Literature DB >> 35741746

Transcriptome Analysis of Bacillus amyloliquefaciens Reveals Fructose Addition Effects on Fengycin Synthesis.

Hedong Lu1,2, Hai Xu1, Panping Yang1, Muhammad Bilal1, Shaohui Zhu1, Mengyuan Zhong1, Li Zhao1, Chengyuan Gu1, Shuai Liu1, Yuping Zhao1, Chengxin Geng1.   

Abstract

Fengycin is a lipopeptide produced by Bacillus that has a strong inhibitory effect on filamentous fungi; however, its use is restricted due to poor production and low yield. Previous studies have shown that fengycin biosynthesis in B. amyloliquefaciens was found to be significantly increased after fructose addition. This study investigated the effect of fructose on fengycin production and its regulation mechanism in B. amyloliquefaciens by transcriptome sequencing. According to the RNA sequencing data, 458 genes were upregulated and 879 genes were downregulated. Transcriptome analysis results showed that fructose changed the transcription of amino acid synthesis, fatty acid metabolism, and energy metabolism; alterations in these metabolic pathways contribute to the synthesis of fengycin. In an MLF medium (modified Landy medium with fructose), the expression level of the fengycin operon was two-times higher than in an ML medium (modified Landy medium). After fructose was added to B. amyloliquefaciens, the fengycin-synthesis-associated genes were activated in the process of fengycin synthesis.

Entities:  

Keywords:  Bacillus amyloliquefaciens; fengycin; metabolism; regulation; transcriptomic

Mesh:

Substances:

Year:  2022        PMID: 35741746      PMCID: PMC9222730          DOI: 10.3390/genes13060984

Source DB:  PubMed          Journal:  Genes (Basel)        ISSN: 2073-4425            Impact factor:   4.141


1. Introduction

Bacillus amyloliquefaciens is a biocontrol strain that is commonly used to control pathogenic fungi and bacteria in plants. Fengycin is one of the amphipathic cyclic lipopeptide molecules produced by B. amyloliquefaciens [1]. It can interact with the lipid bilayer of the cell membrane to change its structure and permeability, making it resistant to a variety of plant pathogens [2]. Due to its broad antibacterial range, safe degradation, and low hemolysis, Fengyin has the potential to be widely employed in agriculture, food, and medicine [3]. Fengycin comprises 10 amino acids and a C14-C18 fatty acid chain [4]. Fengycin is synthesized by nonribosomal peptide synthetase (NRPS), the operon encoding fengycin synthetase is about 38 kb in length, consisting of five open reading frames of fenC, fenD, fenE, fenA, and fenB [5]. Each module in the NRPS is responsible for adding monomeric amino acids to the extended peptide chain and catalyzes the substrate activation, covalent binding, and peptide bond formation steps in the fengycin synthesis process [6]. Fengycin possesses a wide range of biological functions, but its industrial applications are limited due to the low yield and high production costs. Biological metabolic modification can obtain high-producing lipopeptide strains, but it is crucial to understand what factors influence fengycin synthesis. An analysis of transcriptome after fructose treatment could find key genes involved in the biosynthesis of fengycin. The carbon source, nitrogen source, metal ion [7], light, temperature [8], and other factors have been demonstrated to affect the production of fengycin synthase in previous investigations. Fengycin production has been increased by changing the expression level of fengycin operon [9,10]. Moreover, the expression of metabolic genes in Bacillus influences fengycin production. Genes of accA, cypC, and gapA were found to be associated with the synthesis of fengycin [11]. The PhoR/PhoP two-component system regulates fengycin production in B.subtilis NCD-2 [12]. Adding different carbohydrates to the culture has been shown to influence the bacterial metabolic process in some investigations [13]. According to other studies, introducing fructose increases the bacterial breakdown of organic contaminants. The addition of fructose promotes the ability of the bacterial flora to degrade the dye [14]. Furthermore, fructose causes a high production of polyhydroxyalkanoate(PHA) in Arctic Pseudomonas sp. [15]. In our previous work, we demonstrated that fructose efficiently boosts the production of fengycin to 392.87 mg/L in B. amyloliquefaciens [16]. In this study, efforts were made to further reveal the fructose-induced metabolic mechanism of fengycin synthesis. The results offer gene expression information to further research on fengycin metabolic pathways.

