Wenpeng Xie1, Wenjie Chang2, Xiaole Wang1, Fei Liu2, Xu Wang2, Daotong Yuan2, Yongkui Zhang1,3. 1. Department of Orthopedics, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong, 250000, China. 2. First Clinical College, Shandong University of Traditional Chinese Medicine, Jinan, Shandong, 250000, China. 3. Shandong Fupai Pharmaceutical Co., Ltd, Jinan, Shandong, 250000, China.
Abstract
Allicin, an organic sulfur compound extracted from the bulb of Allium sativum, can potentially prevent various tumors. Our previous study found that allicin can effectively suppress the proliferation of osteosarcoma cells. However, the molecular mechanisms have not been illustrated. In this study, Saos-2 and U2OS osteosarcoma cells were used to investigate the underlying mechanisms. A series of experiments were carried out to authenticate the anticancer property of allicin. Knockdown of lncRNA MALAT1 inhibited the proliferation, invasion and migration and promoted apoptosis of osteosarcoma cells. Knockdown of miR-376a increased the proliferation, invasion, and migration and dropped apoptosis of osteosarcoma cells. Furthermore, knockdown of miR-376a reversed the influences of MALAT1 silencing in osteosarcoma cells. Based on our data, MALAT1 could downregulate the expression of miR-376a, subsequently accelerating osteosarcoma. Moreover, oxidative stress and autophagy were identified as the potential key pathway of allicin. Allicin inhibited osteosarcoma growth and promoted oxidative stress and autophagy via MALATI-miR-376a. We also found that allicin promotes oxidative stress and autophagy to inhibit osteosarcoma growth by inhibiting the Wnt/β-catenin pathway in vivo and in vitro. All data showed that allicin promotes oxidative stress and autophagy of osteosarcoma via the MALATI-miR-376a-Wnt/β-catenin pathway.
Allicin, an organic sulfur compound extracted from the bulb of Allium sativum, can potentially prevent various tumors. Our previous study found that allicin can effectively suppress the proliferation of osteosarcoma cells. However, the molecular mechanisms have not been illustrated. In this study, Saos-2 and U2OS osteosarcoma cells were used to investigate the underlying mechanisms. A series of experiments were carried out to authenticate the anticancer property of allicin. Knockdown of lncRNA MALAT1 inhibited the proliferation, invasion and migration and promoted apoptosis of osteosarcoma cells. Knockdown of miR-376a increased the proliferation, invasion, and migration and dropped apoptosis of osteosarcoma cells. Furthermore, knockdown of miR-376a reversed the influences of MALAT1 silencing in osteosarcoma cells. Based on our data, MALAT1 could downregulate the expression of miR-376a, subsequently accelerating osteosarcoma. Moreover, oxidative stress and autophagy were identified as the potential key pathway of allicin. Allicin inhibited osteosarcoma growth and promoted oxidative stress and autophagy via MALATI-miR-376a. We also found that allicin promotes oxidative stress and autophagy to inhibit osteosarcoma growth by inhibiting the Wnt/β-catenin pathway in vivo and in vitro. All data showed that allicin promotes oxidative stress and autophagy of osteosarcoma via the MALATI-miR-376a-Wnt/β-catenin pathway.
