Literature DB >> 35758042

Ibuprofen promotes p75 neurotrophin receptor expression through modifying promoter methylation and N6-methyladenosine-RNA-methylation in human gastric cancer cells.

Haifeng Jin1, Zheng Wu2, Bibo Tan3, Zhen Liu1, Zhanfei Zu1, Xiaoyun Wu1, Yuwang Bi4, Xingmao Hu5.   

Abstract

It is acknowledged that nonsteroidal anti-inflammatory drugs (NSAIDs) can participate in various signaling pathways, while information about their epigenetic effects are limited. p75NTR (p75 neurotrophin receptor) can inhibit tumor growth by inducing cell cycle arrest and regulating cell cycle arrest and apoptotic cell death. The expression of p75NTR is influenced by epigenetic roles. We explored the effects of ibuprofen on p75NTR expression and investigated whether promoter methylation and N6-methyladenosine (m6A) RNA methylation regulates this process in human gastric cancer cells (SGC7901 and MKN45). Cell lines were treated with ibuprofen 0, 2.5, 5, 10, 20 µM, and then DNA, RNA, and protein were isolated 24 h later. Expression and promoter methylation of p75NTR were detected by RT-qPCR and Western blot. The levels of m6A-p75NTR were measured by RNA immunoprecipitation. We also used RT-qPCR to determine the levels of m6A-related regulators, METTL3, METTL14, ALKBH5, FTO, YTHDC2, and YTHDF1-3. Ibuprofen attenuated p75NTR promoter methylation (p < 0.01) and increased p75NTR level (p < 0.001). Ibuprofen increased m6A-p53 expression (p < 0.01) by promoting the expression of METTL3 (p < 0.01) and METTL14 (p < 0.05); and increased levels of YTHDF1 (p < 0.001), YTHDF3 (p < 0.001), and YTHDC2 (p < 0.01) that finally reinforced p53 translation (p < 0.01). Therefore, our results present that ibuprofen epigenetically increased p75NTR expression by downregulating promoter methylation and upregulating m6A-RNA-methylation in SGC7901 and MKN45 cells. Our study unveils a novel mechanism for p75NTR regulation by NSAIDs and helps the design of treatment targets.

Entities:  

Keywords:  Ibuprofen; gastric cancer; m6A-RNA-methylation; p75NTR; promoter methylation

Mesh:

Substances:

Year:  2022        PMID: 35758042      PMCID: PMC9342148          DOI: 10.1080/21655979.2022.2092674

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

Ibuprofen epigenetically increased p75NTR expression at the transcriptional and protein levels by increasing m6A-p75NTR methylation in gastric cancer cells. The increased level of m6A-p75NTR was regulated by the increased expression of METTL3 and METTL14, and may occur independently from ALKBH5 and FTO. These results may serve as an alternative pathway for inhibition of gastric cancer induced by ibuprofen.