2. Materials and Methods

2.1. B. amyloliquefaciens Strain and Culture Medium

The B. amyloliquefaciens fmb-60 (CGMCC7.222) was cultured in 50 mL Landy medium (5 g/L sodium chloride, 5 g/L beef extract, 5 g/L yeast extract, 10 g/L peptone, 10 g/L glucose) at 37 °C and 160 rev min−1. Next, 5% culture solution was transferred to 100 mL modified Landy medium (ML medium, 1 g/L yeast extract, 14 g/L L-sodium glutamate, 0.5 g/L KCl, 1 g/L KH2PO4, 0.5 g/L MgSO4, 5 mg/L MnSO4, 0.17 mg/L CuSO4, 0.15 mg/L FeSO4) and modified Landy medium fructose addition (MLF medium, add 1.5 g fructose to 100 mL ML medium) incubated in a shaker for 24 h (33 °C and 160 rev min−1).

2.2. RNA Extraction and RNA Sequencing

RNeasy extraction kit (Invitrogen Life Technologies, Gaithersburg, MD, USA) was used to extract the total RNA of B. amyloliquefaciens fmb-60. The concentration and purity of total RNA were determined by NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). The extracted total RNA was used as a template to synthesize the cDNA first strand using HiScript First Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The qualified double-stranded cDNA samples were sequenced by HiSeqTM 2000 platform (Illumina, San Diego, CA, USA) for high-throughput sequencing.

2.3. Transcriptome Data and Differential Gene Expression Analysis

RNA sequencing (RNA-Seq) was analyzed by the BGI Genomics Illumina platform (Shenzhen, China, http://www.genomics.cn/index.php (accessed on 5 September 2021). The low-quality reads and adapters were removed. Then, these clean reads were mapped to the reference genome (B. amyloliquefaciens Y2) using a short oligonucleotide sequence alignment program (SOAP developed by Shenzhen Hua da Gene). Unigenes differentially expressed were screened using a false discovery rate (FDR) of <0.001 and log2 (fold change) of ≥1 as the criteria. The functional enrichment analysis of genes was conducted using Blast2Go (http://www.blast2go.org (accessed on 16 October 2021) software, and identified differentially expressed genes (DEGs) were used for Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. For gene ontology and KEGG pathway enrichment, Cluster performed (3.0) and Java Tree View software (1.1.6r2) were implemented, and enrichment results were filtered with the parameters of adjusted p-value < 0.05.

2.4. Quantitative Real-Time PCR (qRT-PCR)

The qRT-PCR reaction system is based on the instructions of the TaKaRa SYBR Premix ExTaqTMII kit (Takara, Kyoto, Japan). The primers required for the experiment are listed in Table 1. After adding primers and 1 ng cDNA template into the reaction system, the system was set up according to the following procedure: (1) 95 °C pre-denaturation for 5 s. (2) 95 °C denaturation for 5 s. (3) Extension at 60 °C for 30 s, and lasting for 40 cycles, and the signal collection step is also in the extension at 60 °C. (4) Denaturation at 95 °C for 15 s, then extension at 60 °C for 60 s, and denaturation at 95 °C for 15 s. The relative expression level of the target gene was analyzed three times.
Table 1

qRT-PCR primers used in this study.

GenePrimer NameSequence5′-3′
16s rRNA 16s rRNA-FPACGGTCGCAAGACTGAAACT
16s rRNA-RPTAAGGTTCTTCGCGTTGCTT
Sigma H Sigma H-FPTTCAGGAAGGCATGATAGGC
Sigma H-RPGTGTTTCTGGCGAGTAGCTGT
ComA ComA-FPGCTCCATCCCATTGACCTC
ComA-RPTTGTCTGTTGATTGTCTCAGTCC
degU degU-FPGCAGAAACTCCGCTTGTTG
degU-RPGCTGAAAGAGATGGATGCTGAT
AbrB AbrB-FPTGGCAAGTCATGTTTGGTTT
AbrB-RPCGAACTGCGTCGTACTCTTG
PhrC PhrC-FPCAGCCGCGATTTTTACAGC
PhrC-RPCGTCATTCCTCTTTCTGTCACAT
Spo0A Spo0A-FPCAACGAGGAAATGGAATCAA
Spo0A-RPGCGAAGCAATCTCAATGGTAT
degQ degQ-FPATGGTGAACGAGTCCTAGGT
degQ-RPTAGTCCTGTTCGCCAAATGC