Osteosarcoma (OS), one of the most aggressive primary musculoskeletal malignancies, originates in the interstitial cell line and most frequently occurs in children and adolescents (median age of 18) [1]. The incidence of OS is approximately 3 per million and is higher in men than in women [2]. Owing to the introduction of multiagent chemotherapy regimens, the prognosis of patients has markedly improved in recent decades [3, 4]. The five-year survival rates of OS patients with localized disease have increased to approximately 60%–78% but remain low at 20% in patients with metastasis at diagnosis or in relapse [5-7]. Over the last decade, no apparent increase in the overall survival rate has been reported. The strong proliferative capacity and drug resistance of OS cells are also important factors affecting prognosis [8, 9]. Thus, the molecular mechanisms related to OS progression and pathogenesis need to be explored, and therapeutic targets with improved effectiveness should be identified.Allicin, an organic sulfur compound extracted from the bulb of Allium and found in onion and other Allium plants, exerts antibacterial, antiviral, anti-inflammatory, and anticancer effects [10]. Moreover, it exhibits potential proapoptotic ability and can be used as a cancer treatment [11]. Extensive studies have shown that allicin suppresses oral squamous cell carcinoma of the tongue [12], cholangiocarcinoma [13], colorectal cancer [14], lung cancer [15], and breast cancer [16]. In our previous studies [17, 18], results showed that allicin could inhibit the proliferation and migration of Saos-2 cells by reducing the production of glucose-regulated protein 78 and upregulating the expression of calcium reticulin. Moreover, He et al. [19] suggested that diallyl trisulfide inhibits OS progress via the PI3K/AKT/GSK3β signaling pathway. However, concrete molecular mechanisms have not been researched.The balance of the redox system keeps cells in normal condition. When this balance is broken, the production rate of highly active substances exceeds the range of the body's antioxidant regulation ability and finally leads to oxidative stress [20]. Almost all tumor cells have an imbalance in the redox system. Oxidative stress can help tumors grow and develop, but one cancer treatment is to raise the level of oxidative stress to boost tumor cells' apoptosis [20]. The study reported that the effect of the GANT61/miR-1286/RAB31 axis on inhibition OS was to induce oxidative stress [21]. And butein induced oxidative stress in OS cells to promote cell autophagy and apoptosis [22]. In addition, allicin could promote cell apoptosis and autophagy by increasing the accumulation of ROS [15]. Autophagy, a type II form of programmed cell death identified more than 50 years ago, is a highly conserved self-stabilizing mechanism of eukaryotic cells. It carried a big weight in maintaining the metabolic requirements of cells and the renewal of some organelles. In OS, autophagy seems deregulated and could act as an antitumoral process [23]. Allicin can activate autophagy to alleviate the malignant development of thyroid cancer [24] and non-small-cell lung cancer [15]. Our previous results showed that autophagy in OS decreased, and allicin could inhibit the growth of OS by increasing autophagy. However, the underlying mechanism is unclear.Noncoding RNA, which includes lncRNA, circRNA, miRNA, and tRNA, among others, is a class of widely existing genes that involve various biological functions. Among them, lncRNA and miRNA control the biological process of tumor autophagy, proliferation, invasion, migration, and metastasis. Salmena proposed the competitive endogenous RNA (ceRNA) mechanism for the first time [25]. The expression level of MALAT1 was increased in OS cells [26, 27]. MALAT1 was also detected in diverse pathologies, such as breast cancer [28] and colorectal cancer [29]. In addition, MALAT1 exerts varying degrees of influence on tumor proliferation, apoptosis, invasion, metastasis, and drug resistance. MALAT1 was found to be closely related to miR-376a in inhibiting the proliferation of OS. Many studies have found a significant decrease in miR-376a expression in tumor cells, such as rectum adenocarcinoma cell carcinoma [30], laryngocarcinoma [31], and hepatocellular carcinoma [32]. However, studies on miR-376a in OS are relatively scarce. Luo et al. found a direct interaction between miR-376a and MALAT1 in OS [33]. MALAT1 can promote Wnt expression. Silencing MALAT1 can inactivate the Wnt signaling pathway in gastric adenocarcinoma [34]. A series of studies confirmed that MALAT1 promoted the proliferation and metastasis of lung cancer via the Wnt/β-catenin pathway [35]. However, no related studies have been reported regarding the roles of allicin on autophagy and oxidative stress in OS via the MALAT1/miR-376a/Wnt/β-catenin signaling pathway.Based on the above, we speculate that the ceRNA network formed by metastasis-associated MALAT1/miR-376a/Wnt/β-catenin was a target of allicin, which allicin could promote autophagy and oxidative stress through it in OS. So the possible mechanisms allowing allicin to promote autophagy and oxidative stress to inhibit the growth of OS were explored.
2. Materials and Methods
2.1. Materials
Culture medium (DMEM, CM15019) and phosphate buffer saline (CC008) were obtained from Macgene Co., Ltd. (Beijing, China). Fetal bovine serum (FBS, 10100147) and 0.25% trypsin were ordered from Gibco (Thermo Fisher, Waltham, MA, USA). Cell Counting Kit-8 (G4103) was purchased from Servicebio (Wuhan, China). The Annexin V-FITC/7-AAD kit (MA0428) and cell cycle and apoptosis analysis kit (MA0334) were provided by Meilune (Suzhou, Jiangsu). A transwell chamber (3422) was supplied by Corning (New York, USA). Rabbit anti-P62 antibody (A19700), rabbit anti-Beclin-1 antibody (A7353), rabbit anti-LC3 antibody (A19665), rabbit anti-GAPDH antibody (A19056), rabbit anti-Wnt3a antibody (A0642), and rabbit anti-β-catenin antibody (A19657) were purchased from ABclonal (Wuhan, China). HRP-conjugated goat anti-rabbit (ZB-2301) and rat anti-mouse (ZB-2305) IgG were provided by ZSGB-BIO (Beijing, China). Primers (Table 1) were purchased from Takara (Dalian, China).
