Literature DB >> 35812971

Variation in the Number and Position of rDNA Loci Contributes to the Diversification and Speciation in Nigella (Ranunculaceae).

Fatemeh Orooji1, Ghader Mirzaghaderi1, Yi-Tzu Kuo2, Jörg Fuchs2.   

Abstract

Nigella is a small genus belonging to the Ranunculaceae family which is presumably originated and distributed in Aegean and the adjacent Western-Irano-Turanian region. Comparative repeat analysis of N. sativa, N. damascena and N. bucharica was performed using low-pass Illumina genomic reads followed by karyotyping and FISH mapping of seven Nigella species using the in silico identified repeats and ribosomal DNA (rDNA) probes. High- and moderate-copy repeat sequences occupy 57.52, 59.01, and 64.73% of N. sativa, N. damascena and N. bucharica genomes, respectively. Roughly, half of the genomes are retrotransposons (class I transposons), while DNA transposons (class II transposons) contributed to only about 2% of the genomes. The analyzed Nigella species possess large genomes of about 7.4 to 12.4 Gbp/1C. Only two satellite repeats in N. sativa, one in N. damascena and four in N. bucharica were identified, which were mostly (peri)centromeric and represented about 1% of each genome. A high variation in number and position of 45S rDNA loci were found among Nigella species. Interestingly, in N. hispanica, each chromosome revealed at least one 45S rDNA site and one of them occurs in hemizygous condition. Based on the chromosome numbers, genome size and (peri)centromeric satellites, three karyotype groups were observed: Two with 2n = 2x = 12 and a karyotype formula of 10m + 2t (including N. sativa, N. arvensis, N. hispanica as the first group and N. damascena and N. orientalis as the second group) and a more distant group with 2n = 2x = 14 and a karyotype formula of 8m + 2st + 4t (including N. integrifolia and N. bucharica). These karyotype groups agreed with the phylogenetic analysis using ITS and rbcL sequences. We conclude that variation in (peri)centromeric sequences, number and localization of rDNA sites as well as chromosome number (dysploidy) are involved in the diversification of the genus Nigella.
Copyright © 2022 Orooji, Mirzaghaderi, Kuo and Fuchs.

Entities:  

Keywords:  Nigella genus; karyotype evolution; repeatome analysis; repetitive sequences; satellites

Year:  2022        PMID: 35812971      PMCID: PMC9261981          DOI: 10.3389/fpls.2022.917310

Source DB:  PubMed          Journal:  Front Plant Sci        ISSN: 1664-462X            Impact factor:   6.627


Introduction

Nigella (fennel flower) is a small genus in the tribe Nigelleae (with 18 species) of the Ranunculaceae family (Zohary, 1983; Dönmez et al., 2021) (Supplementary Table 1), native to Southern Europe, North Africa, South Asia, Southwest Asia and Middle East (Tutin, 1964; Zohary, 1983; Raab-Straube et al., 2014) (Supplementary Figure 1). Fourteen species belong to Nigella, among which N. sativa L. (black cumin) is the most popular medical plant and additionally its seeds are used as spices. N. damascena L. and N. arvensis are annual ornamental and medicinal plants (Ghosh and Datta, 2006; Malhotra, 2012; Shaker et al., 2017). Komaroffia bucharica and K. integrifolia belong to the Komaroffia tribe (the sister tribe of Nigelleae), that Zohary accepted as synonyms for Nigella bucharica and N. integrifolia (Zohary, 1983; Heiss et al., 2011; Dönmez et al., 2021). N. bucharica and N. integrifolia are of great importance for beekeeping, as they provide bees with nectar and pollen in south Uzbekistan (Atamuratova et al., 2021). The diploid species, N. sativa, N. damascena, N. arvensis, N. hispanica and N. orientalis (2n = 2x = 12), have five metacentric and one telocentric chromosome pairs, but N. bucharica and N. integrifolia (2n = 2x = 14) have four metacentric, two submetacentric and one subtelocentric chromosome pairs (Gilot-Delhalle et al., 1976). The 1C-values of N. sativa and N. damascena were determined to be 10.39 Gbp (Bennett and Smith, 1976) and 10.29 Gbp (Evans et al., 1972; Kuznetsova et al., 2017; Leitch et al., 2019), respectively. There is little information about the genome composition and cytogenetic characteristics of Nigella species although such information is important to understand the phylogenetic relationship in this genus. Repetitive DNAs are highly enriched in plant genomes, and repetitive fractions among plant genomes are highly variable, ranging for example from 13–14% in the small genome of Arabidopsis thaliana (157 Mbp/1C) (Bennett et al., 2003), to up to 92% in Allium cepa with a rather large genome (16 Gbp/1C) (Fu et al., 2019). Transposons and tandem repeat DNAs (including satellites and ribosomal DNAs) are major repetitive sequences in eukaryotic genomes (Wicker et al., 2007; Mehrotra and Goyal, 2014; Bao et al., 2015; Piégu et al., 2015; Maumus and Quesneville, 2016). Satellites are commonly used as molecular and cytogenetic markers in studies of the genetic diversity and chromosome evolution due to their species-, or even chromosome-specificity (Elder and Turner, 1995; Ugarkovic and Plohl, 2002; Garrido-Ramos, 2017; Samoluk et al., 2017; Belyayev et al., 2019). Although 45S (18S-5.8S-25S) and 5S rDNA have been widely used as cytological markers for chromosome identification and investigations of chromosomal rearrangements occurring between related species (Mukai et al., 1991; Zoldos et al., 1999; Frello and Heslop-Harrison, 2000; Tagashira and Kondo, 2001; Datson and Murray, 2003), the ITS sequences of 45S rDNA are rather variable between species. In addition to large-scale chromosomal rearrangements, such as inversions and translocations, the high variation in copy number and distribution of tandem repeats can lead to genome divergence and karyotype changes between closely related species (Appels et al., 1980; Mukai et al., 1991; Levin and Donald, 2002). In this study, we analyzed and compared the repeat composition of N. sativa, N. damascena and N. bucharica using low-coverage genome sequences. Furthermore, we generated karyotypes of seven Nigella species using FISH mapping of major satellite repeats and rDNAs. Types and patterns of satellite repeats and number of chromosomes agreed with the phylogenetic relationships revealed by using ITS and rbcL sequences.