Introduction

Nonsteroidal anti-inflammatory drugs (NSAIDs) block the cyclooxygenase (Cox) enzyme, thus decreasing the level of inflammatory mediators’ prostaglandins. NSAIDs have also been demonstrated to have anticancer effects, which can inhibit cell growth and metastasis, and lead to apoptosis [1]. Several early studies have reported that NSAIDs attenuated the progression of colon cancer, gastric cancer and prostate cancer in mice model [2-4]. However, Cox enzyme may not play a role in the anticancer mechanisms of NSAIDs. The antitumor effects need much higher levels of NSAIDs than Cox enzyme inhibition do [5]. Ibuprofen, one of NSAIDs, affects gene expression or alternative splicing, and regulates apoptosis- and cell-cycle-related pathways, including p53, PPARγ and NF-κB once they are acting in the carcinogenic process as tumor suppressor genes [6], which could help reduce the risk of major cancers by 30–60%. However, the various mechanisms by which NSAIDs produce anticancer effects and the effects of NSAIDs on different types of cancer cells are still being studied. p75 neurotrophin receptor (p75NTR), one of the nerve growth factors with low affinity, also has been known as the tumor necrosis factor (TNF) family of receptors [7].p75 NTR has been widely expressed in the central nervous system during development, also in the neural crest population, because p75 NTR is universally expressed and has been described as a neural marker [8]. Neural crest cells (NCCs) form a transient niche that precisely migrates and invades the targeted sites of the embryo [9]. NCCs are obeyed by different migration pathways through the extracellular matrix or specialized molecules display on the surface of those cells [10]. In adults, p75NTR is still expressed by NCCs and has been found in an increasing number of cancer cells [10]. It is now clear that, in addition to the nervous system, p75NTR is widely expressed in many organ, tissue and human cancers, identified as a potential tumor suppressor associated with growth inhibition. p75NTR negatively regulates cell growth and over-proliferation in melanoma, prostate, bladder, and gastric cancer [11-13]. Nevertheless, the regulation of p75NTR level and its potential underlying mechanisms in cancer cells have not been fully investigated. Promoter methylation, within the promoter region of specific genes, plays an important role in gene transcription regulation. mRNA regulation of post transcription is associated with RNA–RNA and RNA–protein interactions [14]. N6-methyladenosine (m6A) RNA methylation is the most abundant post-transcriptional modification, whose frequency in mammalian adenine is approximately 0.2–0.5% [15,16]. m6A can be found in coding region and 3’ UTR of mRNA, which participating in biological process regulation, involving translation [17], splicing [18], and degradation [19]. Abnormal m6A methylation regulation has been known to be associated with dysregulation of development [20], cancer [21], and other human diseases [22]. Previously, we validated that NSAIDs (such as R-Flurbiprofen) can reverse drug resistance, proliferation and metastasis of gastric cancer cells via activating p75NTR [4]. However, the underlying mechanism of ibuprofen on p75NTR expression and its epigenetic regulation remains unclear. The aim of this study was to determine the effects of ibuprofen on p75NTR expression and its epigenetic regulation based on transcription and post-transcription through promoter methylation and m6A RNA methylation. The results of this study provide insights into possible mechanisms of ibuprofen -mediated p75NTR regulation at the epigenetic level.

Materials and methods

Drug, cell culture and treatment

Ethical approval was obtained from the Ethics Committee of the 980th Hospital of the PLA Joint Logistics Support Force. Ibuprofen was obtained from the Institute of Chinese Materia Medica with a concentration of 96% and diluted in DMSO to a final concentration of 2 mM. The solution was filtered through a 0.22-µm filter and stored at 4°C before being further diluted in cell culture medium. The cells (1.5 × 106) were inoculated in to 90% confluency in 25 cm3 cell culture flasks (Corning Inc.). Ibuprofen was treated at different concentrations (0, 2.5, 5, 10, 20 µM) for 24 h [4]. The control group received only the same amount of DMSO. Cells were measured after treatments. The human gastric cancer cell lines SGC7901, MKN45were maintained at 37°C in 5% CO2 in DMEM (Gibco) supplemented with 10% FBS, 100 U/mL penicillin, and 0.1 mg/mL streptomycin. All results were validated by conducting two independent experiments, in triplicate.

RNA isolation and quantitative PCR

RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. The RNA was quantified by Nanodrop2000 spectrophotometer (Thermo-Fisher Scientific), standardized to 1,000 ng/µl, and reverse transcribed into complementary DNA (cDNA). Then, the mRNA expression of p75NTR, METTL3, METTL14, ALKBH5, FTO, YTHDC2 and YTHDF1-3 was measured by the SYBR™ Green (Thermo-Fisher Scientific, A25742) and the CFX96 Real-Time PCR System (Bio-Rad) as set cycling conditions. GAPDH served as an internal control to normalize gene expression [23]. The comparative threshold cycle (CT) method was used to determine relative changes in expression. Forward and reverse primers were as follows: 5’-AGCCTTCAAGAGGTGGAACAG-3’ and 5’-CTGTCGCTGTGGAGTTTTTCTC-3’ (for p75NTR, NM_002507); 5’-GCCTCAAGATCATCAGCAAT-3’ and 5’-AGGTCCACCACTGACACGTT-3’ (for GAPDH, NM_002046); 5’- TTGTCTCCAACCTTCCGTAGT-3’ and 5’- CCAGATCAGAGAGGTGGTGTAG-3’ (for METTL3, NM_019852); 5’- GAACACAGAGCTTAAATCCCCA-3’ and 5’-TGTCAGCTAAACCTACATCCCTG-3’ (for METTL14, NM_020961); 5’- ATCCTCAGGAAGACAAGATTAG-3’ and 5’- TTCTCTTCCTTGTCCATCTC-3’ (for ALKBH5, NM_017758); 5’- GCTGCTTATTTCGGGACCTG-3’ and 5’- AGCCTGGATTACCAATGAGGA −3’ (for FTO, NM_001080432); 5’- ATCCTCAGGAAGACAAGATTAG-3’ and 5’-TTCTCTTCCTTGTCCATCTC −3’ (for FTO); 5’-CAAAACATGCTGTTAGGAGCCT-3’ and 5’-CCACTTGTCTTGCTCATTTCCC-3’ (for YTHDC2, NM_022828); 5’- ATACCTCACCACCTACGGACA −3’ and 5’- GTGCTGATAGATGTTGTTCCCC-3’ (for YTHDF1, NM_017798); 5’- CCTTAGGTGGAGCCATGATTG −3’ and 5’- TCTGTGCTACCCAACTTCAGT −3’ (for YTHDF2, NM_016258); 5’- TCAGAGTAACAGCTATCCACCA −3’ and 5’- GGTTGTCAGATATGGCATAGGCT −3’ (for YTHDF3, NM_152758);

