Literature DB >> 35795863

Carbapenemase Production and Detection of Colistin-Resistant Genes in Clinical Isolates of Escherichia Coli from the Ho Teaching Hospital, Ghana.

John Gameli Deku1, Kwabena Obeng Duedu2, Godsway Edem Kpene1, Silas Kinanyok1, Patrick Kwame Feglo3.   

Abstract

Background: Effective and successful treatment of infectious diseases is a significant gain in clinical settings. However, resistance to antibiotics, especially the last-resort medicines, including carbapenems and colistin is on the rise. Aim: The aim of this study was to detect carbapenemase production and colistin-resistant genes in clinical isolates of Escherichia coli. Method. The study was a cross-sectional study carried out from July 2018 to June 2019. One hundred and thirty-five nonrepetitive E. coli isolates obtained from various clinical samples were screened for carbapenemase production using meropenem (10 μg) and imipenem (10 μg) disks. Screened-positive isolates were further subjected to a confirmatory test using modified carbapenem inhibition method (mCIM). Deoxyribonucleic acid (DNA) was extracted from all the isolates to detect colistin-resistant genes by polymerase chain reaction. Data were analyzed using GraphPad Prism version 8.00 for Windows and IBM SPSS version 26 (IMB Corp. New York, USA).
Results: Of the 135 isolates, 2 were screened positive for carbapenemase production but tested negative to mCIM. With the colistin-resistant genes, only mcr-1 and mcr-2_700bp were detected in 3 of the E. coli isolates, representing 2.2%. The mcr-1 was detected in a high vaginal swab sample of a female aged between 65 and 84 years. Mcr-2_700bp was also detected in urine and blood samples of the patients.
Conclusion: The study investigated the presence of carbapenemase and colistin-resistant genes in E. coli organisms. The absence of carbapenemase in the isolates and the detection of colistin-genes call for strict infection prevention and control practices to prevent their introduction and spread to other bacterial species, respectively.
Copyright © 2022 John Gameli Deku et al.

Entities:  

Year:  2022        PMID: 35795863      PMCID: PMC9252719          DOI: 10.1155/2022/1544624

Source DB:  PubMed          Journal:  Can J Infect Dis Med Microbiol        ISSN: 1712-9532            Impact factor:   2.585


1. Introduction

The discovery of antimicrobial agents has played a significant role in reducing the incidence of illness and death caused by microbial agents. The successful treatment of infectious diseases is one of the remarkable gains in modern medicine. The expansion in health systems and resources, in addition to improved production technologies across the globe, has also led to an increase in availability and ease of access to antimicrobials, especially, over-the-counter drugs. However, the improved access to these antimicrobials accompanied by poor practices has contributed to bacteria, including E. coli, to develop resistance to these life-saving drugs. The rising rates of antimicrobial resistance continue to pose a grave threat to human health globally but more especially, in low- and middle-income countries, partly due to the high burden of communicable diseases [1]. It is estimated that antimicrobial resistance will cause 10 million deaths globally and an economic loss of over 100 trillion US dollars by the year 2050 [2]. The problem of antibiotic resistance is compounded by the resistance of the bacterial organisms to last-resort antibiotics, including carbapenems and colistin. Until recently, carbapenems were the choice of treatment for multidrug-resistant Gram-negative bacterial infections [3]. Despite being generally considered as last-resort antibiotics [4], resistance to this class of antibiotics has been documented in previous studies [5-7]. Resistance of bacteria to carbapenems is due to the production of carbapenem-hydrolyzing enzymes called carbapenemases. These bacteria have the ability to spread rapidly within the hospital environment and from one country to another [8]. The occurrence of an outer membrane porin deficiency and the expression of a plasmid-mediated class C-lactamase have been reported to be responsible for carbapenem resistance in E. coli [9]. Colistin, on the other hand, has been used in treating infections caused by bacterial species in farm animals. The main indications for colistin use in veterinary settings are the prevention and treatment of infections caused by Enterobacteriaceae but it has also been used as a growth enhancer in terrestrial and aquatic animals [10, 11]. In recent times, colistin is being used in humans as a last-resort antibiotic in the treatment of infections caused by carbapenem-resistant Enterobacteriaceae. This has prompted more accurate and careful monitoring of resistance to this polypeptide [12]. The aim of this study was to investigate the production of carbapenemase and colistin-resistant genes in clinical isolates of E. coli from the Ho Teaching Hospital, Ghana.