Materials and Methods

Plant Materials

Seeds of seven Nigella species, N. sativa, N. damascena, N. arvensis, N. bucharica, N. hispanica, N. integrifolia and N. orientalis, were provided by the IPK Genebank in Germany (Table 1, Supplementary Table 1, and Supplementary Figure 2). All species were used for phylogenetic analysis and FISH karyotyping. N. sativa, N. damascena and N. bucharica were further used in a comparative analysis of their genome repetitive compositions.
TABLE 1

Nigella species and accessions used in the present study.

Nigella speciesAccession numberaChromosome number (2n = 2x)Genome size (Gb/1C)Pair number of 45S rDNA lociPair number of 5S rDNA loci
N. arvensis L.NIGE 5127.85141
N. bucharica Schipcz.NIGE 15147.39831
N. damascena L.NIGE 1011211.82642
N. hispanica L.NIGE 28128.732101
N. integrifolia RegelNIGE 31147.44331
N. orientalis L.NIGE 341212.44133
N. sativa L.NIGE 611211.71932

Nigella species and accessions used in the present study.

Genome Size Measurement

To isolate nuclei, approximately 0.5 cm2 of fresh leaf tissue from a Nigella species and the internal reference standard, Pisum sativum L. subsp. sativum convar. sativum var. ponderosum Alef., Sorte Viktoria, Kifejtö Borsó, Gatersleben Gene Bank accession number: PIS 630, were chopped together in a petri dish using the reagent kit ‘CyStain PI Absolute P’ (Sysmex-Partec) following the manufacturer’s instructions. The nuclei suspension was filtered through a 50-μm CellTrics filter (Sysmex-Partec) and measured on a CyFlow Space flow cytometer (Partec-Sysmex). For each genotype, at least six independent measurements were performed. The absolute DNA content (pg/2C) was calculated based on the values of the G1 peak means and converted to the corresponding genome size (Mbp/1C) according to Dolezel et al. (2003).

DNA Extraction and Sequencing

Genomic DNAs were extracted from the leaves of N. sativa, N. damascena and N. bucharica using the CTAB method described in Saghai-Maroof et al. (1984), Aboul-Maaty and Oraby (2019). Paired-end (2 × 150 bp) genome sequencing was performed using the Illumina HiSeq 2500 system in a low-coverage scale by Novogene (China). The coverage of sequenced genome was calculated according to the following equation: Coverage = (Number of reads × size of each read)/1C content of the genome.

Graph-Based Identification of Genome Repetitive Sequences

The quality and GC content of paired-end reads of each species was checked using FastQC (Andrews, 2010) implanted in the RepeatExplorer. The sequence reads were filtered by the quality of 95% of bases equal to or above the quality cut of value of 10. Paired reads were joint using FASTA interlacer tool and pairs with no overlap were selected for the graph-based clustering analysis. The identification and characterization of the repetitive DNA families were then performed using the RepeatExplorer pipeline (Novak et al., 2013; Novák et al., 2017, 2020) with the default setting of 90% similarity over 55% of the read length. Consensus sequences of the identified repeat monomers were reconstructed by TAREAN (TAndem REpeat ANalyzer) (Novák et al., 2017). Comparative RepeatExplorer analysis was performed to identify shared and species-specific repeat clusters. The “Nd,” “Ns,” and “Nb” were used as prefix codes of N. damascena, N. sativa and N. bucharica, respectively. The sequence dataset of each species was then down-sampled to 20% of each genome size (16 million reads for N. sativa and N. damascena and 10 million reads for N. bucharica), followed by a concatenation into a single data file. The settings for comparative clustering analysis were the same as those for individual analysis mentioned above. The sizes of repeat clusters were normalized based on the genome size of analyzed species using optparse package of R version 4.0.2 (The R Project for Statistical Computing, Vienna, Austria). The monomer of (peri)centromeric satellite sequences were aligned using Clustal Omega (Madeira et al., 2019) and viewed in MView (Brown et al., 1998). The 18S, 5.8S, and 26S coding regions of the identified 45S rDNA and the coding region of 5S rDNA were distinguished by referring to the publicly available rDNA coding sequences in NCBI.

Polymerase Chain Reaction

To amplify the repeat DNAs, the consensus sequences of satellite repeats and one LTR element identified were used to design primers using Primer3 (Untergasser et al., 2012). The monomer and primer sequences were listed in Supplementary Table 2. The PCR mixture contained 25 ng of genomic DNA as template, 2.5 mM of each dNTP, 2.5 mM MgCl2, 5 pmol of each primer, and 0.5 U Taq DNA polymerase. PCR amplification was performed for 5 min at 94°C, followed by 30 cycles of 30 s at 94°C, 1 min at 52-60°C (depending on primers), 1 min at 72°C and a final extension for 7 min at 72°C. The size of PCR products was checked in 1% agarose gel by electrophoresis.

Probe Preparation

PCR products were purified by ethanol precipitation. One microgram of each purified PCR products was labeled with Atto488-11-dUTP or Atto550-11-dUTP using a nick translation kit (Jena Bioscience, Germany), recovered by ethanol precipitation and used as FISH probes. For rDNA probes, the 45S rDNA and 5S rDNA containing clones pTa71 (Gerlach and Bedbrook, 1979) and pTa794 (Gerlach and Dyer, 1980), respectively, were labeled with Atto488-11-dUTP and Atto550-11-dUTP by nick translation as mentioned above. To investigate whether Nigella species possess Arabidopsis-like telomeric repeats, FISH was performed using Arabidopsis-type telomere repeats (TTTAGGG)n as a probe, which was generated by non-template PCR according to IJdo et al. (1991) using (TTTAGGG)3 and (CCCTAAA)3 as primers. One microgram of the purified PCR product was labeled with Atto550-11-dUTP as described above, recovered by ethanol precipitation and used as FISH probes.

