Enhanced self-renewal of human pluripotent stem cells by simulated microgravity.

A systematic study on the biological effects of simulated microgravity (sµg) on human pluripotent stem cells (hPSC) is still lacking. Here, we used a fast-rotating 2-D clinostat to investigate the sµg effect on proliferation, self-renewal, and cell cycle regulation of hPSCs. We observed significant upregulation of protein translation of pluripotent transcription factors in hPSC cultured in sµg compared to cells cultured in 1g conditions. In addition to a significant increase in expression of telomere elongation genes. Differentiation experiments showed that hPSC cultured in sµg condition were less susceptible to differentiation compared to cells in 1g conditions. These results suggest that sµg enhances hPSC self-renewal. Our study revealed that sµg enhanced the cell proliferation of hPSCs by regulating the expression of cell cycle-associated kinases. RNA-seq analysis indicated that in sµg condition the expression of differentiation and development pathways are downregulated, while multiple components of the ubiquitin proteasome system are upregulated, contributing to an enhanced self-renewal of hPSCs. These effects of sµg were not replicated in human fibroblasts. Taken together, our results highlight pathways and mechanisms in hPSCs vulnerable to microgravity that imposes significant impacts on human health and performance, physiology, and cellular and molecular processes.

Introduction

Microgravity contributes to the challenging environment of space that causes several pivotal alterations in living systems. The possibility of simulating microgravity by ground-based systems provides research opportunities that will lead to a better understanding of the in-vitro biological effects of microgravity on cells, while eliminating the challenges inherent to spaceflight experiments, including limited availability, high cost, and complexity of experimental conditions[1-3]. Stem cells are one of the most prominent cell types to study, due to their self-renewal and differentiation capabilities that maintain homeostasis in the body. In essence, pluripotent stem cells (PSCs) of human origin (human embryonic stem cells: hESCs, and human-induced pluripotent stem cells: hiPSCs) are of particular interest for their capacity to differentiate into all cells of the body, and for their potential use in personalized and regenerative medicine[4-7].

Although considerable progress has been made in identifying the molecular mechanisms regulating the biological functions of hPSCs, it remains unknown whether such mechanisms will be altered by microgravity. Studies using simulated microgravity (sµg) have improved our knowledge on the effects of microgravity regarding morphology, migration, proliferation, and differentiation of multiple stem cell populations. In general, these studies have demonstrated that under sµg conditions stem cells have reduced capacity for differentiation[8-10], while their self-renewal is enhanced[8,9,11-13]. In addition, it has been documented that during spaceflight diverse physiological conditions are affected, including loss of muscle mass[14-16], compromised immune system[17,18], susceptibility to ocular cataracts[19], loss of bone density[20-22], cardiac stress[23,24], among others, indicating that tissue regeneration is affected, and this might be due to altered stem cell behavior. All of these findings indicate that the study of stem cells under sµg conditions can shed light on potentially new molecular mechanisms involved in self-renewal and differentiation.

We developed a fast-rotating 2-D clinostat to study the biological effects of sµg on hPSCs. In our method, hPSCs are cultured adherent to Matrigel-coated surfaces and with xeno-free and chemically defined medium, conditions well-characterized that support their self-renewal[25]. Our clinostat spins with an axis of rotation that is perpendicular to the gravitational vector, which averages the forces acting on the cells to near-zero[26-28]. Data from this study indicate that several physiological processes of hPSCs, including self-renewal, telomere maintenance, differentiation, proliferation, and cell cycle regulation are influenced by sµg. Based on these findings, we attempt to build a model to better understand the molecular mechanisms behind the regulation of hPSCs.

