Serological Variety and Antimicrobial Resistance in Salmonella Isolated from Reptiles.

Salmonella enterica is one of the best adapted bacterial pathogens causing infections in a wide variety of vertebrate species. The aim of this study was to investigate the prevalence of Salmonella in different reptile species and to evaluate their serological variety and patterns of antimicrobial resistance. In total, 97 samples from 25 wild and domesticated reptile species were investigated in Lithuania. Serological variety, as well as phenotypical and genotypical resistance to antimicrobials, were investigated. Fifty isolates of Salmonella were obtained from the ninety-seven tested samples (51.5%; 95% CI 41.2-61.2). A significantly higher prevalence of Salmonella was detected in domesticated individuals (61.3%; 95% CI 50.0-71.5) compared with wild ones (18.2%; 95% CI 7.3-38.5). All isolates belonged to a single species, Salmonella enterica. Results demonstrated that reptiles carry a large variety of Salmonella serovars. Thirty-four isolates (68%) of Salmonella were resistant to at least one antimicrobial drug. The most frequent resistance of the isolates was to streptomycin (26%), cefoxitin, gentamicin, tetracycline and chloramphenicol (16%). Genes encoding resistance to tetracyclines, aminoglycosides, sulphonamides and trimethoprim were detected. No integrons that are associated with horizontal gene transfer were found. Data obtained provided knowledge about the adaptation of Salmonella in reptiles. Healthy individuals, irrespective of their origin, often carry Salmonella, including multi-resistant strains. Due to its large serological diversity, zoonotic potential and antimicrobial resistance, Salmonella in reptiles poses a risk to other animals and humans.

1. Introduction

Salmonella is a well-known pathogen that is prevalent in multiple species of vertebrates. Although the carriage of Salmonella species (Salmonella bongori and Salmonella enterica) in the intestinal tract of reptiles usually does not cause illness to themselves, it can cause serious infections in people, in particular young children, elderly people or immunocompromised individuals. Salmonella is a zoonotic bacterium and was isolated from multiple vertebrate species, including both warm- and cold-blooded animals [1,2].

Salmonella is divided into 60 serogroups and more than 2300 serovars [3]. Except for characterizing clinical aspects of a few serovars, such as Salmonella enterica (S. enterica) serovar Typhi, serogrouping and serotyping are mainly used as public health tools to recognize outbreaks and identify and control sources of infection [3,4]. Salmonellaenterica spp. enterica serovars are considered zoonotic or potentially zoonotic. The most common serovars infecting humans worldwide are S. serovar (ser.) Typhimurium and S. ser. Enteritidis [1].

Humans may become infected through direct contact with reptiles or indirectly by manipulating objects, home stuff or contaminated food [1,5,6,7,8,9]. Globally, it is estimated that there are 93.8 million cases of salmonellosis per year caused by different reasons [10,11]. It is estimated that over 70,000 people get salmonellosis from reptiles each year in the United States, while 160,649 human cases of salmonellosis were reported in 2006 in 25 European countries, including Bulgaria, Romania, Iceland, Liechtenstein, Latvia, Germany, France and Norway [12,13].

Humans and animals share bacterial species including resistant ones. Antibiotic resistance of bacteria to antimicrobials is currently a primary concern in both human and veterinary medicine. For this reason, epidemiological studies in domestic and wild animals should be performed on a regular basis [1,2]. Resistant pathogens, including Salmonella enterica, should be of particular attention as these bacteria are very well adapted to different hosts, carry different genes encoding for both virulence and antimicrobial resistance and are currently among the most common infectious agents isolated from humans with food-borne infections. The aim of this study was to investigate the prevalence of Salmonella in different reptile species and to evaluate their serological variety and patterns of antimicrobial resistance.

2. Materials and Methods

2.1. Samples and Place

In 2020–2021, samples (n = 97) of domesticated reptile faeces and cloacal swabs of wild reptiles were collected using sterile cotton swabs with a transport medium (Transwab® Amies, Corsham, UK). Domesticated reptiles such as pet animals were sampled all over Lithuania from private keepers as well as in the Lithuanian Zoo. All animals were clinically healthy and underwent physical examination by a veterinarian before sampling. No treatments with antibiotics were performed for at least 6 months before sampling. Wild reptiles were caught and samples were collected from three main locations in Lithuania: Raguva (55.56472 24.61574); (55.564476 24.617858); the Rumšiškės forest (54.881027 24.178046); (54.881832 24.178994) and Čepkeliai—Dzūkija National Park (54.0214 24.4289), (54.0225 24.4831), (54.0562 24.4241), (54.0606 24.4302). Ethical approval for this study was given by the Lithuanian Environmental Protection Agency (permissions numbers AS-4800 and AS-4884).