2. Materials and Methods

2.1. Study Design and Study Area

The study was a cross-sectional study carried out at the Ho Teaching Hospital from July 2018 to June 2019. The hospital is a 241-bed capacity tertiary medical facility located in the regional capital of the Volta Region, Ho. The microbiology department of the hospital receives laboratory requests for various microbiological analyses from various units and departments of the hospital, as well as from the entire region and neighboring health facilities. Analysis of the samples were conducted in the Duedu Laboratory in the Department of Biomedical Science, School of Basic and Biomedical Sciences of the University of Health and Allied Sciences, in Ho which studies microbial ecology and biotechnology.

2.2. The Bacterial Isolates

E. coli isolates were cultured from various clinical specimens on MacConkey agar (Oxoid, UK) and blood agar (Oxoid, UK). The plates were incubated aerobically for 24 hours at 37°C. Growths suspected to be E. coli were confirmed using Gram stain reaction, triple sugar fermentation test, citrate test, urease test, indole test, Voges–Proskauer, and methyl red tests. Confirmation was done by detection of the presence of uidA and uspA genes that are specific to E. coli by PCR. Primers used to amplify these genes are shown in Table 1. The organisms isolated and confirmed as E. coli were stored in glycerol stocks in a −80°C freezer and later used for other tests. Quality control organisms used in the study were E. coli ATCC 25922 and Klebsiella pneumoniae NCTC 13442. K. pneumoniae was used as a negative control for the biochemical tests except for triple sugar ion fermentation in which both E. coli and K. pneumoniae share common characteristics.
Table 1

Oligonucleotide primers used for the molecular identification of E. coli.

Target geneSequence (5′-3′)Amplicon size (bp)Reference
uspA F_CCGATACGCTGCCAATCAGT884[13]
R_ACGCAGACCGTAGGCCAGAT

uidA F_CTGGTATCAGCGCGAAGTCT556[13]
R_AGCGGGTAGATATCACACTC

2.3. Revival of Isolates and DNA Extraction

The stored E. coli isolates were retrieved from the freezer, and the surface was scraped aseptically and emulsified in a 30 ml Luria Bertani broth (Oxoid, UK) and incubated overnight in a shaking incubator. The genomic DNA was extracted according to a previous technique used by Deku, Duedu [14].

2.4. Screening of E. coli Isolates for Carbapenemase Production

The disk diffusion Kirby-Bauer antimicrobial susceptibility testing method was used to detect carbapenemase production against meropenem (10 μg) and imipenem (10 μg). Three well-isolated colonies of E. coli were touched and emulsified in 4 ml of a sterile phosphate buffered saline. The density of the inoculum was adjusted to 0.5 McFarland. The Mueller–Hinton agar (Oxoid, UK) was inoculated by dipping a sterile swab into the inoculum and streaking the entire surface of the medium. A duration of ten minutes was allowed to enable the surface moisture to dry before the antibiotic disks were placed on the medium using sterile forceps. The inoculated plates containing the antibiotic disks were incubated aerobically at 37°C for 16–18 hours. The diameter of the zone of inhibition was measured using a ruler and was recorded. Isolates that were resistant (zone diameter ≤19 mm) to either one or two of the carbapenem antibiotic disks were suspected of carbapenemase production and were subjected to modified the carbapenem inhibition method (mCIM).