Methods

Preparation of chamber slides and cell culture substrate

Chambers slides were prepared inside Clipmax chamber slides flasks (TPP Techno Plastic Products AG, Switzerland), in which a small culture channel was created with polydimethylsiloxane (PDMS), as described before[29]. Briefly, a 1:10 (w/w, curing agent: base monomer) ratio PDMS pre-polymer (Sylgard 184, Dow-Corning, Midland, MI) was poured over the two sides and on the top of the Clipmax chamber-slide flasks, and cured at room temperature for 12 h on each side, leaving a centered channel for cell culture at the bottom of the chamber without PDMS (Fig. 1A). The cell culture area has an approximate dimension of 10 × 60 mm and aligns to the rotation axis (Fig. 1B). Matrigel (BD BioSciences, San Jose, CA) was diluted to a concentration of 100 μg/ml in cold DMEM/F12 (Gibco Life Technologies, Waltham, MA) and it was applied to cover the cell culture area at the bottom of the chamber. The coating was allowed to polymerize during 2 h of incubation at room temperature[30]. Before plating cells, the excess of Matrigel-DMEM/F12 solution was aspirated, and chambers were washed with Dulbecco’s phosphate-buffered saline (D-PBS) (Gibco Life Technologies).

Fig. 1

Experimental setup to simulate microgravity.

A Clipmax chamber-slide flask with a small cell culture channel created (represented by a red double-sided arrow) after filling the two sides (represented by two blue double-sided arrows) and the top of the chamber-slide flask (not shown) with PDMS. B Distribution of microgravity forces in relation to the rotation axis at the area where cells are cultured. Oval circles represent cells. C Illustration of the developed device to simulate microgravity: (A) indicates 3-D printed adapter connecting two cell culture flasks (B) to the spinning bolt of a sample rotator instrument. C Indicates the bottom surfaces of the flasks where cells are attached (illustrated in red), which are positioned back-to-back and located in the axis of rotation. D Our developed rotary cell culture system (RCCS) with 2 flasks affixed to the system and located inside of the cell culture incubator, ready to generate simulated microgravity. E Experimental design used in this project.

Simulating microgravity

A fast-rotating 2-D clinostat was developed following a previous report to generate simulated microgravity (sµg) conditions for culturing adherent cells[27]. Two Clipmax chamber slides were placed back-to-back on a custom-designed holder that was 3-D printed using ABS plastic (Fig. 1C). The holder was connected to a Multi-purpose Tube Rotator (Fisherbrand, Ontario, Canada). The instrument holding the two cell culture chambers was placed inside of a dedicated cell culture incubator set up at 37 °C, 95% humidity, and 5% CO2 conditions (Fig. 1D). As a control, cells were cultured in cell culture chamber slides in static 1g conditions for the same period of time (Fig. 1E).

Cell culture, evaluation of pluripotency, and induced differentiation of human pluripotent stem cells (hPSC)

All experiments were repeated at least in triplicates with NIH-approved hESC H1 and H9 (WA01 and WA09; WiCell Research Institute Inc., Madison, WI) and hiPSCs derived in our laboratory. The undifferentiated hPSCs were cultured on Matrigel-coated tissue culture plates (Applied Biosystems, Foster City, CA) with StemFlex Medium (Gibco Life Technologies) and maintained in cell culture incubators with high humidity and 5% CO2 at 37 °C. For experimental conditions in the chamber slides, hPSCs were dissociated into single cells using L7 dissociation solution (Lonza, Basel, Switzerland), and 10,000 cells were seeded on Matrigel-coated chamber slides with StemFlex medium and 10 μM of ROCK inhibitor (Stem Cell Technology, Vancouver, Canada)[31]. Twenty-four hours post-seeding, two chamber slides were transferred to sµg condition after completely filling with StemFlex medium, while the other remaining two chamber slides were assigned as the control group and cultured at 1g in static conditions. Forty-eight hours (h) later, the clinostat rotator was stopped for ~5 min to replace the culture medium, and immediately after the rotation was resumed. The cells were further cultured for a total of 96 h under both experimental and control conditions, as cell confluency was reached and cellular responses to culture conditions were clearly evident. Human foreskin fibroblasts (hFF-1; ATCC) were cultured in similar conditions with MEM Alpha medium supplemented with 10% fetal bovine serum (FBS). Immediately after stopping the clinostat at the end of the cell culture experiment, the cells were processed for subsequent studies.

