. Indeed, our previous, published studies (ref 9 and 10) demonstrated that depending on environmental conditions (pH, nutrient availability and the growth phase) there is synergistic or competitive interactions between S. pneumoniae and H. influenzae. These are the references we mention above and are now added within our manuscript: Littorin, N, et al., Decreased prevalence of Moraxella catarrhalis in addition to Streptococcus pneumoniae in children with upper respiratory tract infection after introduction of conjugated pneumococcal vaccine: a retrospective cohort study. 2021. Clinical Microbiology and Infection, 27(4):630e1-e6. Pettigrew, M, M, et al., Microbial interactions during upper respiratory tract infections. 2008. Emerging Infections diseases, 14(10):1584–1591 Dagan, R, et al., Mixed Pneumococcal–Nontypeable Haemophilus influenzae otitis media is a distinct clinical entity with unique epidemiologic characteristics and pneumococcal serotype distribution. 2013. The Journal of Infectious Diseases, 208(7): 1152–1160. Minor comments: -The sentence ‘conditions we previously identified resulted in reduced species competition’ (163-164) is not clear (despite the reference) the authors should elaborate a bit more to explain which conditions they refer to. Response: Specifically, we reported (ref 9; 10) that there can be either positive interactions or a negative, competitive interactions as a consequence of the distinct growth parameters: pH, nutrient availability or the stage of growth phase. We have added in this text to make this clear (lines 163-167). -It is not entirely clear why two unencapsulated H. influenzae strains were used. It is important to motivate this choice. Response: As noted by the Reviewers, this is an original study that creates a platform for further in-depth research. As such both the model H. influenzae laboratory strain Rd KW20 was used in (as performed in our previously published analyses, ref 9 and 10), as well as the genetically distinct, nontypeable, and clinical OM isolate 86-028NP. Nontypeable H. influenzae (NTHi) do not have a polysaccharide capsule and are a leading cause of OM. Furthermore, NTHi have specifically been associated with polymicrobial OM (Barkai, 2009), hence were highly relevant to the assessment of bacterial interactions in an OM context. Barkai G, et al., Potential contribution by nontypeable Haemophilus influenzae in protracted and recurrent acutre otitis media. 2009. The Pediatric Infectious Disease Journal, 28(6): 466-471. Submitted filename: Tikhomirova et al 2022 PONE Letter_Response to Reviewers v2.docx Click here for additional data file. 11 Jul 2022 The central role of arginine in Haemophilus influenzae survival in a polymicrobial environment with Streptococcus pneumoniae and Moraxella catarrhalis. PONE-D-22-10862R1 Dear Prof. Kidd, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Hendrik W. van Veen, PhD Academic Editor PLOS ONE 14 Jul 2022 PONE-D-22-10862R1 The central role of arginine in Haemophilus influenzae survival in a polymicrobial environment with Streptococcus pneumoniae and Moraxella catarrhalis. Dear Dr. Kidd: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Hendrik W. van Veen Academic Editor PLOS ONE
  30 in total

1.  Evolution of arginine deiminase (ADI) pathway genes.

Authors:  Manuel Zúñiga; Gaspar Pérez; Fernando González-Candelas
Journal:  Mol Phylogenet Evol       Date:  2002-12       Impact factor: 4.286

2.  The outcome of H. influenzae and S. pneumoniae inter-species interactions depends on pH, nutrient availability and growth phase.

Authors:  Alexandra Tikhomirova; Claudia Trappetti; James C Paton; Stephen P Kidd
Journal:  Int J Med Microbiol       Date:  2015-09-14       Impact factor: 3.473

3.  Moraxella catarrhalis outer membrane vesicles carry β-lactamase and promote survival of Streptococcus pneumoniae and Haemophilus influenzae by inactivating amoxicillin.

Authors:  Viveka Schaar; Therése Nordström; Matthias Mörgelin; Kristian Riesbeck
Journal:  Antimicrob Agents Chemother       Date:  2011-05-16       Impact factor: 5.191

4.  Direct detection of bacterial biofilms on the middle-ear mucosa of children with chronic otitis media.

Authors:  Luanne Hall-Stoodley; Fen Ze Hu; Armin Gieseke; Laura Nistico; Duc Nguyen; Jay Hayes; Michael Forbes; David P Greenberg; Bethany Dice; Amy Burrows; P Ashley Wackym; Paul Stoodley; J Christopher Post; Garth D Ehrlich; Joseph E Kerschner
Journal:  JAMA       Date:  2006-07-12       Impact factor: 56.272

Review 5.  Otitis media and its consequences: beyond the earache.

Authors:  Anne Vergison; Ron Dagan; Adriano Arguedas; Jan Bonhoeffer; Robert Cohen; Ingeborg Dhooge; Alejandro Hoberman; Johannes Liese; Paola Marchisio; Arto A Palmu; G Thomas Ray; Elisabeth A M Sanders; Eric A F Simões; Matti Uhari; Johan van Eldere; Stephen I Pelton
Journal:  Lancet Infect Dis       Date:  2010-03       Impact factor: 25.071

6.  A single nucleotide polymorphism in an IgA1 protease gene determines Streptococcus pneumoniae adaptation to the middle ear during otitis media.

Authors:  Alexandra Tikhomirova; Claudia Trappetti; James C Paton; Nathan Watson-Haigh; David Wabnitz; Jake Jervis-Bardy; Camille Jardeleza; Stephen P Kidd
Journal:  Pathog Dis       Date:  2021-01-09       Impact factor: 3.166

7.  Site-Specific Mutations of GalR Affect Galactose Metabolism in Streptococcus pneumoniae.

Authors:  Kimberley T McLean; Alexandra Tikhomirova; Erin B Brazel; Salomé Legendre; Gian Haasbroek; Vikrant Minhas; James C Paton; Claudia Trappetti
Journal:  J Bacteriol       Date:  2020-12-07       Impact factor: 3.490

8.  Mixed pneumococcal-nontypeable Haemophilus influenzae otitis media is a distinct clinical entity with unique epidemiologic characteristics and pneumococcal serotype distribution.

Authors:  Ron Dagan; Eugene Leibovitz; David Greenberg; Lauren Bakaletz; Noga Givon-Lavi
Journal:  J Infect Dis       Date:  2013-07-10       Impact factor: 5.226

9.  Inhibitory effect of streptococci on the growth of M. catarrhalis strains and the diversity of putative bacteriocin-like gene loci in the genomes of S. pneumoniae and its relatives.

Authors:  L N Ikryannikova; M V Malakhova; G G Lominadze; I Yu Karpova; E S Kostryukova; N A Mayansky; A N Kruglov; E A Klimova; E S Lisitsina; E N Ilina; V M Govorun
Journal:  AMB Express       Date:  2017-12-13       Impact factor: 3.298

10.  Dynamics of Bacterial Colonization With Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis During Symptomatic and Asymptomatic Viral Upper Respiratory Tract Infection.

Authors:  Gregory P DeMuri; James E Gern; Jens C Eickhoff; Susan V Lynch; Ellen R Wald
Journal:  Clin Infect Dis       Date:  2018-03-19       Impact factor: 9.079

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.