2.5. Confirmation of Carbapenemase Production Using mCIM

This test was performed by emulsifying a 10 μl loopful of E. coli culture from the Mueller–Hinton agar into 400 μl of sterile saline [15]. A 10 μg meropenem disk was completely immersed into the suspension using sterile forceps. The inoculum containing the immersed disk was incubated for four hours at 37°C aerobically. Immediately before the completion of the saline meropenem incubation, a 0.5 McFarland suspension was prepared using a controlled E. coli ATCC 25922 organism in sterile normal saline. The Mueller–Hinton agar was inoculated with the control organism according to a routine disk diffusion procedure and the plates were allowed to dry for 10 minutes [16]. The meropenem disk was removed from the suspension using a loop. Excess fluid was removed from the disk by dragging and pressing the loop along the inside wall of the tube. The disk was added to the seeded Mueller–Hinton plate and incubated at 37°C for 18 hours aerobically. If the isolate was a carbapenemase producer, the meropenem in the susceptibility disk would have been inactivated by allowing uninhibited growth (6 mm–15 mm) of the susceptible E. coli strain (positive carbapenemase test). Disks incubated in suspensions that did not contain carbapenemase produced a clear inhibition zone (≥19 mm) (negative carbapenemase test) [16, 17]. A zone size of 16 mm–18 mm was considered as indeterminate [16].

2.6. Molecular Detection of Colistin-Resistant Genes

The DNA extracted from the 135 isolates were subjected to polymerase chain reaction to determine the amplification of mcr genes using primers given in Table 2. The amplification was done using one taq quick-load 2x master mix with standard buffer. A total of 12.5 μl reaction volume was used, comprising 6.25 μl of one taq quick-load 2x master mix with standard buffer, 0.25 μl each of 10 μM forward and reverse primers, 1 μl of template DNA, and 4.75 μl of nuclease-free water. In all cases, the running conditions were as follows: 1 cycle of initial denaturation at 94°C for 10 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing (at temperature specific for primers) for 60 seconds, and extension at 72°C for 60 sec/kb. The final extension was done at 72°C for 10 minutes and held at 4°C. Thermal cycling was done using a thermocycler (Eppendorf, USA).
Table 2

Primers for detection of colistin-resistant genes.

Target genePrimerSequence (5′-3′)Amplification product (bp)Annealing temperature (°C)Reference
mcr-1 mcr-1FATCAGCCAAACCTATCCCATCG125755[18]
mcr-1RGCAGACGCACAGCAATGCCTAT

mcr1_320 bp mcr1_320 bp_FAGTCCGTTTGTTCTTGTGGC32058[19]
mcr1_320 bp_RAGATCCTTGGTCTCGGCTTG

mcr-2 mcr-2FGCGATGGCGGTCTATCCTGTAT37855[18]
mcr-2RTGCGATGACATGGGGTGTCAGC

mcr-2_700 bp mcr2_700 bp_FCAAGTGTGTTGGTCGCAGTT71558[19]
mcr2_700 bp_RTCTAGCCCGACAAGCATACC

mcr-3 mcr-3FTATGGGTTACTATTGCTGG81455[18]
mcr-3RCTACCCTGATGCTCATCG

mcr3_900 bp mcr3_900 bp_FAAATAAAAATTGTTACGCTTATG92958[19]
mcr3_900 bp_RAATGGAGATCCCCGTTTTT

mcr-4 mcr-4FGTCATAGTGGTATAAAAGTACAG66955[18]
mcr-4RCCACCGTCTATCAGAGCCAAC

mcr_4_1100 bp mcr_4_1100 bp_FTCACTTTCATCACTGCGTTG111658[19]
mcr_4_1100 bp_RTTGGTCCATGACTACCAATG

