Literature DB >> 35767545

Absence of toxin gene transfer from Clostridioides difficile strain 630Δerm to nontoxigenic C. difficile strain NTCD-M3r in filter mating experiments.

Susan P Sambol1,2, Stuart Johnson1,2, Adam Cheknis1, Dale N Gerding1.   

Abstract

Nontoxigenic Clostridioides difficile strain M3 (NTCD-M3) protects hamsters and humans against C. difficile infection. Transfer in vitro of the pathogenicity locus (PaLoc) to nontoxigenic strain CD37 has been reported. We repeated these conjugations using toxigenic strain 630Δerm as donor and NTCD-M3 and CD37 as recipients. In order to conduct these matings we induced rifampin resistance (50ug/ml) in NTCD-M3 by serial passage on rifampin-containing media to obtain strain NTCD-M3r. 630Δerm/CD37 matings produced 21 PaLoc transconjugants in 5.5 x 109 recipient CFUs; a frequency of 3.8 x 10-9. All transconjugants carried the tcdB gene and produced toxin. 630Δerm/NTCD-M3r matings produced no transconjugants in 5 assays with a total of 9.4 x 109 NTCD-M3r recipient cells. Toxin gene transfer to NTCD-M3r could not be demonstrated under conditions that demonstrated transfer to strain CD37.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35767545      PMCID: PMC9242483          DOI: 10.1371/journal.pone.0270119

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Clostridioides difficile is the leading cause of healthcare-acquired infection in the United States, with an estimated 29,000 deaths/yr [1, 2]. A further complication of C. difficile infection (CDI) is the high rate of CDI recurrence: 20%-49% in a large clinical trial, emphasizing the importance of prevention of recurrence [3]. One likely cause of CDI recurrence is disruption of normal gut microbiota caused by antibiotics [4]. A promising method of protection against CDI, both primary and recurrent episodes, is the use of non-toxigenic C. difficile (NTCD) to colonize the disrupted gut after antibiotic treatment and prevent colonization by toxigenic C. difficile. This preventive effect of NTCD has been reported since the 1980’s in hamsters [5] and humans [6]. One strain of nontoxigenic C. difficile, restriction endonuclease analysis (REA) type M3 (NTCD-M3), has shown a high rate of success in preventing CDI. M3 is a member of the REA M group which is PCR ribotype 10. We have not done MLST typing but others have shown PCR ribotype 10 to be ST 15 [7]. The REA M group consists only of non-toxigenic strains. In the hamster model, NTCD-M3 prevented CDI in colonized animals when challenged with toxigenic C. difficile strains [8]. In a Phase 2 clinical trial, patients colonized with NTCD-M3 showed a greatly reduced incidence of CDI recurrence (2%) when compared to patients who did not colonize when given NTCD-M3 (31%) [9]. These data support the use of NTCD-M3 as a biotherapeutic for the prevention of CDI and recurrent CDI. A prior study demonstrated that in an in vitro setting, the entire pathogenicity locus (PaLoc) of toxigenic C. difficile strain 630Δerm was transferred to non-toxigenic strain CD37 and two additional nontoxigenic C. difficile strains [10]. These data led the investigators to conclude that passive transfer of toxin genes from toxigenic C. difficile to NTCD strains in vivo could compromise the clinical effectiveness and safety of colonization with NTCD. To assess the possibility of in vitro passive transfer of toxin genes to NTCD-M3, we utilized the methods of Brouwer et al. [10] and replicated their passive transfer experiments using toxigenic donor strain 630Δerm and non-toxigenic recipient strain CD37, and then substituted NTCD-M3r as the nontoxigenic recipient strain.

Materials and methods

C. difficile strains

Toxigenic strain 630Δerm tcdA:erm(B), containing an ermB gene inserted within tcdA (630ΔtcdA), toxigenic 630Δerm tcdB:erm(B), containing an ermB gene inserted within tcdB (630ΔtcdB) and non-toxigenic strain CD37 (PCR ribotype 009) were donated by Dr. Sarah Kuehne (University of Birmingham, Birmingham, UK) and Dr. Peter Mullany (University College, London, UK), respectively. Strain 630Δerm was typed by REA [11] as toxigenic REA type R30. Strain CD37 was typed as REA type T18, a new member of the nontoxigenic REA group T. NTCD-M3 was isolated in our lab in 1987 [8]. Rifampicin–resistant mutants of NTCD- M3 (original rifampicin MIC 0.25μg/ml) were generated by serial streaking onto taurocholate-fructose agar (TFA) plates [12] containing increasing amounts of rifampicin (Sigma-Aldrich, St. Louis, MO) from 0.5μg/ml to 50μg/ml. NTCD-M3 resistant to rifampicin at 50μg/ml was designated as isolate 6935 (NTCD-M3r). Antibiotic resistance of C. difficile strains used in mating experiments are shown in Table 1.
Table 1

Antibiotic resistance characteristics of C. difficile strains used in passive transfer experiments.