Western blot

The cells were cleaned twice with Hanks balancing salt solution and directly dissolved in the radioimmunoprecipitation analysis buffer [50 mmol/L TrIS-HCl (pH 7.4), 1% (V/V) Triton X-100, 1 mmol/L EDTA, 1 mmol/L Leupeptin, 1 mmol/L phenyl sulfonyl fluoride, 10 mmol/L NaF, 1 mmol/L Na3VO4]. Centrifugation was performed at 14,000 g for 30 min, and the supernatant was collected. Using a cytobuster reagent (200 µl; Novagen, 71,009) with proteases and phosphatase inhibitors to isolate proteins. Protein was quantified using a minocycline (BCA) assay and the sample was then standardized to 1 mg/mL. The sample was then boiled in a 1∶1 diluted solution (100°C, 5 min) with 1X Laemmli buffer in a sodium dodecyl sulfate polyacrylamide gel and transferred to the nitrocellulose membrane using a Bio-Rad trans imprinting turbine transfer system (20 V, 30 min). The membrane was then sealed with 5% skimmed milk powder (NFDM) buffered with Tris containing 0.05% Tween 20 and primary antibodies [p75NTR (1:300; Sigma Chemical Co)]. The membrane was rinsed five times in TTBS (10 min, room temperature) and conjugated with horseradish peroxidase secondary antibody [goat versus rabbit (1:5000; cell signaling technology, # 7074S); 1 h, RT]. Rinse the membrane in TTBS five times (10 min at room temperature). Western blots were visualized using the Transparent West ECL Substrate Kit (Bio-Rad, #170-5060) and images were captured using the Chemidoc XRS+ Molecular Imaging System (Bio-Rad). After detection, the membrane was quenched in hydrogen peroxide (5%, 37°C, 30 min), and was treated with housekeep protein and anti-β-actin (1:500, 30 min, room temperature; Sigma-Aldrich, A3854) to normalize protein expression. Protein expression was measured using Image Lab software version 5.1 (Bio-Rad), and the results were expressed as multiples of the band density (RBD) relative to the control [20].

p75NTR promoter methylation

According to manufacturer’s instructions, genomic DNA was isolated from control and ibuprofen treated gastric cancer cells by Quick-g-DNA MiniPrep kit and DNA Clean and Concentrator™-5 Kit. Using Nanodrop2000 spectrophotometer to determine DNA concentration, and standardization to 4 ng/µl. A260/A280 absorbance ratio of DNA was used as purity assessment. p75NTR promoter methylation was measured by OneStep qMethyl Kit (Zymo Research, 5310). Cycling conditions were as follows: digestion by methyl-sensitive restriction enzymes (37°C, 2 h), initial denaturation (95°C, 10 min), followed by 45 cycles of denaturation (95°C, 30 s), annealing (60 s), extension (72°C, 60 s), final extension (72°C, 60 s), and a hold at 4°C. The percentage methylation was calculated by formula: Methylation (%) = 100 × 2-ΔCt, where ΔCt = Ct (test) – Ct (reference) [19].