Table 1
Sequences of the primers used for RT-PCR.
Primers
Upstream (5′→3′)
Downstream (5′→3′)
MALAT1
GCTCTGTGGTGTGGGATTGA
GTGGCAAAATGGCGGACTTT
miR-376a
GTAGATTCTCCTTCTATGC
CAGTGCGTGTCGTGGAGT
P62
CCGTGAAGGCCTACCTTCTG
TCCTCGTCACTGGAAAAGGC
Beclin-1
GGTCTCGGGCGGAAGTTTTC
CTCAGCCCCCGATGCTCTTC
LC3
ACTCCTGACTGCATGGAAGC
TGCTTCTCACCCTTGTAGCG
GAPDH
AGAAGGCTGGGGCTCATTTG
AGGGGCCATCCACAGTCTTC
Wnt3a
GAGCAGGACTCCCACCTAAA
AGCCACCAGAGAGGAGACAC
β-Catenin
CTGAGGAGCAGCTTCAGTCC
GGCCATGTCCAACTCCATCA
2.2. Cell Culture and Drugs
Saos-2 and U2OS cells were provided by the Institute of Biochemistry and Cell Biology at the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in DMEM containing 10% FBS under 37°C and 5% CO2. Allicin (98% pure) was purchased from Solarbio (IA1100, Beijing, China). The best concentration of allicin, 100 μM, was determined by the CCK-8 assay in our previous study [17, 18].
2.3. Cell Transfection
Saos-2 and U2OS cells were cultured in antibiotic-free DMEM in a 6-well plate for 24 h, after reaching 70%–80% confluence and then transfected with 50 nM of sh-MALAT1, 50 nM of sh-NC, 50 nM of miR-376a mimic, or 50 nM of mimic control by Lipofectamine 2000 (11668030, Thermo Fisher). After transfection for 48 h, the cells were harvested. miR-376a mimic and mimic control were supplied by Huzhou Hippo Biotechnology Co., Ltd. (Guangzhou, China), and small interfering RNA for MALAT1 (sh-MALAT1) was synthesized by Huzhou Hippo Biotechnology Co., Ltd. (Guangzhou, China) [27].
2.4. Tumor Xenograft Model In Vivo
Animal experiments were approved by the Institutional Animal Care and Use Committee and Animal Ethics Committee of Affiliated Hospital of Shandong University of Traditional Chinese Medicine (approval number 2021-05). The BALB/c nude mice (4 weeks, male, Vital River, Beijing, China) were maintained at 20–26°C with 30–70% humidity and 12 h light/dark cycle. When being acclimatized for at least 1 week, the right axillary of the mice were injected subcutaneously with 107 Saos-2 cells or transfected Saos-2 cells. When the neoplastic size was grown to about 0.5 cm3, the mice were intraperitoneally injected with allicin (30 mg/kg) or normal saline for 14 days according to the scheduled group. The mice were euthanized with amputation of the neck, and the tumors were extracted and stored at −80°C for further biochemical tests [26, 36].
2.5. CCK-8 Assay
A 100 μL cell suspension (1500 cells) of the transfected Saos-2 and U2OS cells was seeded into 96-well plates. At a different time, CCK-8 (10 μL per well) was added and incubated for 2 h. The optical density (OD) value of 450 nm was collected using a microplate reader (Thermo Fisher) [26].
2.6. Transmission Electron Microscopy
After treatment with allicin for 24 h, Saos-2 and U2OS cells were fixed in 4% glutaraldehyde overnight and then with 1% osmium tetroxide. After the samples were dehydrated in ethanol and infiltrated with propylene oxide, they were embedded. Sections with a thickness of ~50 nm were sliced and then double-stained with 3% uranyl acetate and lead citrate. Autophagosomes were subsequently visualized by electron microscopy (HT7700, Hitachi, Tokyo, Japan).