StrainAliasToxigenicityREA TypeErythromycinRifampicin
630Δerm tcdA:erm(B)630ΔtcdAToxigenicR24resistantsusceptible
630Δerm tcdB:erm(B)630ΔtcdBToxigenicR24resistantsusceptible
CD37CD37/T18NontoxigenicT18susceptibleresistant
Wild type M3 1413NTCD-M3NontoxigenicM3susceptiblesusceptible
NTCD-M3 6935NTCD-M3rNontoxigenicM3susceptibleresistant

Filter matings

Toxigenic CD strains 630ΔtcdA or 630ΔtcdB and non-toxigenic strains CD37 and rifampicin-resistant NTCD-M3r were grown overnight in Trypticase Soy Broth (TSB), (BD Difco, Fisher Scientific, Pittsburgh, PA). Titers were measured by ten-fold serial dilution on TFA plates, both plain TFA and TFA containing erythromycin (Sigma-Aldrich, St. Louis, MO), 10μg/ml for strain 630Δerm, or rifampicin 25μg/ml for CD37 and NTCD-M3r. The overnight cultures were centrifuged, and pellets resuspended in 200μl of Brain-Heart Infusion (BHI) broth (BD Difco, Fisher Scientific, Pittsburgh, PA). The resuspended pellets of donor toxigenic strain and recipient non-toxigenic strain were combined in a single tube, then pipetted onto a sterile 0.45μm nitrocellulose filter (Cytiva Whatman, Fisher Scientific, Pittsburgh, PA) that had been placed on BHI agar plates and were incubated 24 hours at 37°C anaerobically. Filters were placed in sterile 150mm petri dishes and washed repeatedly with 2 ml of sterile BHI pipetted over the filter surface. The cell wash solutions were plated onto selective BHI agar plates containing 5% defibrinated horse blood (Thermo Scientific Remel, Fisher Scientific, Pittsburgh, PA), erythromycin 10μg/ml, and rifampicin 25μg/ml at 100μl per plate, and incubated anaerobically for 24 hours at 37°C. Colonies were counted, isolated, and analyzed for transconjugation.

DNA isolation and REA typing

Individual CD colonies were inoculated into 20ml TSB and incubated overnight at 37°C anaerobically. Cultures were centrifuged, and cell pellets treated with the guanidine-EDTA-Sarkosyl method of DNA isolation [10]. Purified DNA was dried in a Speed-Vac vacuum concentrator (Thermo-Fisher, Grand Island, NY), then resuspended in 25μl of sterile Tris-EDTA buffer, pH 7.8. Resuspended DNA (5μl) was placed in a separate tube for subsequent PCR studies. The remaining 20μl of purified DNA was digested with HindIII restriction enzyme [10] and the restriction fragments separated on a 0.7% agarose gel (Lonza SeaKem GTG, Fisher Scientific, Pittsburgh, PA). Restriction patterns were visually compared to established REA types in our collection and to the known REA patterns of strain 630ΔtcdA and 630ΔtcdB (REA type R30), strain CD37 (REA type T18) and REA type M3. REA groups are defined as restriction patterns with ≥90% similarity (letter designation). REA types have indistinguishable restriction patterns (numerical designations).

PCR for tcdA and tcdB

Purified DNA isolated in the previous step was quantitated by nanodrop spectrometer at 260 nm, purity confirmed at 1.9 to 2.0 in 260/280 ratio, then diluted to a working concentration of 50 ng/μl. DNA from donor strains 630ΔtcdA and 630ΔtcdB, and from recipient strains CD37/T18 and NTCD-M3r were used as positive and negative controls for tcdA and tcdB genes respectively. DNA from putative transconjugants was tested for the presence of tcdA or tcdB using the primers in Table 2 (Eurofins Operon, Louisville, KY). Template DNA (200ng) was amplified in a mixture of 10mM Tris-Cl (pH 8.3), 50mM KCl, 0.01% gelatin, deoxynucleoside triphosphates (200mM each), primers (10pmol each), 1.8U AmpliTaq DNA polymerase (Thermo-Fisher Scientific, Grand Island, NY), and 0.15U Pfu DNA polymerase (Agilent, Santa Clara, CA) in the presence of 4.0mM MgCl2. Each cycle consisted of denaturation at 94°C, annealing at the melting temperature for each primer minus 5°C, and extension at 68°C for 2 min per kb of amplicon, with a total of 30 cycles per PCR assay. Amplicons were run on a 0.9% agarose gel (Lonza SeaKem GTG, Fisher Scientific, Pittsburgh, PA) and analyzed for size against a 1Kb Plus DNA ladder (Thermo-Fisher Scientific, Grand Island, NY).
Table 2

Primers for PCR of tcdA and tcdB sequences in transconjugants.

Primer NameGeneUpstream or downstreamPrimer SequenceAmplicon size
3pB-BtcdB, 3’ endupstream GATGATAGTAAGCCTTCATTTG 2603 bp
3pB-DtcdB, 3’ enddownstream CTATTCACTAATCACTAATTGAG
Nested primer 3pB-nutcdB, 3’ endupstream CACCTTCATATTATGAGGATGG 1004 bp
Nested primer 3pB-ndtcdB, 3’ enddownstream CAGAGTCAGAGAAGTAGAAGAC
A-u2tcdA, 3’ endupstream AATGAGTACTACCCTGAGA 3034 bp
A-d1-btcdA, 3’ enddownstream AATTTCTTAGTAGCACAGGAAT

Confirmation of tcdB using nested PCR primers

Purified DNA isolated in the previous step was quantitated by nanodrop spectrometer at 260/280 nm, then diluted to a working concentration of 50 ng/μl. DNA from donor strains 630Δerm tcdA:ermB, and from recipient strains CD37 and NTCD-M3r were used as positive and negative controls for tcdB genes respectively. DNA from putative transconjugants was tested for the presence or absence of tcdB using nested primers (Table 2). In the nested primer PCR, 200 ng of template DNA were amplified under the same conditions as the original PCR with the following differences: nested primers 3pB-nu and 3pB-nd were used, the positive control was strain 630Δerm tcdA:ermB, negative control was parent strain CD37, and the amplicons were run on a 0.9% agarose gel and analyzed against a 100 bp DNA ladder (New England Biolabs, Ipswich, MA).