3. Results

3.1. RNA-Seq Data Analysis

After transcriptome sequencing, the original MLF combination and ML group data were analyzed and summarized. The two databases generated about 13.3 and 13.6 million raw read data, respectively (Table 2). The total number of sequenced bases was 1197332460 and 1222740360, respectively, which can reach 100% coverage of the reference genome. After filtering raw reads, removing adaptors containing reads, and discarding low-quality reads, the number of reads was counted to compare different gene positions. As shown in Figure 1, reads are evenly distributed in each part of the gene. Through a global analysis of the clear reads data, the high-quality sequences obtained by sequencing are regraded to be relatively high, which can meet the needs of subsequent transcriptome analysis.
Table 2

Sequencing reads coverage ratio table.

Map to GenomeML Reads NumberMLF Reads NumberML PercentageMLF Percentage
Total Reads1330369413586004100.00%100.00%
Total BasePairs11973324601222740360100.00%100.00%
Total Mapped Reads116810941190748187.80%87.65%
perfect match3893131429870629.26%31.64%
≤5 bp mismatch7787963760877558.54%56.00%
unique match108131771037802481.28%76.39%
multi-position match86791715294576.52%11.26%
Total Unmapped Reads1622600167852312.20%12.35%
Figure 1

The distribution of transcriptome sequencing reads on the genome.

3.2. Differentially Expressed Genes GO Classification and KEGG Pathway

A total of 3617 differentially expressed genes were found by comparative analysis of transcriptomics data. Data samples with FDR ≤ 0.001 were screened, and the screening conditions were: a p-value less than 0.05 and gene fold change by more than two-times. A total of 1337 substantially differentially expressed genes were found after the screening. B. amyloliquefaciens fmb-60 exhibited 458 genes upregulated and 879 genes downregulated in the MLF medium compared to the ML medium without fructose (Figure 2).
Figure 2

Volcano plot of B. amyloliquefaciens differential gene expression under fructose induction.

Differentially expressed genes discovered in B. amyloliquefaciens fmb-60 were analyzed for GO enrichment, and the results were classified into three categories: biological processes, cellular components, and molecular functions (Figure 3). The expression of the B. amyloliquefaciens fmb-60 gene is mainly concentrated in the transport process, metabolic activity, cell membrane creation, stress response, and biological regulation process, when comparing the ML and MLF groups.
Figure 3

Gene ontology (GO) functional analysis of unique sequences from fructose and glucose transcriptome. Unique sequences were assigned to three categories: molecular function, cellular components and biological process.

KEGG cluster analysis of differentially expressed genes revealed that differentially expressed metabolic pathways are concentrated on the amino acid metabolism pathways (Figure 4), such as Histidine (ko00340), Arginine (ko00330), Alanine (ko00250), Glutamate (ko00470), Valine (ko00290). Bacterial chemotaxis (ko00230), phosphate transport system (ko00260), flagellar assembly (ko00240), and fatty acid metabolism (ko00071); all of these were altered.
Figure 4

KEGG enrichment factor bubble chart.

3.3. Differentially Expressed Genes Analysis

RNA-seq results support the previous research, demonstrating that the fructose-induced condition of B. amyloliquefaciens is a multigenic response. Several metabolic pathways change with fructose condition, which involves changes in metabolisms, such as amino acid metabolism, fatty acid metabolism, energy metabolism, transport system, and gene transcription and regulation (Figure 5). In addition, the transcriptome data revealed that the expression of the fengycin synthase operon had increased by two-times. As shown in Figure 6, changes in multiple metabolic pathways affect the synthesis of fengycin.
Figure 5

Gene expression change heat map, A: gene expression of Bacillus amyloliquefaciens cultured in ML medium, B: gene expression of Bacillus amyloliquefaciens cultured in MLF medium.

Figure 6

The effect of fructose on the synthesis of fengycin by B. amyloliquefaciens.

3.3.1. Amino Acid Metabolism

According to the transcriptome data, the amino acid metabolism process undergwent significant alterations. Transcription of valine, leucine, isoleucine, and serine biosynthetic were upregulated, including branched-chain amino acid aminotransferase (ywaA), acetolactate synthase catalytic subunit (ilvB), and glycerate dehydrogenase (serA). The genes of alanine racemase (ync) and glutamate dehydrogenase (rocG) were downregulated.

