| Literature DB >> 35814255 |
Min Yan1, Yinyin Yan1,2, Zhenqiang Zhang1, Guoqiang Wang1, Wenbo Shi1,2, Mengyuan Jiang1, Junwei Zhao3, Xiangxiang Wu1, Huahui Zeng1,2.
Abstract
Clinical use of triptolide (TP) is restricted due to severe toxicity. This study assessed the protective effect of crocin (CR) as a natural antioxidant against TP-induced toxicity in bovine collagen type II-induced arthritis (CIA) in mice. The mice in the CIA model group showed macroscopic signs of severe arthritis. The anti-arthritis effects in the control, TP + CR, and TP groups were evaluated through assessment of foot volume, arthritis score, and proinflammatory cytokines, and collagen antibody assay. Crocin reduced TP-induced toxicity, as evidenced by evaluation of survival rate, body weight, visceral index, hepatic and renal functions, histopathologic analyses, and antioxidant enzyme activities. Transcriptome sequencing resulted in identification of 76 differentially expressed genes (DEGs) associated with hepatotoxicity between the TP and TP + CR groups. Of these, Three DEGs (Cyp1a2,Gsta4, and Gstp1) were validated using quantitative real-time PCR analysis. In conclusion, CR protected CIA mice from TP-induced toxicity through modulation of the cytochrome P450 and glutathione metabolism pathways.Entities:
Keywords: arthritis; compatibility; crocin; toxicity; triptolide
Year: 2022 PMID: 35814255 PMCID: PMC9260116 DOI: 10.3389/fphar.2022.908227
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
FIGURE 1Schematic representation of CIA mouse model generation and treatment with TP or TP + CR. TP: triptolide; CR: crocin; CIA: collagen-induced arthritis.
Primer sequences for qRT-PCR.
| Gene Name | Sequence (5'→3′) | Size (Bp) | NCBI GeneID |
|---|---|---|---|
| GSTP1 | Forward ATGCCACCATACACCATTGTC | 161 | 14870 |
| Reverse GGGAGCTGCCCATACAGAC | |||
| GSTA4 | Forward TGATTGCCGTGGCTCCATTTA | 135 | 14860 |
| Reverse CAACGAGAAAAGCCTCTCCGT | |||
| CYP1A2 | Forward AGTACATCTCCTTAGCCCCAG | 118 | 13077 |
| Reverse GGTCCGGGTGGATTCTTCAG | |||
| GAPDH | Forward AGGTCGGTGTGAACGGATTTG | 123 | 14433 |
| Reverse TGTAGACCATGTAGTTGAGGTCA |
FIGURE 2Body weight changes during 20 days of treatment. (n = 8) ***p < 0.001 vs Control.
FIGURE 3The levels of ALT (A), AST (B), CRE (C), BUN (D) in the CIA mice liver were determined using respective kits, after 20 days of different treatment. (n = 8) **p < 0.01,***p < 0.001 vs. Control. ALT, alanine transaminase; AST, aspartate transaminase; CRE, creatinine; BUN, blood urea nitrogen; CIA, collagen-induced arthritis.
FIGURE 4Changes in arthritic foot volume ((A)/a) and arthritis scores ((B)/b) in the CIA mice through the administration course (n = 8). **p < 0.01, ***p < 0.001 vs Control. CIA: collagen-induced arthritis.
FIGURE 5Quantitation of proinflammatory cytokines (A) TNF-α; (B) IL-1β; (C) IL-6 and anti-type II collagen antibody (D) in serum of each group using ELISA. (n = 6).
FIGURE 6Photos of right hind paws (A–G) and histopathological analysis of ankle joints stained with H&E (a–g).
FIGURE 7The survival rates (A) (n = 10) and body weight changes (B) (n = 6) of different groups over 7 days *p < 0.05, **p < 0.01 vs Control.
Comparison of organ coefficients in each group ( ± S, n = 6).
| Groups | Heart | Liver | Spleen | Lung | Kidney | Testis |
|---|---|---|---|---|---|---|
| Control | 0.569 ± 0.019 | 5.665 ± 0.410 | 0.514 ± 0.090 | 0.729 ± 0.074 | 1.437 ± 0.117 | 0.635 ± 0.049 |
| LTP | 0.544 ± 0.022 | 5.301 ± 0.342 | 0.507 ± 0.041 | 0.682 ± 0.052 | 1.405 ± 0.087 | 0.604 ± 0.123 |
| MTP | 0.530 ± 0.023** | 5.086 ± 0.345* | 0.405 ± 0.064* | 0.641 ± 0.055* | 1.239 ± 0.158* | 0.561 ± 0.038* |
| HTP | 0.476 ± 0.036** | 4.936 ± 0.413* | 0.388 ± 0.092* | 0.591 ± 0.052** | 1.165 ± 0.202* | 0.482 ± 0.112* |
| LTP + CR | 0.564 ± 0.030 | 5.530 ± 0.455 | 0.509 ± 0.114 | 0.714 ± 0.063 | 1.424 ± 0.075 | 0.629 ± 0.037 |
| MTP + CR | 0.563 ± 0.029# | 5.527 ± 0.233# | 0.491 ± 0.026# | 0.725 ± 0.066# | 1.428 ± 0.093# | 0.624 ± 0.050# |
| HTP + CR | 0.548 ± 0.051# | 5.499 ± 0.306# | 0.499 ± 0.024# | 0.704 ± 0.092# | 1.400 ± 0.048# | 0.621 ± 0.101# |
Notes: *p < 0.05, **p < 0.01 any group vs Control; # p < 0.05, XTP + CR, vs XTP (X represent L, M, or H).