2.7. Flow Cytometry
The cells were digested with trypsin and centrifuged for 10 min at 1000 rpm/min after being processed with allicin. The samples were stained with Annexin V-FITC/7-AAD and PI. Cell apoptosis and cell cycle (G1, S, and G2 peaks) were determined by flow cytometry (NovoCyte, Agilent, California, USA).
2.8. Transwell Migration Assays
The transwell chamber was used for cell migration assays [26]. Approximately 100 μL of cell suspension (105 cells) was seeded into the upper transwell chamber, whereas 600 μL of 10% FBS was seeded into the lower transwell chamber. After the cells were incubated for 48 h, those that settled on the upper surfaces of the transwell chambers were scraped with cotton swabs, and those that settled on the lower surfaces were fixed for staining with a crystal violet solution (CB0331, Sangon Biotech, Shanghai, China) and observed under fluorescent microscopy.
2.9. Scratch Wound Assay
Saos-2 and U2OS cells were seeded in P6-well culture dishes at a density of 3 × 105 cells per well [37]. The cells were then grown to 90% confluence in 2 mL of growth medium. Subsequently, the cell layer was scratched with a 10 μL pipette tip. The cells were rinsed and then treated with allicin. Cultures were observed immediately after wounding and after 12 and 24 h. Cell migration was monitored under a microscope.
2.10. RT-PCR
RNA was extracted using TRIzol (Invitrogen; Thermo Fisher) and amplified to cDNA by PrimeScript RT reagent kit (Takara, Dalian, China). PCR analysis was performed using SYBR Premix Ex Taq II (Takara) with LightCycler 480 (Roche, Basel, Switzerland). The primers (Table 1) were purchased from Takara. GAPDH was used as the internal control. Data were processed using the 2-ΔΔCt method [18].
2.11. Western Blot
Protein was extracted using RIPA (Beyotime, Shanghai, China) and quantified with a BCA assay kit (Beyotime). Samples (30 μg/lane) were separated by SDS-PAGE and transferred onto PVDF membranes and incubated with primary antibodies against P62 (1 : 1000), Beclin-1 (1 : 1000), LC3 (1 : 1000), Wnt3a (1 : 1000), β-catenin (1 : 1000), and GAPDH (1 : 5000), followed by the peroxidase-conjugated goat anti-rabbit IgG secondary antibody (1 : 5000). The blots were visualized using an ECL kit (Amersham; GE, Chalfont, UK). The expression level of the target protein was normalized with GAPDH [18].
2.12. Dual-Luciferase Assay
The wild type (WT) of MALAT1 containing the predicted interacting sequence of miR-376a was cloned and inserted into the firefly luciferase pGL-3 vector (E1751, Promega, USA), referred to as wt-MALAT1. The mutant (MUT) 3′ UTR of MALAT1 was constructed into the luciferase vector, referred to as mut-MALAT1. pGL3-MALAT1-wt or pGL3-MALAT1-mut was cotransfected with miR-376a mimic/NC into cells by Lipofectamine 2000 (11668030, Thermo Fisher, Waltham, MA, USA). 48 h later, the luciferase activity was detected using the Dual-Luciferase Reporter Assay System (E1960, Promega, Madison, Wisconsin, USA) [26].
2.13. Detection of ROS
The treated cells were seeded in 96-well black plates with 5000 cells/well and incubated at 37°C for 24 h. The level of ROS of cells was detected with 2,7-dichlorofluorescin diacetate (DCFH-DA) assay. DCFH-DA was added at 10 μM in each well and kept for 30 min at 37°C and observed under a fluorescent microscope (Zeiss, Germany) [38].
2.14. Statistical Analysis
All experiments were repeated three times (state n = 3) and performed in triplicate. All data were expressed as mean ± SEM. Data were compared using a one-way ANOVA test. SPSS 20.0 (IBM, Armonk, NY, USA) was used for statistical analysis. P < 0.05 was considered a significant difference.
3. Results
3.1. MALAT1 Downregulation Distinctly Promoted Apoptosis and Inhibited the Proliferation and Migration of OS Cells
To investigate the potential involvement of MALAT1 in OS cells, we knocked down the expression of MALAT1 in Saos-2 and U2OS cells by using sh-MALAT1. The results revealed that downexpression of MALAT1 markedly increased cell apoptosis (Figure 1(a)) and inhibited the migration (Figures 1(b) and 1(c)), proliferation, and cell cycle (Figures 1(d) and 1(e)) of OS cells.