3.3.2. Fatty Acid Metabolism

Fatty acids are key components of fengycin, and the content of fatty acids in B. amyloliquefaciens affects the biosynthesis of fengycin. Transcriptome sequencing results found that the gene expression involved in fatty acid metabolism changed, such as S-malonyltransferase (bmyD), bacilysin biosynthesis oxidoreductase (ywfH), 3-oxoacyl-acyl-carrier protein reductase during fatty acid biosynthesis (DfnC), and acyl-CoA dehydrogenase (ydbM) transcript content, with all being increased. Fatty-acyl-CoAsynthase (yhfL), long-chain fatty-acid-CoA ligase (lcfA), CoA dehydrogenase (yngJ), acyl-CoA dehydrogenase (yusJ), enoyl-CoA hydratase (ysiB) and other fatty-acid-degradation-pathway-related genes were down-regulated.

3.3.3. Energy Metabolism

A total of 24 DEGs linked with energy metabolism were discovered through transcriptomic analysis. NADH dehydrogenase (yqjM), cytochrome c oxidase subunit assembly protein (ctaA), and cytochrome ubiquinol oxidase (qoxABCD) were upregulated. Electron transfer flavoprotein alpha subunit (etfA), electron transfer flavoprotein beta subunit (etfB), cytochrome c oxidase (ctaDEFG), ATP synthase (yqjB), and oxidative-phosphorylation-related genes were downregulated.

3.3.4. Transport System

The transcriptional analysis revealed 81 DEGs associated with the transport system were identified under fructose conditions, including 13 in the phosphotransferase system (PTS), 29 in the ATP-binding cassette transporters (ABC transport system), 16 in the major facilitator superfamily transport system (MFS), and 23 other transport-related genes. Fructose transporter (fruA), glucose symporter (glcP1), multiple sugar transport system permease protein (yurM, yurN), amino acid transporter amino acid transporter, AAT family (gabP, ybgF), polar amino acid transport system (ytmJ, ytmK, ytmL, ytmM, ytmN), ammonium salt transporter (narK) chloramphenicol resistance protein (ybcL) and 26 other genes were upregulated. Lactose/L-arabinose transport system (araP, araN, araQ), ribose transport system (rbsA, rbsB, rbsC, rbsD), PTS system component (mtlA, mtlA1, ywbA, licA, licB, licC), putative glutamine transport system (glnQ, glnM, glnH), polar amino acid transport system (yqiX, yqiY, yqiZ), glycerol uptake facilitator (glpF, glpP), and iron complex transport system (feuA, feuB, feuC, fhuB) were downregulated.

3.3.5. Gene Transcription and Regulation

There are numerous transcriptional regulation mechanisms in B.amyloliquefaciens that are used to regulate the synthesis of fengycin. RNA-seq revealed 43 DEGs associated with transcriptional regulatory factors, such as HTH-type transcriptional regulator (alsR, ydhC2, citR, yuxN, cueR, MUS_4114, norG1, yazB1), DeoR family transcriptional regulator (fruR), response regulator (ComA), the expression of 23 transcriptional regulatory factors, including polymerase sporulation-specific sigma factor (SigH, SigW) and two-component system (degQ, degU) were upregulated, while RNA polymerase sigma factor (SigB, SigE, SigF, SigG, SigL), transcriptional regulator (AbrB), stage 0 sporulation protein A (Spo0A), two-component response regulator (PhrC) and 19 other transcription factors were down-regulated. Based on transcriptome data and the regulatory mechanisms involved in the synthesis of lipopeptides in the previous study, we employed qRT-PCR to confirm the transcriptional regulatory factors: ComA, SigH, AbrB, degQ, degU, PhrC, Spo0A. As shown in Figure 7, the expression levels of sigmaH and degU-degQ two-component systems increased the most significantly.
Figure 7

qRT-PCR analysis of fructose effects on the signal factors gene expression in B. amyloliquefaciens fmb-60.