Slide Preparation

Nigella seeds were germinated on moist filter paper in petri dishes for 3–6 days at room temperature. Roots were subjected to nitrous oxide (N2O) gas at 10 bar pressure for 2 h to arrest dividing cells at metaphase. Treated roots were fixed in ice-cold 90% acetic acid for 10 min, then transferred to 75% ethanol and stored at −20°C until use. Roots were first washed in ice-cold water, followed by 0.01 M citrate buffer (0.01 M citric acid and 0.01 M sodium citrate, pH 4.8) each for 10 minutes. Root meristems were placed in a microtube containing 30 μl enzyme mixture [0.7% cellulase (CalBiochem 219466), 0.7% cellulase R10 (Duchefa C8001), 1% cytohelicase (Sigma C8274) and 1% pectolyase (Sigma P3026) in 0.01 M citrate buffer] and were digested at 37°C for 60 to 90 minutes. Slides were prepared using the dropping method according to Abdolmalaki et al. (2019). The specimens were fixed in 4% paraformaldehyde in 1 × PBS (3 mM NaH2PO4, 7 mM Na2HPO4, 0.13 M NaCl, pH 7.4) for 10 min at room temperature, followed by washing in 2 × SSC (0.3 M sodium chloride, 0.03 M sodium citrate, pH 7.0) and dehydrating in 96% ethanol.

Fluorescence in situ Hybridization

FISH and reprobing was performed according to Abdolmalaki et al. (2019). Briefly, 20 μl of hybridization mixture, containing 2 × SSC, 50% formamide, 20% dextran sulfate, 1 μg sheared salmon testes DNA and 20–30 ng of each labeled probe, was applied on each slide and covered with a plastic coverslip. Specimens were then denatured at 80°C for 2 min on a hot plate and were incubated in a humidified plastic container at 37°C, overnight. Coverslips were removed and slides were washed in 2 × SSC for 20 minutes in a water bath at 56°C. Slides were dehydrated in 96% ethanol and dried at room temperature. A drop of Vectashield mounting medium (Vector Laboratories) containing 1 μg/ml DAPI (4′, 6-diamidino-2-phenylindole) was added to each slide as counterstain and a glass coverslip was applied. Slides were inspected with a fluorescence Olympus BX51 microscope (Olympus, Japan), and images were captured using a DP72 digital camera (Olympus, Japan).

Numerical Characterization of Karyotypes

Chromosomal and karyotypic indices for numerical characterization of mitotic metaphase chromosomes of the Nigella species were measured using IdeoKar software (Mahmoudi and Mirzaghaderi, 2021). The calculated indices include total chromosome length of the haploid complement (HCL); mean chromosome length (CL), and mean centromeric index (CI). Karyotype asymmetry was determined using the A1 (intrachromosomal asymmetry index) and A2 (interchromosomal asymmetry index) indices calculated using Σ(b/B)/n and s/x equations, respectively, where b and B are the mean lengths of the short and long arms of each homologous chromosome pair, respectively; n is the number of homologs, and s and x are standard deviation and mean of the chromosome length, respectively (Romero-Zarco, 1986). Three high-quality FISH-banded metaphase chromosome spreads were traced for each species. The description of chromosome morphology was based on the nomenclature proposed by Levan et al. (1964). Idiograms were generated using the R package “idiogramFISH” (Roa and Telles, 2020).

Phylogenetic Analysis

The ITS1-5.8S-ITS2 region of 45S rDNA in N. sativa, N. damascena and N. bucharica were identified by RepeatExplorer analysis and were extracted using BLASTn at NCBI database. N. damascena complete chloroplast sequence (MN648403.1) was downloaded from NCBI and used as a reference genome to assemble the chloroplast sequence of N. sativa using CLC software. The reference-aided assembled genome was annotated using the GeSeq annotation tool (Tillich et al., 2017). The conserved sequences flanking the ITS1-5.8S-ITS2 and rbcL gene were used to design PCR primers to amplify and sequence the corresponding regions in the other five Nigella genomes (Supplementary Tables 2–4). The ITS1-5.8S-ITS2 and rbcL sequences were used as input for multiple sequence alignment by MUSCLE algorithm using MEGA11 software (Tamura et al., 2021). The concatenated ITS1-5.8S-ITS2 and rbcL sequences were used to build a maximum likelihood tree with 500 bootstrapping replications in MEGA11.

Results

Nigella Is Characterized by Relatively Large Genomes

According to flow cytometric estimation of the DNA content, Nigella orientalis has the largest genome with 12.44 Gbp/1C among the seven species, followed by N. damascena and N. sativa with 11.72 Gbp/1C and 11.83 Gbp/1C, respectively (Table 1 and Figure 1). N. hispanica (8732 Mbp/1C), N. arvensis (7851 Mbp/1C), N. integrifolia (7443 Mbp/1C) and N. bucharica (7398 Mbp/1C) have considerably smaller genomes than those of the other three species mentioned above.
FIGURE 1

Phylogeny and idiograms of Nigella. A maximum likelihood phylogenetic tree of Nigella species with 500 bootstrap replications inferred from ITS1-5.8S-ITS2 and rbcL sequences. A. carmichaelii has been included as an outgroup. The tree has been annotated with idiograms (showing the locations of the identified satellite repeats and 45S and 5S arrays), karyotypic parameters and the estimated DNA C-values. The asterisk in N. hispanica indicates the hemizygous locus. Chr.: Chromosome; A1: intrachromosomal asymmetry index; and A2: interchromosomal asymmetry index; Levan: the description of chromosome morphology was based on the nomenclature proposed by Levan et al. (1964), AR: arm ratio (long arm/short arm).

Phylogeny and idiograms of Nigella. A maximum likelihood phylogenetic tree of Nigella species with 500 bootstrap replications inferred from ITS1-5.8S-ITS2 and rbcL sequences. A. carmichaelii has been included as an outgroup. The tree has been annotated with idiograms (showing the locations of the identified satellite repeats and 45S and 5S arrays), karyotypic parameters and the estimated DNA C-values. The asterisk in N. hispanica indicates the hemizygous locus. Chr.: Chromosome; A1: intrachromosomal asymmetry index; and A2: interchromosomal asymmetry index; Levan: the description of chromosome morphology was based on the nomenclature proposed by Levan et al. (1964), AR: arm ratio (long arm/short arm).

Two Different Karyotypes Are Prevailing in Nigella

Chromosomes of Nigella species were mainly metacentric with one or two telocentric chromosome pairs in each species. Based on their basic chromosome number, the seven species can be classified into two groups. The first group, comprising N. arvensis, N. damascena, N. hispanica, N. orientalis and N. sativa, has a basic chromosome number of x = 6 (2n = 2x = 12) with a karyotype formula of 10m + 2t. N. bucharica and N. integrifolia belong to the second group with a basic chromosome number of x = 7 (2n = 2x = 14) and a karyotype formula of 8m + 2st + 4t. All these species fell into the 2A category of Stebbin’s asymmetry indices (Stebbins, 1971; Figure 1). The size of metacentric chromosomes ranged from 5.99 μm (N. bucharica) to 10.14 μm (N. damascena) and the telocentric chromosome size ranged from 4.04 μm (N. bucharica) to 5.51 μm (N. damascena). N. bucharica and N. integrifolia also have a pair of subtelocentric chromosomes with a size range from 4.54 to 4.71 μm. The total metaphase chromosome length was between 38.21 μm in N. bucharica and 53.17 μm in N. damascena (Supplementary Table 5).