mcr-5 mcr5_FATGCGGTTGTCTGCATTTATC164458[20]
mcr5_RTCATTGTGGTTGTCCTTTTCTG

mmcr-5 mcr-5FGCGGTTGTCTGCATTTATCAC104250[18]
mcr-5RCTTTGAAAACCTGTCTTTGGCA

mcr-6 mcr-6FGTCCGGTCAATCCCTATCTGT55655[18]
mcr-6RATCACGGGATTGACATAGCTAC

mcr-7 mcr-7FTGCTCAAGCCCTTCTTTTCGT89255[18]
mmcr-7RTTCATCTGCGCCACCTCGT

mcr-8 mcr-8FAACCGCCAGAGCACAGAATT66760[18]
mcr-8RTTCCCCCAGCGATTCTCCAT

2.7. Statistical Analysis

GraphPad Prism version 8.00 for Windows and IBM statistical software Package for the Social Sciences (SPSS Inc. Chicago, USA) version 26.00 were used for the statistical analysis. Data obtained from the laboratory analysis were verified and exported to the statistical software for analysis. Data analysis included descriptive statistics, bivariate, and multivariate analyses by performing cross tabulations to obtain Fisher's chi squares for determination of statistical dependencies and risk associations of study variables.

2.8. Ethical Consideration

Ethical approval was granted by a joint committee of Komfo Anokye Teaching Hospital and School of Medical Sciences and Dentistry, Kwame Nkrumah University of Science and Technology, (with reference No. CHRPE/AP/204/18) before the commencement of the study. Data on study participants were anonymous and nonlinked to any of the participants. Isolates from the study participants were assigned study identification numbers.

3. Results

The study characterized a total of 135 clinical E. coli isolates recovered from the various clinical specimens of patients who visited the Ho Teaching Hospital for healthcare. Majority of the organisms (82.2%) were isolated from female participants and were mostly obtained from the 25–44 years age group 60 (44.4%). Christianity 128 (94.8%) was identified as the most professed religion among the patients. The isolates were mostly recovered from outpatients 98 (72.6%), who presented with urinary tract infections. Details of these results are presented in Table 3.
Table 3

Sociodemographic characteristics of study respondents.

ParameterFrequencyPercentage
Age category (years)
<596.7
5–241410.4
25–446044.4
45–643123
65–842115.6

Gender
Male2417.8
Female11182.2

Religion
None53.7
Christian12894.8
Islam21.5

Specimen type
Urine9872.6
Nonurine3727.4

Patient status
Outpatient9872.6
Inpatient3727.4
When the 135 isolates were screened for carbapenemase production, only 2 were resistant to meropenem and imipenem. The suspected carbapenemase-producing isolates were however negative in the modified carbapenem inactivation method to confirm the production of carbapenemase. With the colistin-resistant genes, it was observed that only resistant genes mcr-1 and mcr-2_700bp were detected in 3 of the E. coli isolates, representing 2.2% prevalence. The mcr-1 was detected in a high vaginal swab sample of a female aged between 65–84 years, whereas mcr-2_700 bp was also detected in both urine and blood samples of the patients, aged <5 years and between 5 and 24 years. See Table 4.
Table 4

Proportional distribution of colistin-resistant genes among study participants.

ParameterTotal mcr 1 mcr 1_320 bp mcr 2 mcr 2_700 bp mcr 3 mcr 3_900 bp mcr 4 mcr 4_1100 bp mcr 5–1042 mcr 5–1644 mcr 6 mcr 7 mcr 8
Gender
Male24 (100.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Female111 (100.0)1 (0.9)0 (0.0)0 (0.0)2 (1.8)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Total 1(0.7)135 (100) 0 (0.0) 0 (0.0) 2 (1.5) 0 (0.0) 0 (0.0) (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)

Age category(years)
<59 (100.0)0 (0.0)0 (0.0)0 (0.0)1 (11.1)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
5–2414 (100.0)0 (0.0)0 (0.0)0 (0.0)1 (7.1)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
25–4460 (100.00)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
45–6431 (100.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
65–8421 (100.0)1 (4.8)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

Specimen type
Urine98 (100.0)0 (0.0)0 (0.0)0 (0.0)1 (1.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Blood5 (100.0)0 (0.0)0 (0.0)0 (0.0)1 (20.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Ear swab5 (100.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
HVS10 (100.0)1 (10.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Pleural1 (100.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Sputum2 (100.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Wound14 (100.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