Figure 1
MALAT1 downregulation distinctly inhibited OS cell proliferation and migration. (a) Cell apoptosis in Saos-2 and U2OS cell lines after infection with sh-MALAT1, detected by flow cytometry. (b) Cell migration in Saos-2 and U2OS cell lines after infection with sh-MALAT1, measured using the transwell migration assay. (c) Cell migration in Saos-2 and U2OS cell lines after infection with sh-MALAT1, measured using the scratch wound assay. (d) Cell proliferation in Saos-2 and U2OS cell lines after infection with sh-MALAT1, analyzed using the CCK-8 assay. (e) Cell cycle in Saos-2 and U2OS cell lines after infection with sh-MALAT1, detected by flow cytometry. State n = 3. ∗P < 0.05.
3.2. miR-376a Downregulation Markedly Weakened Apoptosis and Promoted Proliferation and Migration of OS Cells
The biological functions of miR-376a in OS progression were evaluated by inhibiting its expression in Saos-2 and U2OS cells. Notably, miR-376a inhibition markedly reduced cell apoptosis (Figure 2(a)) and promoted the migration (Figures 2(b) and 2(c)), proliferation, and cell cycle (Figures 2(d) and 2(e)) of OS cells.
Figure 2
miR-376a downregulation distinctly promoted OS cell proliferation and migration. (a) Cell apoptosis in Saos-2 and U2OS cell lines after treatment with the miR-376a inhibitor, detected by flow cytometry. (b) Cell migration in Saos-2 and U2OS cell lines after treatment with the miR-376a inhibitor, measured using the transwell assay. (c) Cell migration in Saos-2 and U2OS cell lines after treatment with the miR-376a inhibitor, measured using the scratch wound assay. (d) Cell proliferation in Saos-2 and U2OS cell lines after treatment with the miR-376a inhibitor, analyzed using the CCK-8 assay. (e) Saos-2 and U2OS cell cycles after treatment with the miR-376a inhibitor, detected by flow cytometry. State n = 3. ∗P < 0.05.
3.3. MALAT1 Targets miR-376a
To determine the relation between MALAT1 and miR-376a, MALAT1 expression was knocked down using sh-MALAT1, and miR-376a expression was observed by RT-PCR. The results showed that the expression of miR-376a was raised in OS cells transfected with sh-MALAT1 (Figure 3(a)). Dual-luciferase reporter assays indicated that miR-376a was specifically bound to MALAT1. The luciferase activity was reduced in cells transfected with pGL3-MALAT1-WT and miR-376a mimics (Figure 3(b)), indicating that MALAT1 could sponge miR-376a.
Figure 3
miR-376a was a target of MALAT1. (a) miR-376a expression was detected by RT-PCR. (b) Dual-luciferase reporter activity assay in Saos-2 cells after transfection with pGL3-MALAT1-WT or pGL3-MALAT1-MUT and control miR-NC or miR-376a mimics. State n = 3. ∗P < 0.05.
3.4. Downexpression of miR-376a Reversed the Effects of MALAT1 Knockdown on the Apoptosis, Proliferation, and Migration of OS Cells
The Saos-2 and U2OS cells were transfected with sh-NC+miR-NC, sh-MALAT1+miR-NC, sh-NC+miR-376a inhibitor, and sh-MALAT1+miR-376a inhibitor. The downregulation of MALAT1 promoted OS cells apoptosis, but such promotion was reversed by the miR-376a inhibitor (Figure 4(a)). Moreover, the inhibitory effect of MALAT1 knockdown on cell migration (Figures 4(b) and 4(c)) and proliferation (Figures 4(d) and 4(e)) was reversed by the downexpression of miR-376a in OS cells.
Figure 4
The downexpression of miR-376a reversed the effects of MALAT1 downregulation on OS cell proliferation and migration. (a) Cell apoptosis in Saos-2 and U2OS cell lines, detected by flow cytometry. (b) Cell migration in Saos-2 and U2OS cell lines, measured using the transwell assay. (c) Cell migration in Saos-2 and U2OS cell lines, measured using the scratch wound assay. (d) Cell proliferation in Saos-2 and U2OS cell lines, measured using the CCK-8 assay. (e) Cell cycle in Saos-2 and U2OS cell lines, detected by flow cytometry. State n = 3. Compared with sh-NC+miR-NC, ∗P < 0.05; compared with sh-NC+miR-NC, &P < 0.05; compared with sh-MALAT1+miR-NC, #P < 0.05.