RNA immunoprecipitation

m6A-p75NTR level was quantified by RNA immunoprecipitation. Control and ibuprofen-treated gastric cancer cells in nuclear isolation buffer [500 µl; 1.28 M sucrose, 40 mM Tris-HCl (pH 7.5), 20 mM magnesium chloride, 4% Triton X-100; 4°C, 20 minu] and was centrifuged (2500 g, 4, 15 min). Nuclear pellet were re-suspended in RNA precipitation buffer as previously described [23]. Then, the nuclear membrane and fragments were precipitated by centrifugation (13,000 g, 4°C, 10 min). The supernatant containing RNA was divided into two parts of 500 µl each. Qiazol Reagent (500 µl) was added to one fraction and stored at −80°C for reference RNA isolation. The second part was incubated with m6A antibody [1:100; Abcam, ab208577] overnight at 4°C and the antigen–antibody complex was precipitated using protein A beads [20 µl 50% bead slurry (Cell Signalling Technology, #9863), 4°C, 3 h]. Then, the immuno-precipitates were recovered by centrifugation (2,500 g, 4°C, 60 s), washed three times in RNA immunoprecipitation buffer, followed by re-suspension in Qiazol Reagent (500 µl). RNA was isolated from both the reference and m6A-precipitated samples, as previously described [24]. The expression of p75NTR in the m6A-precipitated sample was normalized against the expression of p75NTR in the reference sample in order to determine the ratio of m6A methylated p75NTR relative to the total p75NTR expressed [17].

Statistical analysis

The numerical data is expressed as the mean (standard error of the mean). Differences between the mean values were determined by analysis of variance and a post hoc test. All statistical analyses were performed using SPSS19.0 software (Chicago, Illinois) and GraphPad Prism version 5.0 (GraphPad Prism Software Inc.). p < 0.05 was considered statistically significant [13].

Results

The expression of p75NTR is influenced by epigenetic roles. We explored the effects of ibuprofen on p75NTR expression and investigated whether promoter methylation and N6-methyladenosine (m6A) RNA methylation regulate this process in human gastric cancer cells (SGC7901 and MKN45). The aim of this study was to determine the effects of ibuprofen on p75NTR expression and its epigenetic regulation based on transcription and post-transcription through promoter methylation and m6A RNA methylation. The results of this study provide insights into possible mechanisms of ibuprofen-mediated p75NTR regulation at the epigenetic level.

Ibuprofen increased p75NTR expression in gastric cancer cells (SGC7901 and MKN45)

p75NTR, as a tumor suppressor, affects the levels of apoptosis and can halt the cell cycle process of gastric cancer cells [13]. Previous study has demonstrated that NSAIDs could induce p75NTR involved by MAPK kinase p38 pathways [4]. However, the effect of ibuprofen on p75NTR mRNA and protein level is unclear. We assessed the effect of ibuprofen on p75NTR express in SGC7901 and MKN45 by qPCR and Western blot. Ibuprofen significantly increased p75NTR mRNA (Figure 1(a)) and protein (Figure 1(b,c)) expression in SGC7901 cells at the concentration of 5 (p < 0.05), 10 (p < 0.01), 20 (p < 0.001) µM compared with the control. In MKN45 cells, the p75NTR mRNA level was significantly increased by 10 (p < 0.01), 20 (p < 0.001) µM ibuprofen, while the p75NTR protein level was significantly increased by 5 (p < 0.05), 10 (p < 0.01), 20 (p < 0.001) µM ibuprofen, compared with the control.
Figure 1.

The effect of Ibuprofen on p75NTR expression in SGC7901 and MKN45 cells. (a) The qPCR results of p75NTR in SGC7901 and MKN45 cells. (b-c) Protein expression of p75NTR was determined using Western blot. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001).

The effect of Ibuprofen on p75NTR expression in SGC7901 and MKN45 cells. (a) The qPCR results of p75NTR in SGC7901 and MKN45 cells. (b-c) Protein expression of p75NTR was determined using Western blot. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (*p < 0.05, **p < 0.01, ***p < 0.001).

Ibuprofen decreased p75NTR promoter methylation and increased m6A- p75NTR levels in gastric cancer cells

Transcriptional expression and activity are frequently regulated by the promoter methylation. However, the methylation epigenetic effect on p75NTR is limited studied. We assessed whether the increase in p75NTR mRNA expression discovered in the ibuprofen-treated gastric cancer cells was the result of changes in p75NTR promoter methylation. Ibuprofen significantly decreased p75NTR promoter methylation in 2.5 (p < 0.001), 5 (p < 0.001), 10 (p < 0.001), 20 (p < 0.001) µM treatment in SGC7901 and MKN45 (Figure 2(a)).
Figure 2.