The Number of rDNA Loci Varies Severely Between the Species

To determine the karyotype evolution among the seven Nigella species, FISH mapping of 45S and 5S rDNA loci on mitotic chromosomes was performed (Figure 2). FISH of both ribosomal probes revealed a considerable interspecific variation regarding the number and position of rDNA loci (Figures 1A, 2). While three 45S rDNA-positive chromosome pairs were observed in N. sativa, N. orientalis, N. integrifolia and N. bucharica (Figures 2A–D), four pairs of 45S rDNA loci were present in N. damascena and N. arvensis (Figures 2E,F). N. hispanica revealed ten pairs of 45S rDNA loci, the highest number among the investigated species. Each chromosome of this species harbors at least one 45S rDNA locus. Interestingly, one of the 45S rDNA sites in N. hispanica did not show a signal on its corresponding homologous chromosome representing hemizygosity (Figures 1A, 2G). While in N. sativa, N. arvensis, N. hispanica and N. damascena, 45S rDNA loci were found on metacentric and telocentric chromosomes, 45S rDNA loci were exclusively found on metacentric chromosomes in N. orientalis or on submetacentric and telocentric chromosomes in N. bucharica and N. integrifolia (Figure 2). The 5S rDNA was found on one (N. integrifolia, N. bucharica, N. arvensis and N. hispanica) (Figures 2C,D,F,G), two (N. sativa and N. damascena) (Figures 2A,E) or three (N. orientalis) (Figure 2B) chromosome pairs. 45S rDNA loci are located mainly either in distal or proximal regions of the chromosome arms, while 5S rDNA arrays were also found interstitially. The size of hybridization signals varied between chromosome pairs both within and between species (Figure 2).
FIGURE 2

rDNA loci distribution of the studied Nigella species. FISH mapping of 45S rDNA (green) and 5S rDNA (red) on mitotic metaphase chromosomes of N. sativa (A), N. orientalis (B), N. integrifolia (C), N. bucharica (D), N. damascena (E), N. arvensis (F) and N. hispanica (G). Chromosomes were counterstained with DAPI. Arrows indicate weak 45S rDNA signals and the asterisks indicate the homologous chromosomes with hemizygous locus. Scale bar 10 μm.

rDNA loci distribution of the studied Nigella species. FISH mapping of 45S rDNA (green) and 5S rDNA (red) on mitotic metaphase chromosomes of N. sativa (A), N. orientalis (B), N. integrifolia (C), N. bucharica (D), N. damascena (E), N. arvensis (F) and N. hispanica (G). Chromosomes were counterstained with DAPI. Arrows indicate weak 45S rDNA signals and the asterisks indicate the homologous chromosomes with hemizygous locus. Scale bar 10 μm.

Molecular Phylogenetic Analysis of ITS and rbcL Sequences Correlate With the Basic Chromosome Numbers

To determine the phylogenetic relationship among the analyzed Nigella species, the sequences of nuclear ribosomal internal transcribed spacer (ITS) and rbcL gene were used. The sequence length of ITS (ITS1-5.8S-ITS2) varied from 732 to 759 bp (Supplementary Table 3), whereas rbcL sequences ranged from 871 to 1428 bp (Supplementary Table 4) in the seven Nigella species. Aconitum carmichaelii, a distantly related species belonging to the same family, was used as an outgroup, and the resulting consensus had high bootstrap support values (Figure 1). N. bucharica and N. integrifolia formed a robust cluster with 100% bootstrap support, and both of them have a basic chromosome number of x = 7. The other cluster included N. sativa, N. arvensis and N. hispanica (with 84% bootstrap support), to which N. damascena and N. orientalis were jointed with lower support. All members of this cluster possess a chromosome number of 2n = 12. The clustering of the seven Nigella species based on molecular phylogenetic analysis correlates with their basic chromosome number (x = 6 or 7). The phylogenetically close N. integrifolia and N. bucharica have the same chromosome number, similar genome size and rDNA-based karyotypes. Nevertheless, among the other five species, despite having the same chromosome number, their genome size, the number and chromosomal distribution of rDNA loci are diverse.

Retroelements Are the Dominating Repeat Type in Nigella While Satellite Sequences Are Rare

Low-pass sequencing of N. sativa, N. damascena and N. bucharica genomes resulted in 4,232,251, 7,553,644, and 15,352,348 Illumina 150 bp paired-end reads corresponding to 0.24×, 0.43×, and 1.50× genome coverage, respectively. The GC content for N. sativa and N. damascena genomes showed a value of 38%, while this value was 42% for N. bucharica. The repeat compositions were inferred from the paired-end reads corresponding to approximately ∼0.2× of the genome for each analyzed species. The proportions of individual repeat types are presented in Table 2. About 57.52, 59.01, and 64.73% of N. sativa, N. damascena and N. bucharica genomes are composed of high- or moderate-copy repeats, respectively. The majority of the repeats (47.91% in N. sativa, 39.47% in N. damascena, and 51.25% in N. bucharica) are retroelements, followed by unclassified repeats (6.95, 17.30, and 10.10%) and tandem repeats (0.75, 0.39, and 0.74% of rDNAs and 0.75, 1.21, and 1.45% of satellites). The proportions of 45S rDNA repeats in N. sativa, N. damascena and N. bucharica genomes were 0.72, 0.38, and 0.65%, respectively, while the 5S rDNA proportions were 0.03%, 0.01% and 0.09% as determined by RepeatExplorer analysis (Table 2). The consensus monomers of the rDNA sequences in N. sativa, N. damascena and N. bucharica identified by TAREAN are listed in Supplementary Table 6. Among the retroelements, LTR retroelements are the most abundant in the N. sativa (47.91%), N. damascena (39.47%) and N. bucharica (51.25%) genomes. LTRs in N. sativa include Ty3–gypsy and Ty1–copia super families with a proportion of 44.01 and 3.76% in the genome, respectively, while they compose 37.77 and 1.64% in N. damascena and 48.55 and 2.58% in N. bucharica. A major part (34.89% in N. sativa, 26.19% in N. damascena and 30.99% in N. bucharica) of Ty3–gypsy belongs to the retrotransposon chromoviral Tekay clade (Table 2). In contrast, DNA transposons contribute to only 1.13, 0.62, and 1.19% of the N. sativa, N. damascena and N. bucharica genomes, respectively, and only three common DNA transposons, EnSpm_CACTA, MuDR_Mutator and PIF_Harbinger, were identified. EnSpm_CACTA composes 0.72% of the N. sativa genome, but its proportion was much lower in N. damascena (0.24%) and N. bucharica (0.16%). MuDR_Mutator comprises about 0.32% of N. sativa, 0.34% of N. damascena and 0.71% of N. bucharica genome. Also, PIF_Harbinger composes 0.32% of the N. bucharica genome, but its proportion was lower than 0.1% in N. sativa (0.06%) and N. damascena (0.04%). The DNA transposon hAT was only detected in N. sativa (Table 2).
TABLE 2