4. Discussion

B. amyloliquefaciens is a biological control potential strain that can produce fengycin and other surfactants with potent antifungal activities. In order to explain the gene expression pattern and compare the gene transcription under ML and MLF culture conditions, we screened out 1337 significantly differentially expressed genes focused on amino acid metabolism, fatty acid metabolism, energy metabolism, transport process, and gene transcription regulation process. Fengycin is a lipopeptide molecule with a circular decapeptide structure; amino acids are its essential components. The lipopeptide synthesis process starts with connecting amino acids in a circular polypeptide structure under the action of NRPS synthetase and then combining with fatty acids to form an amphiphilic molecule [17]. Our previous research demonstrated the promoted production of fengycin by adding fructose to the medium [18]. The transcriptome results illustrated that adding fructose increased the biosynthesis of valine, leucine, isoleucine, and serine biosynthesis. For example, excess pyruvate produced by glycolysis is used as a precursor for amino acid synthesis. Pyruvate is acetylated during the synthesis of valine and alanine. Lactic acid synthase is converted into hydroxyethyl in the synthesis pathway of valine and isoleucine [19]. Fructose activates the expression of genes related to amino acid synthesis and improves the biosynthesis of fengycin. As non-polar components of fengycin, the content of fatty acids is one of the limiting factors of lipopeptide synthesis. Fengycin production of B. subtilis was increased to 130.11 mg/L after strengthening fatty acid metabolism [20]. The biological activity and yield of inturin and fengycin are increased in B. amyloliquefaciens PC3 by adding alkanoic acid to the medium [21]. Fengycin synthesis is an energy-consuming process, and the adenylation of amino acids in the NRPS system requires the consumption of ATP [22]. Therefore, maintaining the dynamic balance of energy metabolism in cells is crucial for the synthesis of fengycin [23]. Transcriptome data show that the expression level of yqjM is increased by 4.3-times. Cytochrome c oxidase can discharge protons into the membrane gap, transfer electrons to oxygen, and produce water, and its expression drops to 0.47-times. In the presence of fructose, the energy-related genes of B. amyloliquefaciens fmb-60 alter, potentially affecting fengycin synthesis. The addition of fructose influences the transport process of B. amyloliquefaciens, which increases the expression of transporters of dominant carbon sources, such as fructose and glucose. In contrast, the expression of non-dominant carbon sources, such as lactose, ribose, and cellobiose transporters, was decreased due to carbon catabolite repression (CCR). When dominant carbon sources are present, bacteria preferentially utilize dominant carbon sources and suppress other carbon source metabolism and transport-related genes, reducing unnecessary gene expression and enhancing metabolic efficiency [24]. We discovered that the expression of all iron-transport-related genes in the transcriptome data were down-regulated, which could be related to the concentration of iron ions in the medium [25]. Fengycin synthesis is not affected by the gene transcription process but is regulated by the gene regulatory network because fengycin is synthesized by substrate catalysis. Lipopeptide synthesis is regulated by transcriptional factors (sigmaH, Spo0A, AbrB), two-component systems (degU, degQ), and quorum-sensing systems (ComA, PhrC) [26]. As a transcription regulator, SigmaH recognizes the start site of mRNA transcription to promote gene expression [27]. The signal protein AbrB is a lipopeptide transcription inhibitor, and Spo0A is a transcription regulator in the sporulation process. Here, phosphorylated Spo0A plays a constructive role in fengycin production via inhibiting the expression of AbrB [28]. Recent studies have proved that DegQ increases the production of Fengycin [29]. Moreover, there are regulatory sites for ComA and DegU in the upstream region of the DegQ promoter, meaning that the expression of DegQ is regulated by ComA and DegU [30]. ComA is a response regulator in the quorum-sensing system during the formation of Bacillus competence. When the concentration of ComX reaches a certain threshold, ComA is phosphorylated to ComA-P by ComP and combined with the promoter of fengycin synthase to activate transcription [31]. PhrC is a competence, and sporulation factor (CSF) initiates the transcription by PhrC, binds to the phosphatase RapC, and inhibits its activity. Thus, reducing the impact of RapC on ComA-P, the dephosphorylation of this compound maintains the activity of ComA-P to ensure the transcription level of lipopeptide synthase. For instance, the production of surfactin in B.subtilis was increased by overexpressing the signal peptides PhrC and ComX [32]. Overall, the expression of SigmaH, Spo0A, degU, degQ, ComA, and PhrC are advantageous to transcription of the fengycin synthase gene and the fengycin production.