The effect of Ibuprofen on the promoter methylation and m6A-p75NTR in SGC7901 and MKN45 cells. (a) The OneStep qMethyl Kit results of p75NTR in SGC7901 and MKN45 cells. (b) RNA immunoprecipitation using m6A antibody and quantification of p75NTR mRNA levels in control and Ibuprofen-treated gastric cancer cells. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (***p < 0.001).

The effect of Ibuprofen on the promoter methylation and m6A-p75NTR in SGC7901 and MKN45 cells. (a) The OneStep qMethyl Kit results of p75NTR in SGC7901 and MKN45 cells. (b) RNA immunoprecipitation using m6A antibody and quantification of p75NTR mRNA levels in control and Ibuprofen-treated gastric cancer cells. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (***p < 0.001). m6A can affect mRNA translation and degradation as a post-transcriptional modification [17,19,25]. We assessed the effect of ibuprofen on m6A-p75NTR levels in SGC7901 and MKN45 by RNA immune-precipitation. Ibuprofen significantly increased m6A-p75NTR level in gastric cells in 5 (p < 0.001), 10 (p < 0.001), 20 (p < 0.001) µM treatment (Figure 2(b)).

Ibuprofen increases the expression of m6A methyltransferases and demethylases in gastric cancer cells

As the result of ibuprofen-induced increase in m6A-p75NTR, we assessed the effect of ibuprofen on the mRNA expression of m6A methyltransferases, including METTL3 (Figure 3(a), p < 0.001), METTL14 (Figure 3(b), p < 0.001), ALKBH5 (Figure 3(c), p < 0.001), FTO (Figure 3(d), p < 0.001). Ibuprofen significantly increased the expression of METTL3, METTL14, ALKBH5, FTO in both SGC7901 and MKN45 at 5, 10, 20 µM treatment. This might indicate that ibuprofen could increase m6A-p75NTR levels via regulating the levels of the m6A methyltransferases in gastric cancer cells.
Figure 3.

The effect of Ibuprofen on the expression of m6A methyltransferases and demethylases in SGC7901 and MKN45 cells. The qPCR results of METTL3 (a), METTL14 (b), ALKBH5 (c) and FTO (d) in SGC7901 and MKN45 cells. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (*p < 0.05, ***p < 0.001).

The effect of Ibuprofen on the expression of m6A methyltransferases and demethylases in SGC7901 and MKN45 cells. The qPCR results of METTL3 (a), METTL14 (b), ALKBH5 (c) and FTO (d) in SGC7901 and MKN45 cells. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (*p < 0.05, ***p < 0.001).

Ibuprofen decreased the expression of m6A readers in gastric cancer cells

m6A can recruit particular readers recognizing m6A altered mRNAs so that it regulates the level of target molecules [22]. Previously known readers were presented to be correlated with m6A and regulate mRNA expression, including YTHDC2 and YTHDF1-3 [19,25]. Considering the fact that the increase in p75NTR expression in ibuprofen-treated gastric cancer cells and ibuprofen-induced increase in m6A-p75NTR levels, we assessed the effect of ibuprofen on the transcript of YTHDC2 and YTHDF1-3. Ibuprofen significantly increased the level of YTHDC2 (Figure 4(a), p < 0.001), YTHDF1 (Figure 4(b), p < 0.001), YTHDF2 (Figure 4(c), p < 0.001), YTHDF1 (Figure 4(d), p < 0.001) in both SGC7901 and MKN45 at 5, 10, 20 µM treatment compared to the control.
Figure 4.

The effect of Ibuprofen on the expression of m6A readers in SGC7901 and MKN45 cells. The qPCR results of YTHDC2 (a), YTHDF1 (b), YTHDF2 (c), and YTHDF2 (d) in SGC7901 and MKN45 cells. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (***p < 0.001).

The effect of Ibuprofen on the expression of m6A readers in SGC7901 and MKN45 cells. The qPCR results of YTHDC2 (a), YTHDF1 (b), YTHDF2 (c), and YTHDF2 (d) in SGC7901 and MKN45 cells. Results are represented as mean fold-change ± SD (n = 3). Statistical significance was determined by one-way ANOVA with the Bonferroni multiple comparisons test (***p < 0.001).