Types and proportions of highly-repetitive sequences in N. sativa, N. damascena and N. bucharica characterized by RepeatExplorer2.

RepeatGenome proportion (%)
N. sativa N. damascena N. bucharica
LTR retroelementTy1_copiaAngela2.470.611.11
LTR retroelementTy1_copiaBianca0.140.080.02
LTR retroelementTy1_copiaIkeros0.210.120.13
LTR retroelementTy1_copiaIvana0.110.060.02
LTR retroelementTy1_copiaSIRE0.450.39
LTR retroelementTy1_copiaTAR0.240.230.77
LTR retroelementTy1_copiaTork0.130.140.53
LTR retroelementTy1_copiaAle0.010.01
LTR retroelementTy3_gypsyAthila6.468.267.23
LTR retroelementTy3_gypsyRetand2.332.6510.04
LTR retroelementTy3_gypsy (chromovirus)CRM0.310.550.26
LTR retroelementTy3_gypsy (chromovirus)Tekay34.8926.1930.99
LTR retroelementTy3_gypsy (chromovirus)Galadriel0.020.090.03
LTR retroelementTy3_gypsy (chromovirus)Reina0.03
LTR retroelementLINE0.140.060.12
Total LTR retroelement47.9139.4751.25
Pararetrovirus0.030.02
DNA transposonEnSpm_CACTA0.720.240.16
DNA transposonMuDR_Mutator0.320.340.71
DNA transposonhAT0.03
DNA transposonPIF_Harbinger0.060.040.32
Total DNA transposon1.130.621.19
rDNA45S_rDNA0.720.380.65
rDNA5S_rDNA0.030.010.09
Satellite0.751.211.45
Tandem repeads1.501.602.19
Unclassified6.9517.3010.10
Total high- or moderate copy repeats57,5259,0164,73
Non-clustered reads (low-copy sequences)42.4840.9935.27

The repeats grouped according to their repeat class and lineage. “-”: not detected.

Types and proportions of highly-repetitive sequences in N. sativa, N. damascena and N. bucharica characterized by RepeatExplorer2. The repeats grouped according to their repeat class and lineage. “-”: not detected. To compare the repeat compositions between the genomes of N. sativa, N. damascena and N. bucharica, a comparative clustering analysis was performed. About a quarter of the top clusters (Figure 3) are shared between the species. Not all of these clusters had similar abundance in the genomes. Out of the in total 272 major repeat clusters, only 16 clusters (5.88%) were relatively evenly shared between the three genomes, and they were annotated as Ty1_copia-TAR and Tork, Ty3_gypsy-Athila, DNA transposon-EnSpm CACTA and rDNAs (Figure 3). Up to 97 clusters (35.66%) were almost N. bucharica specific, and shared clusters between N. bucharica and either N. damascena or N. sativa were barely detectable. N. damascena and N. sativa contributed to 123 and 120 clusters, respectively, of which 77 clusters were shared between the two genomes, whereas 61 and 37 of them were highly enriched or specific to N. damascena and N. sativa, respectively. The comparative analysis demonstrated that N. bucharica is relatively more distinct from N. damascena and N. sativa. This result is in line with their phylogenetic relationships inferred based on ITS and rbcL sequences. The monomer length and cluster proportion of satellites and high copy retrotransposons identified by TAREAN is listed in Supplementary Table 7. Most of retrotransposons were common between N. sativa and N. damascena, (Supplementary Table 7).
FIGURE 3

Comparative analysis of genome repetitive composition among three Nigella species. (A) Bar plot of N. damascena, N. sativa and N. bucharica showing the sizes (numbers of reads) of individual clusters. (B) Rectangle size is proportional to the number of reads in a cluster for each species. Clusters were sorted by using hierarchical clustering and the rectangles are colored based on their cluster annotation. (C) The size of the rectangles in (B) was normalized based on the genome size of analyzed species. Species codes: ND, N. damascena; NS, N. sativa; Nb, N. bucharica.

Comparative analysis of genome repetitive composition among three Nigella species. (A) Bar plot of N. damascena, N. sativa and N. bucharica showing the sizes (numbers of reads) of individual clusters. (B) Rectangle size is proportional to the number of reads in a cluster for each species. Clusters were sorted by using hierarchical clustering and the rectangles are colored based on their cluster annotation. (C) The size of the rectangles in (B) was normalized based on the genome size of analyzed species. Species codes: ND, N. damascena; NS, N. sativa; Nb, N. bucharica.