4. Discussion

E. coli is a member of normal microflora of gastrointestinal tract of man and other animals and belongs to the family of Enterobacteriaceae. Although most strains are nonpathogenic in the gut, few can cause disease in man in the intestine or outside the intestine. Infections caused by this organism are treated with cephalosporins. However, there are reports of resistance to this class of antimicrobials due to the production of extend-spectrum beta-lactamases (ESBL). This has necessitated the use of carbapenem drugs. Carbapenems are antimicrobial agents that are used as last resorts in the treatment of infections caused by ESBL-producing bacteria. There is, however, a growing concern about the emergence and spread of carbapenemase-producing bacteria. Contrary to the global increase in carbapenemase-producing organisms [21-23], our study detected two meropenem- and imipenem-resistant E. coli isolates that tested negative to mCIM. The screened-positive but negative confirmatory test may not connote carbapenemase production as other factors such as increased efflux pump activity and porin loss can also cause resistance [24, 25]. For infection prevention and control purposes, it is important to draw the distinction between carbapenem resistance due to carbapenemase production and resistance mediated by other mechanisms [15]. This is because most carbapenemase are plasmid encoded and can readily spread form one organism to the other. Since resistant genotypes can be transferred through crossborder migration, there is the need to put in place or enforce the existing infection prevention and control practices in the study area since carbapenemase production has been detected in other African countries, including 2.8% in Morocco [26], 28.6% in Uganda [23], 33.5% in Nigeria [27], and 35.24% in Tanzania [22]. Due to the emergence and rise of carbapenemase-producing bacteria in other countries, there is a need for proactive and adequate preventive measures locally, regionally, and nationally to contain the spread of these resistant bacteria [28]. Although, their detection can be difficult as their presence do not always produce resistant phenotypes on conventional disc diffusion or automated susceptibility testing methods [29], early detection through targeted laboratory protocols and containment of spread through comprehensive infection control measures are among appropriate preventive measures to take [28]. In this study, 3 E. coli isolates harbored one colistin resistant gene each, representing 2.2% of the total isolates. The resistance proportion recorded in this study is alarming since colistin has been regarded as a last-resort antibiotic [30, 31]. Previous studies recorded a lower prevalence in comparison with our current study [32-35]. These studies were designed to detect only mcr-1 resistant genotype, contrary to the current study where various oligonucleotide primers were used to detect a wide range of colistin resistant genes, including mcr-2, mc3-3, and mcr-4, among others. Other studies have reported a higher prevalence in comparison with this current study in Nigeria 8.3% [30] and Thailand 4.7% [36]. As at the year 2020, thirty-six studies were conducted to detect the presence of colistin-resistant genes in Africa and twenty-seven of these studies were carried out in North African countries [37]. The mcr genes have been reported in only six of the African countries and the distribution of these genes is also changing [37]. In those studies, mcr-1, mcr-2, mcr-3, and mcr-4 genes were detected in Northern Africa, while only mcr-1 genotypes were detected in Southern and Central African countries. Only two studies were conducted in Western Africa, specifically in Nigeria where only the mcr-1 genotype was detected. Our current study recorded mcr-1 1 (0.7%) and mcr-2–700 bp 2 (1.5%) among the 135 isolates tested. Colistin has not been in use in the study hospital. It is possible that the 3 isolates carrying the colistin-resistant genes were present in the community where this class of antibiotic is used for agricultural purposes, rather than arising as a result of selective pressure in the hospital [38]. This calls for a judicious use of this antimicrobial agent in animals so as to retain its efficacious activity. The predominant colistin-resistant genotype detected in this study was mcr-2_700 bp, with mcr-1 being the least. The mcr-2 predominance was in contrast with previous studies which reported mcr-1 majority [38]. A study conducted in 36 countries across the globe reported the detection of plasmid-mediated mcr-1, indicating the widespread presence of this colistin-resistant genotype [39]. The detection of other colistin-resistant genes in this study calls for regular monitoring and surveillance to prevent the spread of these resistant genotypes.