Discussion

Previously, NSAIDs (including ibuprofen) were reported to inhibit invasion and cell proliferation by the induction of p75NTR [4]. However, the effect of ibuprofen on p75NTR and its epigenetic mechanisms are not fully known. In the current work, we provided insights for an epigenetic regulation of ibuprofen-treated alterations in p75NTR level based on promoter methylation and m6A RNA methylation detection in gastric cancer cells. Firstly, our work suggested that ibuprofen significantly increased p75NTR at mRNA and protein level by inducing p75NTR promoter hypo-methylation and increasing m6A-p75NTR expression in both SGC7901 and MKN45 cells at 5, 10, 20 µM. This is in accordance with similar epigenetic studies that the hypo-methylation of tumor suppressor was correlated with the increase in gene expressions [26,27]. The data are also in agreement with our early work that NSAIDs increased p75NTR protein level in gastric cancer cells [4]. Despite the fact that ibuprofen increased p75NTR level, the increase in p75NTR expression was concentration-dependent and it was found that the ibuprofen at 2.5 µM had no effect on the p75NTR expression. m6A, as the most abundant epi-transcriptomic marker, can recruit particular readers recognizing m6A altered mRNAs so that it regulates the level of target molecules [17,28,29]. Previous studies have shown that abnormal regulation of m6A RNA is associated with many biological mechanisms, involving adipogenesis [30], lipid metabolism [31], and cell growth and differentiation [16]. Moreover, modification of m6A RNA can affect the process of various diseases, such as lung cancer [29], breast cancer [32] and liver cancer [33]. In this study, it was found that ibuprofen increased m6A-p75NTR level in gastric cancer cells and the levels of METTL3 and METTL14 (m6A methyltransferases), as well as ALKBH5 and FTO (demethylases) were significantly increased. The ibuprofen-treated increase in ALKBH5 and FTO indicates that it might not participate in the increase of m6A-p75NTR in gastric cancer cells, so that the increase in m6A-p75NTR was the result of increase in ibuprofen-induced decrease in METTL3 and METTL14. This is consistent with previous studies that m6A mRNA levels were increased when the overexpression of METTL3 and/or METTL14 [31]. In addition, decrease in METTL3 and METTL14 was reported to down-regulate several tumor suppressor genes, including TP53I11, BRCA2, and CDKN2A [34]. The knockout of ALKBH5 and FTO was also found to inhibit the cell proliferation and progression in vitro [29,35]. It is noted that although the FTO and ALKBH5 are considered as m6A demethylases, FTO is highly co-expressed with the m6A methyltransferases. This may explain the positive association between ALKBH5 and FTO and METTL3 and METTL14 expressions in ibuprofen-treated gastric cancer cells. This co-expression of m6A methyltransferases and demethylase has been found in other studies [36,37]. However, future studies are essential to discuss whether this co-expression offsets each other. YTHDC2, YTHDF1-3 specifically identify m6A-altered mRNAs and modify mRNA translation [19] and degradation [17,25]. In gastric cancer cells, ibuprofen-induced reduction of m6A-p75NTR levels resulted in the decrease in the level of YTHDC2, YTHDF1-3. In ibuprofen-treated gastric cancer cells, observed YTHDF2 level increase, p75NTR level increase and p75NTR promoter methylation decrease indicated that ibuprofen might increase the expression of p75NTR through low promoter methylation rather than ibuprofen-induced degradation of p75NTR. YTHDF1, YTHDF3, and YTHDC2 act by interacting with translation mechanisms and actively reinforce protein synthesis by dynamic transcripts labeled by m6A [17]. Thus, in addition to ibuprofen-induced increase in p53 transcripts, ibuprofen-induced increase in YTHDC2, YTHDF1 and YTHDF3 may play a role in the increased p75NTR protein level observed in gastric cancer cells.

Conclusion

In conclusion, this study demonstrated a potential mechanism by which ibuprofen-mediated alterations in p75NTR expression at the epigenetic angle. The results showed that ibuprofen epigenetically increased p75NTR expression at the transcriptional and protein levels by decreasing p75NTR promoter methylation and increasing m6A-p75NTR methylation in gastric cancer cells. This study provides an insight for further studies of ibuprofen and p75NTR in vivo models and for determining the effect of ibuprofen to induce p75NTR mutated proteins by changing m6A levels. Click here for additional data file.
  37 in total

1.  mRNA m⁶A methylation downregulates adipogenesis in porcine adipocytes.