(Peri)centromeric Satellites Reflect the Phylogenetic Relationship in Nigella

The application of the TAREAN pipeline (Novák et al., 2017) allowed the identification of tandem repeat clusters in Nigella species. Two satellite repeats in N. sativa, i.e., Ns-Sat1 (CL21) and Ns-Sat2 (CL144) were detected, representing 0.52 and 0.01% of the genome, respectively (Table 3). Only one satellite repeat, named Nd-Sat1 (CL23), was identified in N. damascena which corresponds to 0.52% of the genome. On the other hand, four satellite repeats, Nb-Sat1 (CL21), Nb-Sat2 (CL129), Nb-Sat3 (CL64) and Nb-Sat4 (CL144), were identified in N. bucharica, representing 0.86, 0.08, 0.42, and 0.03% of the genome, respectively. All these repeats represented satellite-typical globular graph layouts, and their consensus monomer sequences are available in Supplementary Table 2. The monomers of Ns-Sat-1, Ns-Sat-2 and Nd-Sat-1 are all 178 bp in length and AT-rich (e.g., 68% AT for Ns-Sat1) (Table 3 and Supplementary Figure 3). Their sequence similarity ranged from 78.8% (between Ns-Sat1 and Nd-Sat1) to 71.8% (between Ns-Sat1 and Ns-Sat2). In addition, the monomer sequence of the Ty3_gypsy LTR-annotated retrotransposon, Ns-CL6, was reconstructed. To determine the chromosomal distribution of the identified repeats, the corresponding DNA fragments were PCR amplified using the respective primers and labeled as FISH probes (Table 3).
TABLE 3

Repeats used as probes in FISH experiments on N. sativa, N. damascena and N. bucharica chromosomes.

RepeatClusterRepeat typeMonomer bpGenome proportion%PCR Primers (5′→ 3′)
Ns-Sat1CL21Satellite1780.52F: AAGATCGCGTAAAACAGACGA R: TCAAAAACTTGAACGAATTCAAAA
Ns-Sat2CL144Satellite1780.013F: ATCCGCTCGTTCGTCCATTT R: TCATTCGCGTAAAACTCGTGA
Ns-CL6CL6Transposon6,4652.3F: AGGCAAACCAGGTACCACTG R: TTGGCAAATGGATGTCAAGA
Nd-Sat1CL23Satellite1780.52F: CATGTAATGACAAACGGATCG R: TCAAAGGTTTGCTAATTTTCCA
Nb-Sat1CL64Satellite210.42F: TGGGGTTGGCAAGGCATG R: GGCCATGCCTTGCCAACC
Nb-Sat2CL144Satellite1590.034F: GACAATTCGGGTCTTCGC R: GTTTCTTCACTATGGTCCCCC
Nb-Sat3CL21Satellite1350.86F: TGAATTTGCAATAAACACCAAG R: CTTGCCATTTCATGACTTTCG
Nb-Sat4CL129Satellite390.077F: TTGCAAGTTCTTGAGTTTCT R: TGCAAGAAACTCAAGAACTT

Repeat type, monomer length, their proportion in genome, and primer pairs used for their amplification are indicated. Other information including monomer sequences and FISH conditions are presented in

Repeats used as probes in FISH experiments on N. sativa, N. damascena and N. bucharica chromosomes. Repeat type, monomer length, their proportion in genome, and primer pairs used for their amplification are indicated. Other information including monomer sequences and FISH conditions are presented in After FISH, all metaphase chromosomes of N. sativa revealed (peri)centromeric Ns-Sat1 signals while Ns-Sat2 localized in the (peri)centromeric regions of only chromosomes 1 and 4 (Figures 4A,B). The Ns-CL6 probe which is a Ty3_gypsy LTR retrotransposon, resulted in evenly distributed signals, although with a lower density toward the distal chromosome regions (Figure 4A). Nd-Sat1-specific signals were found in the (peri)centromeric regions of all N. damascena chromosomes (Figure 4C). Ns-Sat1 also cross-hybridized to the (peri)centromeric regions of N. arvensis and N. hispanica (Figures 4D,E). The Nd-Sat1 of N. damascena also cross-hybridized to the (peri)centromeric regions of N. orientalis (Figure 4F). None of the Nd-Sat1, Ns-Sat1 and Ns-Sat2 probes cross-hybridized with N. integrifolia or N. bucharica. The observed clustering of (peri)centromeric repeats at one pole of the nuclei indicates a Rabl-like chromosome configuration in interphase nuclei of Nigella (Figures 4A,E).
FIGURE 4

Chromosomal distribution of the identified high-copy repeats of Nigella. FISH results using the identified satellite repeats and Arabidopsis-type telomeric repeat probe (TTTAGGG)n probes on mitotic metaphase chromosomes of N. sativa (A,B,I), N. damascena (C), N. arvensis (D), N. hispanica (E), N. orientalis (F) and N. bucharica (G,H). The Ns-CL6 (red) repetitive sequence is dispersed throughout the genome (A), while the satellite sequences are mostly (peri)centromeric. Scale bar 10 μm.

Chromosomal distribution of the identified high-copy repeats of Nigella. FISH results using the identified satellite repeats and Arabidopsis-type telomeric repeat probe (TTTAGGG)n probes on mitotic metaphase chromosomes of N. sativa (A,B,I), N. damascena (C), N. arvensis (D), N. hispanica (E), N. orientalis (F) and N. bucharica (G,H). The Ns-CL6 (red) repetitive sequence is dispersed throughout the genome (A), while the satellite sequences are mostly (peri)centromeric. Scale bar 10 μm. The observed hybridization signals of all four Nb satellite probes showed similar intensities, locations and numbers in N. bucharica and N. integrifolia (Figure 1). Nb-Sat1 seems to co-localize with the 45S-rDNA loci, since it is found in terminal positions on the short arms of the two telocentric and the submetacentric chromosomes. Nb-Sat2 revealed signals on the distal ends of the long arm of the telocentric chromosomes (Figure 4G), while Nb-Sat3 and Nb-Sat4 showed signals in (peri) centromeric positions of all chromosomes (Figures 1A, 4H). It seems that at least in some of the chromosomes Nb-Sat3 is extended toward the inner part of the centomeres compared with Nb-Sat4 (arrows in Figure 4H). FISH with the Arabidopsis-type telomere repeat (TTTAGGG)n detected corresponding signals exclusively at both ends of all Nigella chromosomes (Figure 4I). The genome-wide repetitive analysis in the three Nigella species indicated that retroelements, especially Ty_gypsy LTRs, are the main contributors to the relatively large genomes of Nigella. On the contrary, the abundance and diversity of satellite DNAs are relatively low. Most of these satellites locate at (peri)centromeric regions. The (peri)centromeric satellite repeats of N. sativa (Ns-Sat1), N. damascena (Nd-Sat1) and N. bucharica (Nb-Sat3 and Nb-Sat4) are highly distinct and cross-hybridized only to the closely related genomes as indicated in Figure 1.