3.5. Allicin Inhibited OS Growth by Promoting Oxidative Stress and Autophagy via Inactivation of the MALAT1-miR-376a-Wnt/β-Catenin Signal Pathway Axis In Vitro and In Vivo
To explore the mechanisms of allicin in the treatment of OS, Saos-2 cell lines and mice were divided into six groups: the NC, allicin, sh-NC, sh-MALAT1, sh-NC+allicin, and sh-MALAT1+allicin groups. The results showed that allicin significantly increased OS cell apoptosis (Figure 5(a)) and inhibited cell migration (Figures 5(b) and 5(c)) and proliferation (Figures 5(d) and 5(e)), which was consistent with MALAT1 knockdown. The DCFH-DA assay results showed that the level of ROS was boosted in allicin and sh-MALAT1, sh-NC+allicin, and sh-MALAT1+allicin groups, which indicated that allicin and knockdown of MALAT1 induced the accumulation of ROS (Figure 6(a)). Transmission electron microscopy images revealed that the number of autophagic vacuoles with double-membrane structures was increased after treatment with allicin in vitro (Figure 6(b)). The expression levels of autophagy-related proteins were also detected by RT-PCR and western blot analysis in vitro. Allicin upregulated Beclin-1 and LC3 expressions and downregulated p62 expression (Figures 6(c) and 6(d)). Moreover, RT-PCR and western blot data also showed that allicin downregulated Wnt3a and β-catenin expressions in vitro and in vivo (Figures 6(e) and 6(f)), which presented similar effects with MALAT1 knockdown in OS cells. All data above showed that allicin promotes oxidative stress and autophagy to inhibit OS growth via the MALATI-miR-376a-Wnt/β-catenin signal pathway.
Figure 5
Allicin inhibits OS cell growth and migration by inactivation of the expression of MALAT1. (a) Apoptosis in Saos-2 and U2OS cell lines, detected by flow cytometry. (b) Cell migration in Saos-2 and U2OS cell lines, measured using the transwell assay. (c) Cell migration in Saos-2 and U2OS cell lines, determined using the scratch wound assay. (d) Cell proliferation in Saos-2 and U2OS cells, analyzed using the CCK-8 assay. (e) Cell cycle in Saos-2 and U2OS cell lines, detected by flow cytometry. State n = 3. Compared with NC, ∗P < 0.05; compared with allicin, #P < 0.05; compared with sh-NC, &P < 0.05.
Figure 6
Allicin inhibits OS growth and migration by promoting oxidative stress and autophagy via inactivation of the MALAT1-miR-376a-Wnt/β-catenin signal pathway axis. (a) The level of ROS was detected by DCFH-DA. (b) Autophagy was detected by transmission electron microscopy. (c) Protein expression of autophagy-related proteins, detected by western blot analysis. (d) mRNA expression of autophagy-related proteins, measured by RT-PCR. (e) Protein expression of Wnt3a and β-catenin, determined by western blot analysis. (f) mRNA expression of Wnt3a and β-catenin, measured by RT-PCR. n = 3. ∗P < 0.05.