Authors:  Xinxia Wang; Linna Zhu; Jingqing Chen; Yizhen Wang
Journal:  Biochem Biophys Res Commun       Date:  2015-02-25       Impact factor: 3.575

2.  m(6)A RNA modification controls cell fate transition in mammalian embryonic stem cells.

Authors:  Pedro J Batista; Benoit Molinie; Jinkai Wang; Kun Qu; Jiajing Zhang; Lingjie Li; Donna M Bouley; Ernesto Lujan; Bahareh Haddad; Kaveh Daneshvar; Ava C Carter; Ryan A Flynn; Chan Zhou; Kok-Seong Lim; Peter Dedon; Marius Wernig; Alan C Mullen; Yi Xing; Cosmas C Giallourakis; Howard Y Chang
Journal:  Cell Stem Cell       Date:  2014-10-16       Impact factor: 24.633

3.  Fusaric acid decreases p53 expression by altering promoter methylation and m6A RNA methylation in human hepatocellular carcinoma (HepG2) cells.

Authors:  Terisha Ghazi; Savania Nagiah; Anil A Chuturgoon
Journal:  Epigenetics       Date:  2020-07-07       Impact factor: 4.528

4.  m6A demethylase FTO facilitates tumor progression in lung squamous cell carcinoma by regulating MZF1 expression.

Authors:  Jiqin Liu; Dangli Ren; Zhenhua Du; Hekong Wang; Hua Zhang; Ying Jin
Journal:  Biochem Biophys Res Commun       Date:  2018-06-02       Impact factor: 3.575

Review 5.  Gene expression regulation mediated through reversible m⁶A RNA methylation.

Authors:  Ye Fu; Dan Dominissini; Gideon Rechavi; Chuan He
Journal:  Nat Rev Genet       Date:  2014-03-25       Impact factor: 53.242

6.  Ibuprofen inhibits survival of bladder cancer cells by induced expression of the p75NTR tumor suppressor protein.

Authors:  Fatima Khwaja; Jeff Allen; John Lynch; Peter Andrews; Daniel Djakiew
Journal:  Cancer Res       Date:  2004-09-01       Impact factor: 12.701

7.  R-flurbiprofen reverses multidrug resistance, proliferation and metastasis in gastric cancer cells by p75(NTR) induction.

Authors:  Haifeng Jin; Zhipeng Wang; Lili Liu; Liucun Gao; Li Sun; Xiaohua Li; Hongxi Zhao; Yanglin Pan; Hai Shi; Na Liu; Liu Hong; Jie Liang; Qiong Wu; Zhiping Yang; Kaichun Wu; Daiming Fan
Journal:  Mol Pharm       Date:  2010-02-01       Impact factor: 4.939

8.  Hypoxia induces the breast cancer stem cell phenotype by HIF-dependent and ALKBH5-mediated m⁶A-demethylation of NANOG mRNA.

Authors:  Chuanzhao Zhang; Debangshu Samanta; Haiquan Lu; John W Bullen; Huimin Zhang; Ivan Chen; Xiaoshun He; Gregg L Semenza
Journal:  Proc Natl Acad Sci U S A       Date:  2016-03-21       Impact factor: 11.205

9.  Landscape and Regulation of m6A and m6Am Methylome across Human and Mouse Tissues.

Authors:  Jun'e Liu; Kai Li; Jiabin Cai; Mingchang Zhang; Xiaoting Zhang; Xushen Xiong; Haowei Meng; Xizhan Xu; Zhibin Huang; Jinying Peng; Jia Fan; Chengqi Yi
Journal:  Mol Cell       Date:  2019-10-29       Impact factor: 17.970

10.  Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq.

Authors:  Dan Dominissini; Sharon Moshitch-Moshkovitz; Schraga Schwartz; Mali Salmon-Divon; Lior Ungar; Sivan Osenberg; Karen Cesarkas; Jasmine Jacob-Hirsch; Ninette Amariglio; Martin Kupiec; Rotem Sorek; Gideon Rechavi
Journal:  Nature       Date:  2012-04-29       Impact factor: 49.962

View more
  1 in total

Review 1.  Emerging Roles of the Nervous System in Gastrointestinal Cancer Development.

Authors:  Chunhua Wan; Xiaoqin Yan; Baoying Hu; Xinhua Zhang
Journal:  Cancers (Basel)       Date:  2022-07-30       Impact factor: 6.575

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.