Toxin assays

Cytotoxicity assay

Transconjugant colonies and parent donor strains 630ΔtcdA or 630ΔtcdB, and parent recipient strains CD37/T18 and NTCD-M3r were inoculated into 20ml of BHI broth and incubated anaerobically for 48–72 hours. Cells were separated by centrifugation and the supernatants added to sterile 1.5ml Eppendorf microcentrifuge tubes. Supernatants were centrifuged at 16,000 x g and added to the Bartels Clostridium difficile Cytotoxicity Assay Kit (Trinity Biotech, Jamestown, NY), containing human fibroblast cells. Supernatants, either neat or pre-incubated with C. difficile toxin B neutralizing antibody for 40 minutes, were added to the test wells, and cell morphology (rounding of spindle-shaped fibroblasts) assessed at 24h and 48h anaerobic incubation at 36°C.

Enzyme Immunoassay (EIA)

Supernatants from transconjugant colonies and parent donor and recipient strains were generated using the same techniques as for the cytotoxicity assay. Quantitative toxin levels were determined in the transconjugant and parent donor strain supernatants by toxin EIA using C. difficile Tox A/B II kit (TechLab, Blacksburg, VA), and the results analyzed on an iMark Microplate Absorbance reader (Bio-Rad, Hercules, CA) at 450nm.

DNA sequencing

DNA was prepared in our laboratory for strains NTCD-M3 and NTCD-M3r and sent to CosmosID, Rockville, MD for sequencing. Isolated genomic DNA was quantified with Qubit 2.0 DNA HS Assay (ThermoFisher, Massachusetts, USA) and quality assessed by Tapestation genomic DNA Assay (Agilent Technologies, California, USA). Library preparation was performed using KAPA Hyper Prep kit without PCR (Roche, Indianapolis, USA) following the manufacturer’s recommendations. Following end repair and ligation with KAPA Unique dual adaptors containing Illumina® 8-nt dual-indices, the final libraries were purified using SPRI beads (Beckman Coulter, Indianapolis, USA). Library quality and quantity were assessed with Qubit 2.0 DNA HS Assay as well as Tapestation High Sensitivity D1000 Assay (Agilent Technologies, California, USA). Final libraries were quantified using the QuantStudio® 5 System (Applied Biosystems, California, USA) prior to equimolar pooling based on qPCR QC values. Sequencing was performed on an Illumina® NovaSeq (Illumina, California, USA) with a read length configuration of 150 PE for 6.67M PE reads (3.335 M in each direction) per sample. The SNP’s were identified through Snippy by a comparison of short read data and the draft assemblies. The genes were then identified through genome annotation using Prokka in conjunction with Snippy. The SNP’s were validated through a series of alignments between short read data and the draft assemblies.

Results

PaLoc transfer

Transconjugants were defined as C. difficile colonies growing on selective BHI plates containing erythromycin at 10μg/ml and rifampicin at 25μg/ml that were identified by REA typing as nontoxigenic strains and shown to contain PaLoc tcdA or tcdB genes by PCR. Transconjugation was further confirmed by toxin assays performed on transconjugant supernatants. Three filter matings were conducted between strain 630ΔtcdA and strain CD37/T18, generating 21 transconjugants from a total of 5.5 x 109 non-toxigenic cells, a passive transfer frequency of 3.8 x 10−9 CD37 cells (s.d. = 4.7 x 10−9) (Table 3). Four filter matings were conducted between strain 630ΔtcdA and NTCD-M3r (resistant to rifampicin 50ug/ml), generating no transconjugants from a total of 7.9 x 109 non-toxigenic cells, at a passive transfer frequency of 0 transconjugants per 109 NTCD-M3r cells (Table 3). One filter mating was conducted between strain 630ΔtcdB and non-toxigenic NTCD-M3r, generating no transconjugants from a total of 1.46 x 109 non-toxigenic cells, at a passive transfer frequency of 0 transconjugants per 109 NTCD-M3r cells (Table 3).
Table 3

Filter matings between toxigenic strain 630ΔtcdA and 630ΔtcdB and nontoxigenic strains CD37/T18 and NTCD-M3r.

Mating no.Donor strain titerTotal cfu of donor strainRecipient strain TiterTotal cfu of recipient strainResults
1630ΔtcdA .85 x 108 cfu/ml1.7 x 109CD 37/T18 0.53 x 108 cfu/ml1.0 x 10912 CD37 transconjugants
2630ΔtcdA .85 x 108 cfu/ml1.7 x 109NTCD-M3r 0.97 x 108 cfu/ml1.94 x 1090 M3r transconjugants
3630ΔtcdA 1.05 x 108 cfu/ml2.1 x 109NTCD-M3r 0.73 x 108 cfu/ml1.46 x 1090 M3r transconjugants
4630ΔtcdB 1.6 x 108 cfu/ml3.2 x 109NTCD-M3r 0.73 x 108 cfu/ml1.46 x 1090 M3r transconjugants
5630ΔtcdA 1.8 x 108 cfu/ml4.5 x 109CD 37/T18 1.0 x 108 cfu/ml2.5 x 1094 CD37 transconjugants
6630ΔtcdA 1.8 x 108 cfu/ml4.5 x 109NTCD-M3r 1.4 x 108 cfu/ml3.5 x 1090 M3r transconjugants
7630ΔtcdA 1.8 x 108 cfu/ml3.6 x 109CD 37/T18 1.0 x 108 cfu/ml2.0 x 1095 CD37 transconjugants
8630ΔtcdA 1.8 x 108 cfu/ml3.6 x 109NTCD-M3r 0.5 x 108 cfu/ml1.0 x 1090 M3r transconjugants