Comparison of hepatic and renal functions among the groups of mice ( ± S, n = 6).
| Groups | AST (IU/L) | ALT (IU/L) | BUN(mmol/L) | CRE(μmol/L) |
|---|---|---|---|---|
| Control | 23.373 ± 2.829 | 30.512 ± 9.592 | 4.634 ± 0.291 | 14.037 ± 1.952 |
| LTP | 34.526 ± 6.497** | 43.86 ± 7.142* | 4.953 ± 0.221 | 16.931 ± 2.284 |
| MTP | 41.998 ± 4.595** | 45.382 ± 10.674* | 5.609 ± 0.188** | 21.782 ± 1.902* |
| HTP | 50.125 ± 7.816** | 49.224 ± 15.304* | 7.948 ± 1.171** | 22.802 ± 2.866* |
| LTP + CR | 24.32 ± 8.476# | 26.774 ± 12.049# | 4.781 ± 0.195 | 15.259 ± 1.229 |
| MTP + CR | 25.064 ± 6.311## | 30.371 ± 4.409# | 4.916 ± 0.480## | 15.625 ± 0.914## |
| HTP + CR | 25.428 ± 5.766## | 34.528 ± 3.703# | 5.017 ± 0.485## | 17.533 ± 3.445# |
Notes: *p < 0.05, **p < 0.01 any group vs Control; # p < 0.05, ## p < 0.01, XTP + CR, vs XTP (X represent L, M, or H).
FIGURE 8Histopathological observations of H&E staining on the main visceral organs of the mice. Images were obtained at 400X magnification (scale bar = 20 μm).
Morphological and pathological manifestations of mice in each group.
| Control | TP Groups | TP + CR Groups | |
|---|---|---|---|
| Heart | The myocardial fibers were orderly and tightly arranged | LTP and MTP groups: the transverse striations were ambiguous and there was interstitial congestion | Myocardial damage was significantly ameliorated and histological morphology tended to be normal |
| HTP group: cardiomyocytes had been dissolved, interstitial fibers showed hyperplasia, and inflammatory cell infiltration occurred | |||
| Liver | Normal cell morphology, clear hepatic lobule structure, and neatly arranged hepatocytes with no inflammatory | LTP group: few inflammatory cells were observed | Clear structure with no edema, and small fat vacuoles were observed in part of the hepatocyte cytoplasm. Hepatocellular injury was significantly improved |
| cell infiltration | MTP group: hepatocyte edema and punctate necrosis | ||
| Disordered hepatic cell cord arrangement, and compressed sinusoids | |||
| HTP group: hepatocytes exhibited diffuse hydropic or fatty degeneration | |||
| Spleen | Splenic corpuscle was circular and the structure was clear | LTP group: Decreased lymphocyte density, increased red pulp macrophages | White pulp injury was significantly reduced and no abnormal changes were observed |
| MTP group: Significant increase in the number of multinucleated macrophages and erythrocytes | |||
| HTP group: white pulp structures were disordered and numerous apoptotic bodies were present | |||
| Lung | The alveolar structure in H&E staining was normal, the lung tissue was well structured, and there was no inflammatory cell infiltration | MTP and HTP group: alveolar and alveolar interstitial inflammatory cell infiltration and edema | Normal alveoli and few inflammatory cells |
| Kidney | Tubular epithelial cells and glomerular structures were clear and intact | With increased TP drug dosage, the proximal convoluted tubules were edematous and glomerular capillaries were markedly dilated. Infiltration of inflammatory cells was observed | Normal histological morphology. Slight hyperplasia of fibrous tissue was observed in the interstitium |
| Testes | Clear structure of seminiferous tubules and orderly arrangement of spermatogenic cells. Mature sperm were observed | Compared to that in the healthy testes, the number of spermatogenic cells in the seminiferous tubules was reduced, and they were disorganized | Compared with the model group, the number of spermatogenic cells was increased and the cells were arranged in an orderly fashion |
| Stomach | The control group showed a normal structure and no histopathological changes | HTP group: tissue structure was disordered, mucosal epithelial cells had shed, and inflammatory cell infiltration was observed | CR treatment significantly ameliorated gastric mucosa damage; regular glandular structure was observed, and reduced inflammatory cell infiltration |
| Intestine | The mucosal epithelial cells were arranged neatly | HTP group: The epithelial cells had shed and inflammatory cells had infiltrated the lamina propria | The tissues were clear and intact |
FIGURE 9Levels of CAT (A), SOD (B), GSH (C), and MDA (D) in liver homogenates of mice (n = 6). *p < 0.05, **p < 0.01, ***p < 0.001 vs Control.
FIGURE 10Volcano maps of differentially expressed mRNAs between groups. (A) MTP vs. Control (B) MTP + CR vs. MTP.
FIGURE 11Venn diagram showing the number of differently expressed mRNAs related to hepatotoxicity (A) and pathway enrichment analysis (B).
FIGURE 12The heat maps of the Top 23 differentially-expressed mRNAs among three groups.
FIGURE 13Confirmation of mRNA expression by qRT-PCR (A) the CYP1A2 mRNA level; (B) the GSTP1 mRNA level; (C) the GSTA4 mRNA level. **p < 0.01,***p < 0.001 vs MTP.