In-vitro analysis of pluripotency of hPSCs from each group was evaluated by embryoid bodies (EB) formation. Cells were cultured in suspension with MEM Alpha (Gibco Life Technologies) supplemented with 10% FBS for 10 days to make EBs. Direct differentiation of hPSCs was performed on the sµg chamber slides with chemically defined medium (CDM) consisting of DMEM/F12 (Gibco Life Technologies) supplemented with 1 × N2 (Invitrogen), 1 × B27 (Invitrogen), 0.11 mM 2-mercaptoethanol, 1 mM nonessential amino acids (Gibco Life Technologies), 2 mM l-glutamine (Gibco Life Technologies), and 0.5 mg/ml bovine serum albumin (BSA) (fraction V; Sigma-Aldrich) for 4 days following established protocols[32]. To induce trophectoderm and neuroectoderm differentiation, cells were cultured in CDM supplemented with 50 ng/ml human recombinant bone morphogenetic protein (BMP)-4 (Stemgent, Cambridge, MA) and 4.5 μM retinoic acid (RA) (Stemgent), respectively.

Quantitative analysis of undifferentiated colony size and the total number of cells

Microscopic images of undifferentiated hPSC colonies were used to calculate the colony area of at least 10 randomly selected colonies after 96 h of culture under sµg and 1g conditions using NIH ImageJ software (http://rsb.nih.gov/ij). Data from independent replicates were averaged and standard deviations were calculated, compared, and used for statistical analysis. The total number of cells after 96 h of culture under sµg and 1g conditions was calculated after the dissociation of colonies into single cells and counted using a hemocytometer.

Immunofluorescence staining

Immediately after stopping the clinostat rotator cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 10 min, permeabilized with 0.1% Triton X-100 (Roche Applied Science, Indianapolis, IN) for 10 min, incubated in TBS with 0.1% sodium borohydride for 5 min and incubated in blocking solution (1% BSA/PBS and 10% normal donkey serum) for 1 h, all at room temperature (RT). Then samples were incubated overnight at 4 °C with primary antibodies diluted in 1% BSA and 1% normal donkey serum. The next day samples were washed three times with PBS, followed by 1 h of exposure to secondary antibodies diluted in 1% BSA and 1% normal donkey serum at RT. Samples were then incubated for 10 min with DAPI, followed by three wash steps with PBS. These steps were performed at RT and in dark conditions. Samples were treated with BD Stabilizing Fixative solution (BD Biosciences) diluted in PBS for 5 min, then treated with ProLong Gold Antifade Reagent (Molecular Probes Life Technologies, Grand Island, NY), and mounted with a glass cover slide. Sample images were captured using an EVO FL M5000 cell imaging system (ThermoFisher Scientific). The following antibodies were used: OCT4 (SC8629, Santa Cruz Biotechnology, Dallas, TX), NANOG (MABD24, Millipore, Billerica, MA), SOX2 (AB5603, Millipore), integrin α6 (MAB1378, Millipore, Billerica, MA), integrin β1 (MAB1959, Millipore), SSEA-4 (MAB4304, Millipore), TRA-1-60 (MAB4360, Millipore), and TRA-1-81 (MAB4381, Millipore). The mean fluorescent intensity was calculated using NIH ImageJ software.

Western blot analysis

The following antibodies were used: OCT4 (SC8629, Santa Cruz Biotechnology), NANOG (MABD24, Millipore), SOX2 (AB5603, Millipore), Integrin α6 (MAB1378, Millipore), Integrin β1 (MAB1959, Millipore), PSMD11 (NBP2-59484, Novus Biologicals; Centennial, CO) and GAPDH (2118, Cell Signaling Technology). Whole-cell lysates were prepared from cells, separated on 10% SDS-polyacrylamide gel, and transferred to polyvinylidene difluoride membranes. The membranes were incubated with 5% milk in TBST (w/v) for 1 h and then incubated with primary antibodies diluted in 5% BSA in TBST overnight at 4 °C. Blots were incubated with horseradish peroxidase-coupled secondary antibodies (Promega, Madison, WI; R&D systems, Mckinley NE, MN) for 1 h, and protein expression was detected using SuperSignal West Pico Chemiluminescent Substrate or SuperSignal West Femto Chemiluminescent Substrate (Thermo Scientific, Waltham, MA). NIH ImageJ software was used for the quantification of blotting images. Uncropped and unprocessed scans for blots are in Supplementary Fig. 11. All blots were derived from the same experimental replicate and processed in parallel.