REA typing of transconjugants

Toxigenic strains 630ΔtcdA and 630ΔtcdB were both identical REA type R30. REA designated CD37 as type T18. NTCD-M3r was reconfirmed as REA Type M3. There were no NTCD-M3r transconjugants, so all analyses were performed only on the 21 transconjugants generated from 3 filter matings of 630ΔtcdA with CD37/T18. CD37/T18 transconjugants displayed multiple variations in the REA pattern of CD37/T18 but retained 90% homology with the parent T18 type as described by Clabots et al. [11], keeping the transconjugants within the REA T group (Fig 1). It is likely that the extra and missing bands of REA type T18 are due to the inclusion of HindIII sites in the passive transfer of large segments of 630ΔtcdA DNA within or flanking the PaLoc, as described by Brouwer et al. [10].
Fig 1

HindIII REA patterns of C. difficile donor (Strain 630Δerm), recipient strains (M3r, CD37), and seven representative CD37 transconjugants (tc).

A. Lane 1; lambda DNA phage marker followed by donor strains 630ΔtcdA, 630ΔtcdB, M3, CD37, and transconjugants tc3 and tc10. B. Lane 1; CD37, followed by tc4, tc11, tc16, tc17, tc21 and lambda DNA phage marker. White arrowheads to the left of the gel lanes indicate HindIII band differences between parent strain CD37 (REA type T18) and CD37 transconjugants (tc3 –tc21).

HindIII REA patterns of C. difficile donor (Strain 630Δerm), recipient strains (M3r, CD37), and seven representative CD37 transconjugants (tc).

A. Lane 1; lambda DNA phage marker followed by donor strains 630ΔtcdA, 630ΔtcdB, M3, CD37, and transconjugants tc3 and tc10. B. Lane 1; CD37, followed by tc4, tc11, tc16, tc17, tc21 and lambda DNA phage marker. White arrowheads to the left of the gel lanes indicate HindIII band differences between parent strain CD37 (REA type T18) and CD37 transconjugants (tc3 –tc21).

PCR analysis of transconjugants

All 21 CD37 transconjugants showed positive amplification of a 2600 bp fragment of the 3’ end of the tcdB gene in the PaLoc, confirming the transfer of PaLoc sequences to the non-toxigenic strain (Fig 2). The amplicon size in the transconjugants matched the amplicon size of the control strain 630ΔtcdA. Similarly, all 21 transconjugants demonstrated amplification of the 1004 bp amplicon using nested primers in the tcdB gene. Representative transconjugants are shown in Fig 3.
Fig 2

PCR amplification of 3’ tcdB sequences in 11 CD37 transconjugants and donor strain 630ΔtcdA.

A. Lane 1; 1Kb Plus DNA ladder with the donor strain 630ΔA in the next lane followed by transconjugants tc7- tc12 and TC37. B. Lane 1; 1Kb Plus DNA ladder with the donor strain 630ΔA in the next lane followed by transconjugants tc17-21 and CD37. All transconjugants show amplicons of the expected 2600bp size found in 630ΔA. The far right lanes in both gels show the negative results for recipient parent strain CD37.

Fig 3

PCR amplification of 3’ tcdB nested 1004 bp sequence using primers 3pB-nu and 3pB-nd.

Lane 1; 100 bp DNA ladder with the donor strain 630ΔA in the next lane followed by 9 transconjugants (Tc 8–12, 17, 18, 20 and 21) and NTCD strain CD37 in the last lane.

PCR amplification of 3’ tcdB sequences in 11 CD37 transconjugants and donor strain 630ΔtcdA.

A. Lane 1; 1Kb Plus DNA ladder with the donor strain 630ΔA in the next lane followed by transconjugants tc7- tc12 and TC37. B. Lane 1; 1Kb Plus DNA ladder with the donor strain 630ΔA in the next lane followed by transconjugants tc17-21 and CD37. All transconjugants show amplicons of the expected 2600bp size found in 630ΔA. The far right lanes in both gels show the negative results for recipient parent strain CD37.

PCR amplification of 3’ tcdB nested 1004 bp sequence using primers 3pB-nu and 3pB-nd.

Lane 1; 100 bp DNA ladder with the donor strain 630ΔA in the next lane followed by 9 transconjugants (Tc 8–12, 17, 18, 20 and 21) and NTCD strain CD37 in the last lane. Strain 630ΔtcdA showed cytotoxic effects (rounding of cells) identical to the Bartels kit toxin control, as did all 21 of the CD37/T18 transconjugants. Parent nontoxigenic strain CD37/T18 showed no cytotoxic effect. Specificity of cytotoxic effect was confirmed by negative results for all supernatants incubated with neutralizing antibody prior to addition to the fibroblast culture. Strain 630ΔtcdA and the CD37/T18 transconjugants were also positive by toxin A/B EIA (ODs >0.120 at 450nm), whereas CD37/T18 nontoxigenic parent strain gave a negative reading equivalent with background (OD450 approximately 0.043).

DNA sequencing of NTCD-M3 and NTCD-M3r

NTCD-M3 and NTCD-M3r Illumina DNA sequencing showed the strains differ by 2 SNPs in the core genome. One SNP is in the pepT_1 gene. No phenotypic changes are expected because the change results in a synonymous variant. The second SNP is in the expected rpoB gene which is presumably altered with rifampin resistance. Phenotypic changes are expected because this SNP results in a missense variant. Both SNPs were called with a high level of confidence.