5. Conclusion

In conclusion, the study investigated the presence of carbapenemase and colistin-resistant genes in the E. coli organism. The absence of carbapenemase in the isolates coupled with the presence of mcr genes calls for strict infection prevention and control practices to prevent their introduction and spread to other bacterial species, respectively.
  33 in total

1.  Role of beta-lactamases and porins in resistance to ertapenem and other beta-lactams in Klebsiella pneumoniae.

Authors:  George A Jacoby; Debra M Mills; Nancy Chow
Journal:  Antimicrob Agents Chemother       Date:  2004-08       Impact factor: 5.191

2.  Emergence of New Delhi metallo-beta-lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC-2) in South Africa.

Authors:  Adrian J Brink; Jennifer Coetzee; Cornelis G Clay; Sindi Sithole; Guy A Richards; Laurent Poirel; Patrice Nordmann
Journal:  J Clin Microbiol       Date:  2011-11-23       Impact factor: 5.948

3.  The emerging threat of acquired carbapenemases in Gram-negative bacteria.

Authors:  G Cornaglia; G M Rossolini
Journal:  Clin Microbiol Infect       Date:  2010-02       Impact factor: 8.067

Review 4.  Colistin use and colistin resistance in bacteria from animals.

Authors:  Isabelle Kempf; Eric Jouy; Claire Chauvin
Journal:  Int J Antimicrob Agents       Date:  2016-10-27       Impact factor: 5.283

5.  Carbapenem resistance among Escherichia coli and Klebsiella pneumoniae in a tertiary care hospital in south India.

Authors:  S Nagaraj; S P Chandran; P Shamanna; R Macaden
Journal:  Indian J Med Microbiol       Date:  2012 Jan-Mar       Impact factor: 0.985

6.  Plasmid-mediated colistin resistance: an additional antibiotic resistance menace.

Authors:  P Nordmann; L Poirel
Journal:  Clin Microbiol Infect       Date:  2016-03-26       Impact factor: 8.067

Review 7.  Carbapenem-Resistant Enterobacteriaceae: A Strategic Roadmap for Infection Control.

Authors:  N Deborah Friedman; Yehuda Carmeli; Aaron Lea Walton; Mitchell James Schwaber
Journal:  Infect Control Hosp Epidemiol       Date:  2017-03-15       Impact factor: 3.254

8.  Molecular Epidemiology and Colistin Resistant Mechanism of mcr-Positive and mcr-Negative Clinical Isolated Escherichia coli.

Authors:  Qixia Luo; Wei Yu; Kai Zhou; Lihua Guo; Ping Shen; Haifeng Lu; Chen Huang; Hao Xu; Shaoyan Xu; Yonghong Xiao; Lanjuan Li
Journal:  Front Microbiol       Date:  2017-11-17       Impact factor: 5.640

9.  Prevalence and molecular characteristics of mcr-1 colistin resistance in Escherichia coli: isolates of clinical infection from a Chinese University Hospital.

Authors:  Lin Cao; Xuemei Li; Yang Xu; Jilu Shen
Journal:  Infect Drug Resist       Date:  2018-09-26       Impact factor: 4.003

10.  Plasmid-mediated colistin resistance gene mcr-1 in Escherichia coli and Klebsiella pneumoniae isolated from market retail fruits in Guangzhou, China.

Authors:  Fan Yang; Cong Shen; Xiaobin Zheng; Yan Liu; Mohamed Abd El-Gawad El-Sayed Ahmed; Zihan Zhao; Kang Liao; Yaling Shi; Xin Guo; Ruoxuan Zhong; Zhimin Xu; Guo-Bao Tian
Journal:  Infect Drug Resist       Date:  2019-02-11       Impact factor: 4.003

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.