RNA isolation and quantitative real-time PCR and reverse transcription PCR

Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA) and purified using RNeasy Mini Kit (Qiagen, Hilden, Germany) and DNase I treatment. The yield and purity of RNA were estimated spectrophotometrically using the A260/A280 ratio. One µg of total RNA was reverse transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) and the equivalent of 10 ng was used for PCR. These reactions were carried out in a final volume of 20 μL containing 0.2 mM deoxynucleotide triphosphates, 120 nM of each primer, and 1 U Taq-DNA-polymerase. The TaqMan probes used are listed in Supplementary Table 1. Gene expression was determined by quantitative real-time PCR on an ABI Prism 7700 Sequence Detection System (Applied Biosystems). The relative RNA expression levels of target genes were analyzed by the comparative ΔΔCT method[33] using GAPDH as an internal control, which has been reported stably expressed in all gravity conditions[34]. Subsequently, expression levels of the investigated genes were normalized to expression levels of control samples and reported as fold changes. Changes larger than 2-fold in relative mRNA expression were considered significant. The TaqMan human cyclins and cell cycle regulation gene array (Applied Biosystems; Waltham, MA) was used following the company protocol.

For reverse transcription PCR, 1 μg of total RNA was reverse transcribed using SuperScript™One-Step RT-PCR with Platinum®Taq (Invitrogen). The primer sequences for Ki67 are for forward: TTGTGCCTTCACTTCCACAT and for the reverse: CTGGTAATGCACACTCCACCT, while for TBP are forward: CTCCCACCCAAAGTCTGATGA and reverse: GCCATAAACCAAGCAGGACG. The cDNA synthesis and pre-denaturation were carried out at 95 °C for 2 min. PCR amplification was performed for 35 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. The final extension cycle was run at 72 °C for 10 min. Finally, 14 μL of PCR product was loaded onto a 1.0% agarose gel. Band densitometry analysis was performed using ImageLab 6.0 (Bio-Rad, Hercules, CA, USA).

RNA sequencing and data analysis

Total RNA (>500 ng with RIN >7.0) was used to prepare TruSeq Stranded mRNA library using the TruSeq Stranded mRNA LT Sample Prep Kit following the manufacturer’s library preparation protocol (TruSeq Stranded mRNA Sample Preparation Guide, Part #15031047 Rev. E). Whole transcriptome sequencing for six samples (three sμg and three matched control samples) was performed using Illumina NovaSeq6000 S4 sequencer. More than 100 million 2 × 151 pair-end reads were generated per sample with a Phred quality score Q30 > 90%. In order to test the robustness of the RNAseq gene expression quantification results with respect to different bioinformatics pipelines, we generated five versions of raw counts matrices using several pipelines with different parameter settings. First, RNAseq reads were aligned to GRCh38.p13 (GENCODE release 36, www.gencodegenes.org/human) using STAR (2.7.7a) with default parameters. In addition, we changed the default parameters outFilterScoreMinOverLreadand outFilterMatchNMinOverLread from 0.66 to 0.30 and generated a second-version of alignment. Both RSEM (v1.3.3) and Salmon (1.4.0) were used to quantify the gene expression with their default parameters using the two versions of STAR alignments, resulting in four versions of the gene expression raw count matrices. In addition, Salmon was used in mapping-based mode (without using STAR alignments) to generate the fifth version of gene expression raw count matrices. The fifth version of gene expression results was highly consistent with each other (Supplementary Fig. 6). DESeq2 (1.30.0) was used to perform differential gene expression analysis using all five versions of the gene expression results. GSEA (v4.1.0) was used to perform gene set enrichment analysis.

Statistical analysis

All experiments were performed at least in triplicate and data from all different cell lines was pooled for analysis, as no differences were found between them. The data were expressed as mean value ± SEM and analyzed by an unpaired t test. Levels of statistical significance were set at p < 0.05 (in the text ‘*’ means p < 0.05, ‘**’ means p < 0.005).