Discussion

Previous studies in addition to ours have shown that colonization with NTCD is effective in preventing CDI in animal models [13-15]. A surveillance study in two hospitals showed that in patients recently asymptomatically colonized with C. difficile (46% with a non-toxigenic strain) had a significantly lower incidence of CDI than patients who were in the same setting and had not been previously colonized [16]. NTCD-M3 prevention of lethal infection by toxigenic strains of C. difficile was shown in the hamster model and prevention of recurrent CDI was shown in a Phase 2, randomized, placebo-controlled clinical trial [8, 9]. Intentional colonization with nontoxigenic C. difficile strains to protect against CDI could be compromised if these strains were to convert to toxin-producing strains in vivo at a substantial frequency. Brouwer et al. demonstrated spontaneous transfer of the PaLoc from toxigenic C. difficile strain 630Δerm to nontoxigenic C. difficile strains CD37, OX904, and OX2157 [9]. We confirmed that the 630ΔtcdA strain transferred the PaLoc to CD37 at nearly the same rate reported by Brouwer et al., generating 21 transconjugants in a total of 5.5x109 recipient CD37 cells, a transfer frequency of 3.8x10-9. In contrast, we were unable to detect PaLoc passive transfer between 630ΔtcdA or 630ΔtcdB and NTCD-M3r using the same experimental conditions in five separate assays in over 9.4x109 NTCD-M3r recipient cells. It is not clear why NTCD-M3 transconjugants were not found. There is the potential for CD37 and NTCD-M3 strain to have differences in capsule or S-layer permeability that restrict any mating apparatus [17], CRISPR systems that exclude the DNA (unlikely but possible), poor recombination in the NTCD-M3 strain compared to CD37, or CD37 is more primed to take up DNA from horizontal gene transfer. We currently favor restriction-modification system differences as the most likely mechanism since CD37 (and CD630) have both been reported to lack restriction systems [18]. However, we have no knowledge of the restriction modification systems in OX904 and OX2157 that were successfully used in transfer experiments by Brouwer et al. [10]. If a patient already harbors a toxigenic strain of C. difficile, is PaLoc transfer really an issue? Should transfer occur this should not worsen the patient condition but could result in symptomatic C. difficile infection due to the new toxigenic NTCD strain that would require treatment. Theoretically the new toxigenic strain could possess more virulence than other toxigenic strains, but this is speculative. High frequency of such transfer events would certainly compromise use of NTCD as a preventive strategy. Studies that attempt to demonstrate a negative, in this case, the failure of a toxigenic C. difficile strain to transfer its PaLoc to NTCD-M3, have unavoidable limitations. Demonstration of negative in vitro results, even in multiple assays, does not prove that PaLoc transfer from toxigenic strains to NTCD-M3 is not possible under different conditions since the mechanism of transfer resistance in NTCD-M3 has not been identified. In addition, the process of inducing rifampin resistance to obtain NTCD-M3r could have inadvertently altered DNA transfer. Moreover, the important observation of in vivo PaLoc transfer and its consequences has not been identified in animal models or humans.