Discussion

We studied the phylogenetic relationship and karyotype structure of seven Nigella species by using sequences of ITS and rbcL gene, analyzing the repeatome and FISH mapping. Except for N. sativa and N. damascena, whose genome sizes were previously reported, the genome size of the other species was estimated for the first time. N. orientalis, N. damascena, and N. sativa have roughly 1.5 times larger genomes than N. arvensis, N. hispanica, N. bucharica and N. integrifolia. The DNA C-values estimated for N. sativa and N. damascena were quite similar to the previous estimations based on Feulgen densitometry [10.30 and 10.58 Gbp/1C for N. damascena (Evans et al., 1972; Olszewska and Osiecka, 1983) and 10.39 Gbp/1C for N. sativa (Bennett and Smith, 1976). The slight differences might be explained by the different methods used (Feulgen densitometry versus flow cytometry) and/or the different reference standards used (P. sativum versus Allium cepa). In spite of the smaller genome sizes, N. bucharica and N. integrifolia have with a genome formula of 2n = 2x = 14 one additional chromosome pair more than the other species (basic chromosome number x = 6). A previous study using Giemsa C-banding on Nigella chromosomes (Gilot-Delhalle et al., 1976) suggested that the telocentric chromosomes originated from a centromeric fission event of a metacentric chromosome. Subsequent structural rearrangements might have formed the submetacentric chromosome in N. bucharica and N. integrifolia (Gilot-Delhalle et al., 1976). The morphology of the studied species is rather similar except for N. bucharica and N. integrifolia, which have distinct flower and leaf morphology (Supplementary Figure 3). Both species, in turn, show substantial morphological, karyological and sequence similarities, which raises the question if they should be classified as varieties of a single species instead of two independent species. N. sativa, N. damascena, N. arvensis, N. hispanica and N. orientalis showed similar karyotypes in terms of chromosome numbers and morphology, but the patterns of 5S and 45S rDNA loci differ between species, suggesting that the evolution of these species was accompanied by chromosomal segment rearrangements such as inversions, translocations and Robertsonian fission or mobility of rDNA loci without noticeably affecting the arm ratios. Similarly, in a cytogenetic survey of the Ranunculaceae, the number, location and intensity of rDNA signals varied between various species of Pulsatilla and Anemone genera. Most of the 45S rDNA loci in these genus are located at distal regions of the short arms of acrocentric chromosomes, while 5S rDNA loci don’t show preferential chromosomal positions. Such a rDNA mobility might be the result of homologous and non-homologous recombination mechanisms and retroelement-mediated rDNA transpositions (Mlinarec et al., 2006, 2012; Sramkó et al., 2019). Variation in the number and position of rDNA loci has also been reported among other species such as e.g., legumes (Abirached-Darmency et al., 2005). rDNA might be moved by transposition, as previously shown in Allium species and their hybrids (Schubert, 1984). In fact, rDNA sequences are conserved, but their chromosomal distribution is a source of species differentiation and evolution (Raskina et al., 2008). In Nigella, the number of 45 rDNA loci varied from three to ten. However, no positive correlation between the loci number and genome size was observed. While the three larger genomes (N. sativa, N. damascena and N. orientalis) all showed only three loci, the highest number was found in N. hispanica which has a rather small genome. Also in diploid lineages of Brassicaceae (Hasterok et al., 2006), Cyperaceae (Da Silva et al., 2010), Iris (Martinez et al., 2010), and Rosaceae (Mishima et al., 2002) no positive correlation exists between the number of rDNA arrays and the number of chromosomes or genome size. The presence of additional 45S rDNA loci in N. damascena (4 loci), N. arvensis (4 loci) and N. hispanica (10 loci) compared with N. sativa, N. orientalis, N. integrifolia and N. bucharica (all 3 loci) may be due to independent formation of a separate 45S rDNA array after the divergence of these species. N. hispanica also showed hemizygosity for one 45S rDNA site. rDNA site hemizygosity has been reported in other genera such as Anacyclus (Rosato et al., 2017), Vicia (Li et al., 2001), Chrysanthemum (He et al., 2021) and Lilium (Wang et al., 2012). In most cases such a heterozygosity is related to hybridization events. The reason for the detected hemizygous locus in Nigella remains to be elucidated. Similarly, it is not clear if this heterozygosity is only occurring in the investigated genotype or if it is a general feature of N. hispanica. Overall, 45S rDNA composed about 0.38, 0.72, and 0.65% of the N. damascena, N. sativa and N. bucharica genomes, respectively (Table 2). The relative amount and size of rDNA units in the nuclear genome can be highly variable, and the rDNA copy number can vary between 150 to 26,048 copies in plants (Prokopowich et al., 2003; Wicke et al., 2011). In Nigella, the majority (47.91% in N. sativa, 39.47% in N. damascena and 51.25% in N. bucharica) of the repeats are retrotransposons (class I transposons), while DNA transposons (class II transposons) contributed to only 1.13, 0.62, and 1.19% of the genomes. Although the three Nigella species possess rather large genomes of about 7.4 to 12.4 Gb/C, only one to four satellite repeats were found in these species, and no correlation was found between the number of satellites and the size of the genome in the studied Nigella species. Interestingly, N. bucharica and N. integrifolia with smaller genome sizes contained a higher number of satellite sequences than the larger genome of N. damascena. The most abundant satellites in the three species were found in (peri)centromeric position on all chromosomes. Ns-CL6 is a retrotransposon distributed over all chromosomes of N. sativa although with a reduced density at distal regions. The reduced frequency of Ns-CL6 at chromosome ends could be explained by the potential enrichment of coding sequences in this region. In many plant species, especially well investigated in cereals, the terminal and subterminal chromosomal regions are often enriched in coding sequences[1]. The rDNA probes alone or in combination with chromosome-specific satellite sequences are useful markers to identify individual chromosomes. While in N. damascena, N. hispanica and N. orientalis the 5S rDNA and 45S rDNA were sufficient to characterize the complete chromosome set, in N. sativa additionally NS-Sat2 was required. In N. arvensis 4 out of 6 and in N. integrifolia and N. bucharica 2 out of 7 chromosome pairs could be unequivocally identified by using the rDNA probes. Sequence alignment indicated that the Ns-Sat1, Ns-Sat2 and Nd-Sat1 (peri)centromeric repeats are similar, suggesting they might share a common origin. However, the retained identity between Ns-Sat1 and Nd-Sat1 (78.8%, Supplementary Figure 2) was not enough for each of them to cross-hybridize on the other species, indicating their sequence divergence after specification. Ns-Sat1, Ns-Sat2 and Nd-Sat1 are all 178 bp long AT-rich satellite repeats. Due to their localization patterns and their length similarity with described centromeric satellites in other species such as Arabidopsis (Copenhaver et al., 1999), human (Choo et al., 1991) and the fish Pungitius pungitius (Varadharajan et al., 2019) it is tempting to speculate that these sequences indeed represent centromeric repeats of Nigella, although a functional proof is still missing. The 178 bp satellite unit is consistent with the 150–180 bp length DNA required to wrap around a single nucleosome (Henikoff et al., 2001). However, the (peri)centromeric satellites in N. bucharica and N. integrifolia (Nb-Sat3 and Nb-Sat4) have a deviating monomer length of only 135 and 39 bp. Our molecular phylogeny using rbcL and ITS1-5.8S-ITS2 sequences grouped the seven Nigella species into three different clades, two groups with x = 6 and the third one with x = 7. These results are in agreement with the morphological classifications reported earlier (Zohary, 1983: Yao et al., 2019). Significant variation observed in the sites and numbers of 45S rDNA loci might be involved in shaping Nigella karyotypes. The more asymmetric karyotype of the third group with additional telo- or subtelocentric chromosomes and the presence of terminal 45S rDNA sites in almost all telo- and subtelocentrics suggest that chromosomal rearrangements might play a role in changing the basic chromosome number (dysploidy) in the genus Nigella. DNA breakage and repair, rDNA mobility and Robertsonian fusions/fissions are suggested as the possible mechanisms during this process (Sramkó et al., 2019).

