| Literature DB >> 35814024 |
Kara Jew1, Philip E J Smith2, Byungcheol So2, Jillian Kasman2, Javin P Oza2, Michael W Black1.
Abstract
Cell-free protein synthesis (CFPS) is an in vitro process that enables diverse applications in research, biomanufacturing, point-of-care diagnostics, therapeutics, and education using minimal laboratory equipment and reagents. One of the major limitations of CFPS implementation is its sensitivity to plasmid type. Specifically, plasmid templates based on commonly used vector backbones such as the pET series of bacterial expression vectors result in the inferior production of proteins. To overcome this limitation, we have evaluated the effect of expression cassette elements present in the pET30 vector on protein production across three different CFPS systems: NEBExpress, PURExpress, and CFAI-based E. coli extracts. Through the systematic elimination of genetic elements within the pET30 vector, we have identified elements that are responsible for the poor performance of pET30 vectors in the various CFPS systems. As a result, we demonstrate that through the removal of the lac operator (lacO) and N-terminal tags included in the vector backbone sequence, a pET vector can support high titers of protein expression when using extract-based CFPS systems. This work provides two key advances for the research community: 1) identification of vector sequence elements that affect robust production of proteins; 2) evaluation of expression across three unique CFPS systems including CFAI extracts, NEBexpress, and PURExpress. We anticipate that this work will improve access to CFPS by enabling researchers to choose the correct expression backbone within the context of their preferred expression system.Entities:
Keywords: cell-free; in vitro; pET30; protein synthesis; template; translation
Year: 2022 PMID: 35814024 PMCID: PMC9259831 DOI: 10.3389/fbioe.2022.895069
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primers used to construct pET30 expression vectors. Primers for amplification of insert and vector backbones used in Gibson assembly to construct pET30-T7-sfGFP, pET30-lacO-sfGFP, pET30-His-sfGFP, and pET30-lacO-His-sfGFP.
| Primer sequences | Tm | Annealing | |
|---|---|---|---|
| pET30-T7-sfGFP | |||
| Insert: T7-Pro-Gib-F | ccgcgaaattaatacgactcactatagg | 59°C | 63°C |
| Insert: T7-Term-Gib-R | ctttcagcaaaaaacccctcaag | 56°C | |
| Vector: T7-Term-Gib-F | cttgaggggttttttgctgaaag | 56°C | 63°C |
| Vector: T7-Pro-Gib-R | cctatagtgagtcgtattaatttcgcgg | 59°C | |
| pET30-T7-lacO-sfGFP | |||
| Insert: RBS-sfGFP-F | ctttaagaaggagatatacatatgagcaaaggtgaagaactg | 62°C | 55°C |
| Insert: T7-Term-Gib-R | ctttcagcaaaaaacccctcaag | 56°C | |
| Vector: T7-Term-Gib-F | cttgaggggttttttgctgaaag | 56°C | 63°C |
| Vector: pET-RBS-long-R | catatgtatatctccttcttaaagttaaacaaaattatttctagagg | 58°C | |
| pET30-T7-His/S-sfGFP | |||
| Insert: pET-RBS-F | gtttaactttaagaaggagatatacatatg | 52°C | 58°C |
| Insert: T7-Term-Gib-R | ctttcagcaaaaaacccctcaag | 56°C | |
| Vector: T7-Term-Gib-F | cttgaggggttttttgctgaaag | 56°C | 58°C |
| Vector: pET-RBS-long-R | catatgtatatctccttcttaaagttaaacaaaattatttctagagg | 58°C | |
| pET30-T7-lacO-His/S-sfGFP | |||
| Insert: N-tag-sfGFP-F | cacatggacagcccagatctcatgagcaaaggtgaagaactg | 69°C | 63°C |
| Insert: T7-Term-Gib-R | ctttcagcaaaaaacccctcaag | 56°C | |
| Vector: T7-Term-Gib-F | cttgaggggttttttgctgaaag | 56°C | 61°C |
| Vector: pET-No-Cut-DIC-R | agatctgggctgtccatgtg | 58°C | |
FIGURE 1Schematic of the expression vectors studied. (A) pJL1-sfGFP represents the reference vector, (B) the pET30-T7-lacO-His/S-sfGFP cassette contains the T7 promoter (T7 pro) followed by lacO and a N-terminal purification tags (His and S tags) included in the pET30 vector backbone. Modifications of the pET30 expression cassette included the deletion of (C) the N-terminal His/S-tags, (D) lacO, and (E) both lacO and the N-terminal tags to assess the effects on sfGFP expression. Similar to pET30-T7-sfGFP, the pJL1-T7-sfGFP cassette includes the same T7 promoter but not the lacO nor the N-terminal His-tag. All templates used in this study were in their circular plasmid forms. While the backbone sequences are not displayed here, pET30a includes the lacI gene that is not present in the pJL1 backbone.
FIGURE 2sfGFP expression from the CFAI-based, NEB Express, and NEB PURExpress CFPS systems. The sfGFP yields from (A) CFAI-based, (B) NEBExpress, and (C) NEB PURExpress CFPS systems determined by fluorescence. Data are presented as mean ± s.d. (n = 3).