Conclusion

We conclude that the risk of PaLoc transfer to NTCD-M3 in vitro is lower than that of CD37 strain of C. difficile under the same conditions. PaLoc transfer in vivo has not been demonstrated nor have its consequences been determined were it to occur. The potential benefits of NTCD-M3 for prevention of primary and recurrent CDI currently outweigh the theoretical safety risk of PaLoc transfer. (PDF) Click here for additional data file. 13 Oct 2021
PONE-D-21-28123
Resistance to Toxin Gene Transfer in Nontoxigenic Clostridioides difficile Strain M3
PLOS ONE Dear Dr. Gerding, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. One expert reviewer raises concerns about the limited scope of your study and further notes that this may not be adequately reflected in the manuscript's discussion and title. I concur with this view and request that the manuscript be adjusted accordingly. In particular, the manuscript's title should be more specific about the observation made and the discussion should be expanded to include potential reasons for the lack of transconjugants. Please submit your revised manuscript by Nov 27 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Ulrich Nübel Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. 2. Thank you for stating the following in the Competing Interests section: [DNG holds patents and technology for the use of non-toxigenic C. difficile for prevention and treatment of CDI licensed to Destiny Pharma, plc Brighton, England. All other authors have no competing interests.] Please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials, by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests).  If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. Please include your updated Competing Interests statement in your cover letter; we will change the online submission form on your behalf. 3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this manuscript the authors tackle an important question: can the pathogenicity locus of a toxigenic strain of C. difficile transfer to a non-toxigenic C. difficile strain that has potential as an intervention for C. difficile infection? The approaches are relevant, the data sound, and the manuscript is mostly written in a balanced way. The fact that the major finding is negative (lack of transconjugants) cannot exclude the possibility that transfers occurs under other conditions; absence of proof is no proof of absence (also stated by authors in L198-204). Overall, the manuscript is rather limited in scope and largely replicates published work in methodology (as also indicated, e.g. in L60-63); it feels more suited for a note, rather than a full manuscript. In particular, a single donor (630Derm) is used, and only one recipient (NTCD-M3r) in addition to a published control (CD37) under a single condition for transfer (filter mating). Though this does not necessarily detract from the observation that PaLoc transfer to NTCD-M3r is not found, the manuscript would be much more impactful if a) multiple toxigenic C. difficile strains were explored as donors and b) transfer under conditions more relevant to those encountered during interventions (e.g. in a hamster or mouse model of disease) could be demonstrated (at least for CD37) and authors might want to more explicitly acknowledge the narrow scope of their results. Major comments 1. I find the title somewhat misleading and over-stating. Resistance suggests that there is an active mechanism that prevents PaLoc transfer. This cannot be concluded from the study. Moreover, the title does not reflect the limited scope of the conditions tested. I suggest rephrasing in line with the experiments performed: e.g. “No evidence for transfer of tcdA and tcdB from C. difficile strain 630Δerm to strain NTCD-M3r during filter mating experiments”. 2. The authors do not comment on whether serial streaking (in order to obtain rifR colonies) might have generated additional mutations that might affect their results. The NTCD-M3R should be sequenced and compared to NTCD-M3 to exclude secondary mutations. Similarly, in the manuscript, authors should acknowledge the possibility that results obtained with NTCD-M3r might not be different from M3 (when the Rif mutation affects transfer efficiency). 3. The results obtained with NTCD-M3r appear in contrast with those over Brouwer et al, that demonstrated PaLoc transfer to multiple NTCD strains. The current manuscript does not attempt to speculate about the reasons for this. Considering the limitations in the scope, I think this should be done. Why would NTCD-M3r behave differently from CD37, OX904, OX2157? Minor comments 1. L48-49: Please include additional typing information on the M3 strain, in particular PCR ribotype, and MLST type. I would also like to encourage authors to further clarify whether REA-type M3 is a group that only harbors NTCD strains, or also encompasses toxigenic isolates. I also suggest citing work of others using different NTCD strains, at least in a minimal form. 2. L60: inconsistent use of italics (in vitro). Please review carefully throughout manuscript. 3. L62: authors refer to strain 630, but their experimental methods state that they used 630Δerm-derived strains. Please ensure the utmost accuracy here, as the source of 630 and 630-derived strains (such a 630Δerm and 630E/JIR8094) can result in significant genomic differences for which it is difficult to predict how these would impact the results. See for instance doi: 10.1016/j.anaerobe.2018.04.015. 4. L153-155: why were 4 matings done with one donor, and only 1 with the other? Please explain the rationale for this. The present result begs different questions: a) was this a (single) experimental failure? b) does tcdB insertion affect PaLoc transfer? 5. Erythromycin and rif resistant mutants are generally easily obtained. The authors describe a clear definition of transconjugants, but do not explicitly comment on frequencies obtained for RifR donors or EryR recipients (both not transconjugant). Were non observed? L161 and on may suggest that this is the case, but it is unclear. Please provide REA patterns for all TCs and controls, either in Figure 1 or as Supplemental information. How was the 90% homology defined? This is not clear from the M&M. 6. L188 and on; I would appreciate the author’s view on how relevant transfer of PaLoc from TCD to NTCD is, in the context of a patient. If patient already harbors a TCD, is PaLoc transfer really an issue? 7. L190: I don’t believe Brouwer et al have demonstrated that transfer is passive (nor proven that it is active). 8. Figure 2: though size of the amplicon is as expected, it would be best to confirm identity either using a nested PCR or sequencing approach. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Wiep Klaas Smits [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 18 May 2022 Our responses to the Reviewer comments are shown below in red font. We believe the submission is much improved as a result of these thoughtful comments from reviewer Wiep Klaas Smits. Reviewer #1: In this manuscript the authors tackle an important question: can the pathogenicity locus of a toxigenic strain of C. difficile transfer to a non-toxigenic C. difficile strain that has potential as an intervention for C. difficile infection? The approaches are relevant, the data sound, and the manuscript is mostly written in a balanced way. The fact that the major finding is negative (lack of transconjugants) cannot exclude the possibility that transfers occurs under other conditions; absence of proof is no proof of absence (also stated by authors in L198-204). Overall, the manuscript is rather limited in scope and largely replicates published work in methodology (as also indicated, e.g. in L60-63); it feels more suited for a note, rather than a full manuscript. In particular, a single donor (630Derm) is used, and only one recipient (NTCD-M3r) in addition to a published control (CD37) under a single condition for transfer (filter mating). Though this does not necessarily detract from the observation that PaLoc transfer to NTCD-M3r is not found, the manuscript would be much more impactful if a) multiple toxigenic C. difficile strains were explored as donors and b) transfer under conditions more relevant to those encountered during interventions (e.g. in a hamster or mouse model of disease) could be demonstrated (at least for CD37) and authors might want to more explicitly acknowledge the narrow scope of their results. We agree with the narrow scope of the presentation and agree that additional donor filter matings are required even though further negative results will not resolve the question. Our purpose in this presentation was to replicate the work of Brouwer et al with known strains and a proven method of PaLoc transfer to serve as a control rather than blindly trying mating pairs and methods in vivo and in vitro. Because of the unique antibiotic resistances that must be induced or present in mating pairs, additional filter matings will require considerable time to document successful methods and obviously be limited to only another few selected isolates. We cannot agree more with the reviewer that “absence of proof is no proof of absence”. Major comments 1. I find the title somewhat misleading and over-stating. Resistance suggests that there is an active mechanism that prevents PaLoc transfer. This cannot be concluded from the study. Moreover, the title does not reflect the limited scope of the conditions tested. I suggest rephrasing in line with the experiments performed: e.g. “No evidence for transfer of tcdA and tcdB from C. difficile strain 630Δerm to strain NTCD-M3r during filter mating experiments”. We agree with the reviewer and have changed the title to “Absence of toxin gene transfer from Clostridioides difficile strain 630∆erm to nontoxigenic C. difficile strain NTCD-M3r in filter mating experiments” 2. The authors do not comment on whether serial streaking (in order to obtain rifR colonies) might have generated additional mutations that might affect their results. The NTCD-M3R should be sequenced and compared to NTCD-M3 to exclude secondary mutations. We have had NTCD-M3 and NTCD-M3r Illumina sequenced and they differ by 2 SNPs in the core genome. One SNP is in the pepT_1 gene. No phenotypic changes are expected because the change results in a synonymous variant. The second SNP was in the expected rpoB gene as we have previously reported which is presumably altered with rifampin resistance. Phenotypic changes are expected because this SNP results in a missense variant. Both SNPs were called with a high level of confidence. This is now reported in the Methods (lines 157-173) and Results (lines 239-244) of the revised submission. Similarly, in the manuscript, authors should acknowledge the possibility that results obtained with NTCD-M3r might not be different from M3 (when the Rif mutation affects transfer efficiency). We have now included this acknowledgment in the Discussion (lines 284-285) as a potential limitation of the study. 