4. Discussion
The main treatment for osteosarcoma is surgery combined with radiotherapy and chemotherapy, but the cure is very difficult and mortality is high. With the deepening of the modernization of traditional Chinese medicine, the therapeutic effect of traditional Chinese medicine on the tumor is obvious to all, and it has become a hot spot in the research and development of antitumor drugs in recent years because of its characteristics of multiple links and multiple targets affecting the occurrence, invasion, metastasis, and small side effects of tumor [39]. Astragalus membranaceus polysaccharides inhibited lung cancer proliferation and metastasis by promoting the effects of immune checkpoint inhibitors [40]. Our previous study indicated that allicin could effectively inhibit the proliferation of OS cells. The effects of allicin on antiproliferative and anti-invasive properties of cancer cells were based on the upregulation of miR-134 expression [41]. A study by Yue et al. exhibited that allicin induced apoptosis of human OS cells by inactivation of the PI3K/Akt/mTOR pathway [42]. Hu et al. found that diallyl sulfide could inhibit proliferation and migration by reducing the expression of VEGF [43]. Moreover, the inhibitory effect of allicin on the proliferation and migration of OS was verified by Jiang et al. [44]. These results indicated that allicin could act as an anticancer compound. However, the system-wide molecular mechanisms targeting the antitumor effect of allicin had not been elucidated. In this study, we investigated the molecular mechanisms of allicin in OS.The expression of MALAT1 was reported to increase and could promote the development of OS [26, 27]. MALAT1 was found to inhibit autophagy in endothelial progenitor cells and increase cell viability while suppressing apoptosis of coronary atherosclerotic heart disease by activating the mTOR signaling pathway [45]. The results of our current study showed that downregulation of MALAT1 inhibited OS growth and migration. Luo et al. found a direct interaction between miR-376a and MALAT1 in OS [33]. Notably, miR-376a was involved in several tumor diseases. For instance, miR-376a alleviated the development of glioma by negatively regulating KLF15 [46]. In addition, miR-376a suppressed the proliferation and invasion of OS cells by targeting FBXO11 [47]. Interestingly, our study revealed that downregulation of miR-376a distinctly promoted the proliferation and migration of OS cell lines. Rescue experiments also revealed that downexpression of miR-376a reversed the effects of MALAT1 silencing on OS cell proliferation and migration. miR-376a could specifically bond to MALAT1 which was revealed by the dual-luciferase reporter assays. These results indicated that MALAT1 regulated miR-376a in OS cells.The latest research made clear that oxidative stress and autophagy emerged as important mechanism targets of OS. Moreover, accumulating evidence indicated that activation of oxidative stress and autophagy could inhibit OS progression [21, 23]. lncRNA regulates the progression of cells in a variety of ways which includes oxidative stress and autophagy. In diabetic nephropathy, MALAT1 regulated oxidative stress to promote the injury of podocyte cell via the miR-200c/NRF2 axis [48]. Knockdown of MALAT1 activated cell autophagy and inhibited the progression of atherosclerosis [45]. Allicin was reported to play an inhibitory role in cancer through oxidative stress and autophagy [15]. Oxidative stress and autophagy of OS cells were regulated by various signaling pathways, such as the notch, NF-κB, and PI3K/AKT signaling pathways, among others. A review of a bioinformatics database verified that the Wnt/β-catenin pathway was a target of allicin and that it formed a ceRNA network with MALAT1 and miR-376a. With the importance of MALAT1 in different diseases, MALAT1 was an upstream regulator of Wnt/β-catenin. In this study, allicin decreased MALAT1 expression to suppress the progression of OS. And allicin could induce oxidative stress and autophagy via regulating the expressions of genes of the Wnt/β-catenin pathway in vivo and in vitro. Collectively, these data indicated that allicin could promote oxidative stress and autophagy and inhibit OS growth via the MALATI/miR-376a/Wnt/β-catenin pathway.In summary, a review of the bioinformatics database verified that Wnt/β-catenin was a target of allicin and that it formed a ceRNA network with MALAT1 and miR-376a. Knockdown of MALAT1 could also significantly promote oxidative stress and autophagy to inhibit proliferation in OS. It was also verified that MALAT1 could competitively bind to miR-376a. Thus, allicin is suggested to considerably promote oxidative stress and autophagy to inhibit OS growth by inactivating the MALAT1-miR-376a-Wnt/β-catenin axis. These results also indicate that the MALATI-miR-376a-Wnt/β-catenin axis can be used as a diagnostic and therapeutic target for OS and allicin might be an effective drug for the treatment of osteosarcoma.However, there are still some limitations that existed in this study. Clinical samples are not used for verification in this study, and further mechanism verification in animal experiments is required.
5. Conclusions
On the basis of the aforementioned experiments, we conclude that allicin can considerably promote oxidative stress and autophagy to inhibit OS growth via the inactivation of the MALAT1-miR-376a-Wnt/β-catenin axis. The MALATI-miR-376a-Wnt/β-catenin axis can be used as a diagnostic and therapeutic target for OS, and allicin might be an effective drug for the treatment of osteosarcoma.
Authors: Daniel P Regan; Lyndah Chow; Sunetra Das; Laurel Haines; Eric Palmer; Jade N Kurihara; Jonathan W Coy; Alissa Mathias; Douglas H Thamm; Daniel L Gustafson; Steven W Dow Journal: Clin Cancer Res Date: 2022-02-15 Impact factor: 13.801