5. Conclusions

This study systematically analyzed gene expression about fengycin biosynthesis, amino acid metabolism, fatty acid metabolism, energy metabolism, and other critical factors, under different fructose supply conditions. Our analysis found 458 genes were upregulated and 879 genes were downregulated. Furthermore, the positive regulators of fengycin synthesis, degQ, degU, and sigmaH, were upregulated, while the negative regulator of AbrB was downregulated. In conclusion, this article describes the effect of fructose addition on fengycin synthesis by B. amyloliquefaciens at the transcriptional level and provides evidence for elucidating the regulation of fengycin synthesis. Our study shows changes in gene expression, but the mechanism of genes induce fengycin synthesis requires further investigation.
  25 in total

1.  Study of the correlation between fengycin promoter expression and its production by Bacillus subtilis under different culture conditions and the impact on surfactin production.

Authors:  Yazen Yaseen; Frédérique Gancel; Max Béchet; Djamel Drider; Philippe Jacques
Journal:  Arch Microbiol       Date:  2017-07-22       Impact factor: 2.552

2.  Sequential induction of Fur-regulated genes in response to iron limitation in Bacillus subtilis.

Authors:  Hualiang Pi; John D Helmann
Journal:  Proc Natl Acad Sci U S A       Date:  2017-11-13       Impact factor: 11.205

3.  Fructose as an additional co-metabolite promotes refractory dye degradation: Performance and mechanism.

Authors:  Qingyun Zhang; Xuehui Xie; Yanbiao Liu; Xiulin Zheng; Yiqin Wang; Junhao Cong; Chengzhi Yu; Na Liu; Jianshe Liu; Wolfgang Sand
Journal:  Bioresour Technol       Date:  2019-02-10       Impact factor: 9.642

4.  Improvement of surfactin production in Bacillus subtilis using synthetic wastewater by overexpression of specific extracellular signaling peptides, comX and phrC.

Authors:  Ju Jung; Kyung Ok Yu; Ahmad Bazli Ramzi; Se Hoon Choe; Seung Wook Kim; Sung Ok Han
Journal:  Biotechnol Bioeng       Date:  2012-04-24       Impact factor: 4.530

5.  Effect of metal ions on lipopeptide secretion from Bacillus subtilis strain FJAT-4: Negative regulation by Ca2.

Authors:  Meichun Chen; Meixia Zheng; Yanping Chen; Rongfeng Xiao; Xuefang Zheng; Bo Liu; Jieping Wang; Yujing Zhu
Journal:  J Appl Microbiol       Date:  2021-11-09       Impact factor: 3.772

6.  Fructose-Based Production of Short-Chain-Length and Medium-Chain-Length Polyhydroxyalkanoate Copolymer by Arctic Pseudomonas sp. B14-6.

Authors:  Tae-Rim Choi; Ye-Lim Park; Hun-Suk Song; Sun Mi Lee; Sol Lee Park; Hye Soo Lee; Hyun-Joong Kim; Shashi Kant Bhatia; Ranjit Gurav; Kwon-Young Choi; Yoo Kyung Lee; Yung-Hun Yang
Journal:  Polymers (Basel)       Date:  2021-04-26       Impact factor: 4.329

7.  Flux Connections Between Gluconate Pathway, Glycolysis, and Pentose-Phosphate Pathway During Carbohydrate Metabolism in Bacillus megaterium QM B1551.

Authors:  Julie A Wushensky; Tracy Youngster; Caroll M Mendonca; Ludmilla Aristilde
Journal:  Front Microbiol       Date:  2018-11-21       Impact factor: 5.640

8.  Expression of degQ gene and its effect on lipopeptide production as well as formation of secretory proteases in Bacillus subtilis strains.

Authors:  Lars Lilge; Maliheh Vahidinasab; Isabel Adiek; Philipp Becker; Chanthiya Kuppusamy Nesamani; Chantal Treinen; Mareen Hoffmann; Kambiz Morabbi Heravi; Marius Henkel; Rudolf Hausmann
Journal:  Microbiologyopen       Date:  2021-10       Impact factor: 3.139

9.  Influence of B. subtilis 3NA mutations in spo0A and abrB on surfactin production in B. subtilis 168.

Authors:  Peter Klausmann; Lars Lilge; Moritz Aschern; Katja Hennemann; Marius Henkel; Rudolf Hausmann; Kambiz Morabbi Heravi
Journal:  Microb Cell Fact       Date:  2021-09-26       Impact factor: 5.328

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.