3. The results obtained with NTCD-M3r appear in contrast with those over Brouwer et al, that demonstrated PaLoc transfer to multiple NTCD strains. The current manuscript does not attempt to speculate about the reasons for this. Considering the limitations in the scope, I think this should be done. Why would NTCD-M3r behave differently from CD37, OX904, OX2157? This is a challenging question particularly since the method of DNA transfer in successful strains has not been determined. We currently have no data to support any particular hypothesis but have consulted with a number of C difficile molecular experts for their views. There is the potential for restriction modification system differences between the CD37 and NTCD-M3 strain, differences in capsule or S-layer permeability (Merrigan MM et al Plos One 2013;8:e78404) that restrict any mating apparatus, CRISPR systems that exclude the DNA (unlikely but possible), poor recombination in the NTCD-M3 strain compared to CD37, or the CD37 is more primed to take DNA from horizontal gene transfer. Of these possibilities we currently favor restriction-modification system differences since CD37 (and CD630) have both been reported to lack restriction systems (Minton N et al Anaerobe 41 (2016) 104-112). However, we have no knowledge of the restriction modification systems in OX904 and OX2157. We have added this information to the Discussion as requested lines 263-271. Minor comments 1. L48-49: Please include additional typing information on the M3 strain, in particular PCR ribotype, and MLST type. I would also like to encourage authors to further clarify whether REA-type M3 is a group that only harbors NTCD strains, or also encompasses toxigenic isolates. I also suggest citing work of others using different NTCD strains, at least in a minimal form. The REA M group of which M3 is a member is PCR ribotype 10. We have not done MLST but others have shown PCR ribotype 10 to be ST 15. (Griffiths D et al J Clin Microbiol 2010;78:770-778.) The REA M group consists only of non-toxigenic strains. This has been added to the text lines 45-47. 2. L60: inconsistent use of italics (in vitro). Please review carefully throughout manuscript. Thank you. We have done a search and correct on (in vivo and in vitro) and believe they are no longer italicized. 3. L62: authors refer to strain 630, but their experimental methods state that they used 630Δerm-derived strains. Please ensure the utmost accuracy here, as the source of 630 and 630-derived strains (such a 630Δerm and 630E/JIR8094) can result in significant genomic differences for which it is difficult to predict how these would impact the results. See for instance doi: 10.1016/j.anaerobe.2018.04.015. Good point and we agree and have changed 630 to 630Δerm 4. L153-155: why were 4 matings done with one donor, and only 1 with the other? Please explain the rationale for this. The present result begs different questions: a) was this a (single) experimental failure? b) does tcdB insertion affect PaLoc transfer? Our major goal in these experiments was to compare PaLoc transfer to NTCD-M3 compared to CD37 and we began the experiments with the most important toxin, toxin B. After repeated attempts to show transfer with the the tcdA knockout (630∆tcdA) we made one attempt with the tcdB knockout (630∆tcdB) to get confirmation that we were not getting transconjugants. In retrospect it might have been better to do more attempts with this donor, but it was apparent that we were not getting any transconjugants. 5. Erythromycin and rif resistant mutants are generally easily obtained. The authors describe a clear definition of transconjugants, but do not explicitly comment on frequencies obtained for RifR donors or EryR recipients (both not transconjugant). Were non observed? None were observed. L161 and on may suggest that this is the case, but it is unclear. Please provide REA patterns for all TCs and controls, either in Figure 1 or as Supplemental information. We have gels of all TCs but show 7 of 21 TCs in Figure 1 as representative of all TCs, the donors and recipients. These seven TCs demonstrate the seven unique REA patterns seen in the 21 CD37 TCs; many of the TCs are identical to each other or to the parent CD37 (in which PCR and phenotypic assays show the presence of toxin B gene). Brouwer et al have demonstrated in their CD37 transfer assays that the transferred DNA fragments contain much more DNA than just the PaLoc sequences, fragments ranging from 66 Kb to 271 Kb in size. It is possible, even likely, that these additional sequences carry HindIII sites that produce additional pattern bands in the size range of 9 to 24 Kb, as seen in Figure 1. We cannot without extensive sequencing confirm that these changes in the REA pattern are due to the transfer of additional DNA with HindIII restriction sites that result in the changes and do not agree that showing all 21 transconjugants would make this any more convincing. How was the 90% homology defined? This is not clear from the M&M. REA profile interpretation is from Clabots et al Ref 10. REA types were organized into larger groups on the basis of band pattern similarity. Similarities between the new and reference REA types were scored by visual comparison of each 1-mm segment of the top 60 mm of the DNA band patterns run on the same gel (approximate molecular weight range, 30 to 2 kb). A similarity index was calculated as the number of identical segments expressed as a percentage of the total segments. Any new REA type with a similarity index of >90% compared with an existing reference REA type was included in that group. New REA types were run on the same gel with a reference REA type from one to eight groups that most closely matched the DNA band pattern of the new isolate. Any new REA type with a similarity index of <90% compared with any existing reference REA types was designated the primary reference REA type for a new group and was used for all future group comparisons. The groups were designated by letters, and distinct REA types within a group were designated by Arabic numbers. We have now included ref 10 in the Results Section line 198 so the reader can reference the method. 6. L188 and on; I would appreciate the author’s view on how relevant transfer of PaLoc from TCD to NTCD is, in the context of a patient. If patient already harbors a TCD, is PaLoc transfer really an issue? The reviewer is correct that this should not worsen the patient condition but could result in symptomatic C difficile infection due to the NTCD strain that would require treatment. Theoretically the new toxigenic strain could possess more virulence than other toxigenic strains, but this is all quite speculative. High frequency of such transfer events would certainly compromise use of NTCD as a preventive strategy. We have added a paragraph to the Discussion lines 273-278. 7. L190: I don’t believe Brouwer et al have demonstrated that transfer is passive (nor proven that it is active). We agree with the Reviewer and have deleted the word passive. 8. Figure 2: though size of the amplicon is as expected, it would be best to confirm identity either using a nested PCR or sequencing approach. We have now used a nested PCR to confirm the identity of the tcdB sequence as suggested. This procedure was added to the Methods (lines 129-138) and Results (lines 214-216) and is shown in new Figure 3. Nested primers are now added to Table 2. We have also added a sentence to the Abstract to explain how NTCD-M3r was obtained from NTCD-M3, lines 22-24. Submitted filename: ResponseToReviewer.docx Click here for additional data file. 6 Jun 2022 Absence of toxin gene transfer from Clostridioides difficile strain 630∆erm to nontoxigenic C. difficile strain NTCD-M3r in filter mating experiments PONE-D-21-28123R1 Dear Dr. Gerding, Thank you for the careful and thorough revision of your manuscript. We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Ulrich Nübel Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 17 Jun 2022 PONE-D-21-28123R1 Absence of toxin gene transfer from Clostridioides difficile strain 630∆erm to nontoxigenic C. difficile strain NTCD-M3r in filter mating experiments Dear Dr. Gerding: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Ulrich Nübel Academic Editor PLOS ONE
  18 in total