Conclusion

Overall, our analyses based on the molecular phylogeny, DNA C-value analysis, genomic repeat composition and FISH-karyotyping shed light on the genome organization and evolution of seven Nigella species and supports a classification into three different groups of which two are closer to each other than the third one. The two phylogenetically closer groups (N. sativa, N. arvensis and N. hispanica and accordingly N. damascena and N. orientalis) share the same basic chromosome number (x = 6), and a similar karyotype formula. N. integrifolia and N. bucharica, in contrast, differ with x = 7 from the other five species. The repeatome analysis demonstrated that the genomes of Nigella species increased in size due to the preferential accumulation of Ty3_gypsy retroelements, especially of the Ty3_gypsy-Tekay lineage. In contrast, satellite repeats comprise only a small proportion of the Nigella genomes and are predominantly located at the (peri)centromeric regions. These sequences are only cross-hybridizing within the closely related species and support the proposed grouping. Surprisingly, despite the low total genome proportion of 5S and 45S rDNA, their diverse loci number and patterns on chromosomes of the analyzed species indicated the potential importance of rDNAs in driving the Nigella genome divergence and specification. Additionally, 5S and 45S rDNAs can be further applied as cytogenetic markers for chromosome discrimination and karyotype analysis in the genus Nigella.

Data Availability Statement

The datasets presented in this study can be found in online repositories. The low coverage genomic DNA sequencing data of N. sativa, N. damascena and N. bucharica have been submitted to the Sequence Read Archive (SRA) database (https://www.ncbi.nlm.nih.gov/sra/) under accession number: PRJNA686272.

Author Contributions

FO conducted the experiments and data analysis and assisted in the manuscript writing. GM conceived and designed the research and wrote the manuscript. Y-TK contributed to the data analysis, critical discussions, and manuscript revisions. JF contributed to the flow cytometry analysis and critical discussions. All authors contributed to the article and approved the submitted version.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  44 in total

1.  Distribution of 45S and 5S rDNA sites in 23 species of Eleocharis (Cyperaceae).

Authors:  Carlos Roberto Maximiano da Silva; Carolina Cristina Quintas; André Luís Laforga Vanzela
Journal:  Genetica       Date:  2010-07-31       Impact factor: 1.082

Review 2.  Impact and insights from ancient repetitive elements in plant genomes.

Authors:  Florian Maumus; Hadi Quesneville
Journal:  Curr Opin Plant Biol       Date:  2016-02-09       Impact factor: 7.834

3.  TAREAN: a computational tool for identification and characterization of satellite DNA from unassembled short reads.

Authors:  Petr Novák; Laura Ávila Robledillo; Andrea Koblížková; Iva Vrbová; Pavel Neumann; Jirí Macas
Journal:  Nucleic Acids Res       Date:  2017-07-07       Impact factor: 16.971

Review 4.  Repetitive DNA and chromosomal rearrangements: speciation-related events in plant genomes.

Authors:  O Raskina; J C Barber; E Nevo; A Belyayev
Journal:  Cytogenet Genome Res       Date:  2008-05-23       Impact factor: 1.636

5.  The making of elaborate petals in Nigella through developmental repatterning.

Authors:  Xu Yao; Wengen Zhang; Xiaoshan Duan; Yi Yuan; Rui Zhang; Hongyan Shan; Hongzhi Kong
Journal:  New Phytol       Date:  2019-04-12       Impact factor: 10.151

Review 6.  Concerted evolution of repetitive DNA sequences in eukaryotes.

Authors:  J F Elder; B J Turner
Journal:  Q Rev Biol       Date:  1995-09       Impact factor: 4.875

7.  Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH.

Authors:  Mona Abirached-Darmency; Emilce Prado-Vivant; Liudmila Chelysheva; Thomas Pouthier
Journal:  Genome       Date:  2005-06       Impact factor: 2.166

8.  MEGA11: Molecular Evolutionary Genetics Analysis Version 11.

Authors:  Koichiro Tamura; Glen Stecher; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2021-06-25       Impact factor: 16.240

9.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

10.  A High-Quality Assembly of the Nine-Spined Stickleback (Pungitius pungitius) Genome.

Authors:  Srinidhi Varadharajan; Pasi Rastas; Ari Löytynoja; Michael Matschiner; Federico C F Calboli; Baocheng Guo; Alexander J Nederbragt; Kjetill S Jakobsen; Juha Merilä
Journal:  Genome Biol Evol       Date:  2019-11-01       Impact factor: 3.416

View more
  1 in total

1.  Integration of Repeatomic and Cytogenetic Data on Satellite DNA for the Genome Analysis in the Genus Salvia (Lamiaceae).

Authors:  Olga V Muravenko; Olga Yu Yurkevich; Julia V Kalnyuk; Tatiana E Samatadze; Svyatoslav A Zoshchuk; Alexandra V Amosova
Journal:  Plants (Basel)       Date:  2022-08-29
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.