1.  Treatment of relapsing Clostridium difficile diarrhoea by administration of a non-toxigenic strain.

Authors:  D Seal; S P Borriello; F Barclay; A Welch; M Piper; M Bonnycastle
Journal:  Eur J Clin Microbiol       Date:  1987-02       Impact factor: 3.267

2.  Administration of spores of nontoxigenic Clostridium difficile strain M3 for prevention of recurrent C. difficile infection: a randomized clinical trial.

Authors:  Dale N Gerding; Thomas Meyer; Christine Lee; Stuart H Cohen; Uma K Murthy; Andre Poirier; Trevor C Van Schooneveld; Darrell S Pardi; Antonio Ramos; Michelle A Barron; Hongzi Chen; Stephen Villano
Journal:  JAMA       Date:  2015-05-05       Impact factor: 56.272

3.  Oral Immunization with Nontoxigenic Clostridium difficile Strains Expressing Chimeric Fragments of TcdA and TcdB Elicits Protective Immunity against C. difficile Infection in Both Mice and Hamsters.

Authors:  Yuanguo Wang; Shaohui Wang; Laurent Bouillaut; Chunhui Li; Zhibian Duan; Keshan Zhang; Xianghong Ju; Saul Tzipori; Abraham L Sonenshein; Xingmin Sun
Journal:  Infect Immun       Date:  2018-10-25       Impact factor: 3.441

4.  Primary symptomless colonisation by Clostridium difficile and decreased risk of subsequent diarrhoea.

Authors:  J K Shim; S Johnson; M H Samore; D Z Bliss; D N Gerding
Journal:  Lancet       Date:  1998-02-28       Impact factor: 79.321

5.  Colonization for the prevention of Clostridium difficile disease in hamsters.

Authors:  Susan P Sambol; Michelle M Merrigan; Janet K Tang; Stuart Johnson; Dale N Gerding
Journal:  J Infect Dis       Date:  2002-11-22       Impact factor: 5.226

Review 6.  Recurrent Clostridium difficile infection: a review of risk factors, treatments, and outcomes.

Authors:  Stuart Johnson
Journal:  J Infect       Date:  2009-04-05       Impact factor: 6.072

7.  Horizontal gene transfer converts non-toxigenic Clostridium difficile strains into toxin producers.

Authors:  Michael S M Brouwer; Adam P Roberts; Haitham Hussain; Rachel J Williams; Elaine Allan; Peter Mullany
Journal:  Nat Commun       Date:  2013       Impact factor: 14.919

8.  Surface-layer protein A (SlpA) is a major contributor to host-cell adherence of Clostridium difficile.

Authors:  Michelle M Merrigan; Anilrudh Venugopal; Jennifer L Roxas; Farhan Anwar; Michael J Mallozzi; Bryan A P Roxas; Dale N Gerding; V K Viswanathan; Gayatri Vedantam
Journal:  PLoS One       Date:  2013-11-12       Impact factor: 3.240

Review 9.  A roadmap for gene system development in Clostridium.

Authors:  Nigel P Minton; Muhammad Ehsaan; Christopher M Humphreys; Gareth T Little; Jonathan Baker; Anne M Henstra; Fungmin Liew; Michelle L Kelly; Lili Sheng; Katrin Schwarz; Ying Zhang
Journal:  Anaerobe       Date:  2016-05-24       Impact factor: 3.331

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.