Samples were delivered to the laboratory within 24 h of collection, kept in containers with transport media on ice for 1–2 h then followed by refrigeration at +2–4 °C. In total, 97 samples were collected from 25 different species of reptiles (Table 1).

Table 1

Species and number of tested reptiles.

Domesticated and Wild Reptile Species
Snakes	Number
Grass snake (Natrix natrix)	13
California kingsnake (Lampropeltis californiae)	9
King ratsnake (Elaphe carinata carinata)	7
Taiwan beauty ratsnake (Elaphe taeniura friesei)	6
Mexican vine snake (Oxybelis aeneus)	6
Corn snake (Pantherophis guttatus)	5
Milk snake (Lampropeltis triangulum)	5
Desert kingsnake (Lampropeltis splendida)	5
Smooth snake (Coronella austriaca)	4
Boa constrictor (Boa constrictor)	3
Brown house snake (Boaedon capensis)	2
Ball python (Python regius)	2
Western hognose snake (Heterodon nasicus)	1
Banded water snake (Nerodia fasciata)	1
Total:	69
Lizards	Number
Slow worm (Anguis fragilis)	5
Central bearded dragon (Pogona vitticeps)	5
Crested gecko (Correlophus ciliatus)	4
Great plated lizard (Gerrhosaurus major)	3
Frill-necked lizard (Chlamydosaurus kingii)	2
Plumed basilisk (Basiliscus plumifrons)	2
Chinese water dragon (Physignathus cocincinus)	2
Common chameleon (Chamaeleo chamaeleon)	1
Green iguana (Iguana iguana)	1
Common leopard gecko (Eublepharis macularius)	1
Total:	26
Turtles	Number
Central Asian tortoise (Testudo horsfieldii)	2
Total:	2

2.2. Isolation and Identification of Salmonella

Isolation of Salmonella was performed according to the EN ISO 6579-1 (ISO, 2017) [14] procedure for Salmonella detection. Xylose lysine deoxycholate (XLD) agar and Salmonella Shigella (SS) agar (Oxoid, Basingstoke, UK) were used as plating media after the enrichment procedure. The randomly selected separate colonies (one colony per sample) were identified using the “Microgen Gram-Negative Plus” biochemical identification system (Microgen, Camberley, UK).

Salmonella serotyping was carried out by standard slide agglutination test (CEN ISO/TR 6579-3:2014) [15] with polyvalent and monovalent somatic (O) and flagella (H) antisera (Statens Serum Institute Denmark and Sifin, Berlin, Germany). Firstly, suspected colonies were picked up and tested with somatic O polyvalent and O polyvalent group antisera. In the case of a positive reaction, testing according to the Kaufman–White scheme was applied. If the suspect colony did not show any reaction with O polyvalent antisera, Salmonella species and subspecies were identified by biochemical properties. Serotyping results were evaluated according to the Kaufmann–White Salmonella serotyping scheme.

2.3. Susceptibility Testing

Antimicrobial susceptibility testing was performed using the disk diffusion method according to Kirby-Bauer. Antimicrobials of different classes were selected with the aim of addressing the risk of salmonellosis to public health. The following disks were used: ampicillin (10), cefoxitin (30), gentamicin (10), chloramphenicol (30), sulfamethoxazole-trimethoprim (25), cefpodoxime (10), ciprofloxacin (5), tetracycline (30), ofloxacin (5), streptomycin (10) and doxycycline (30). The results were interpreted according to the European Committee on Antimicrobial Susceptibility Testing licensed by EUCAST 2022 clinical breakpoints [16] whenever possible. For tetracycline, doxycycline, cefpodoxime and streptomycin the interpretation of the results was performed using Clinical and Laboratory Standards Institute (CLSI) guidelines [17]. In the case of resistance to at least three or more antimicrobial classes, the isolates were treated as multi-resistant isolates.

2.4. Molecular Testing

The resistant Salmonella isolates were tested by polymerase chain reaction (PCR) for detection of the genes encoding resistance. DNA material for molecular testing was obtained after bacterial lysis was performed as described previously [18]. PCR included 30 cycles of denaturation (94 °C, 30 s), annealing (30 s) and extension (94 °C, 90 s). Annealing temperatures and oligonucleotides used are presented in Table 2. As a negative control, DNA/RNA-free water was used instead of the antigen whereas, for the positive control strains, Enterobacteriaceae from the culture collection of the Microbiology and Virology Institute at the Lithuanian University of Health Sciences were used.

Table 2

Antimicrobial resistance genes tested and oligonucleotide primers used in the study.

Primer Name	Sequence (5′-3′)	Size, bp and t (°C)	Target Gene	Source
blaTEM-F	GAGTATTCAACATTTTCGT	857 (50)	tem	[19]
blaTEM-R	ACCAATGCTTAATCAGTGA
blaSHV-F	TCGCCTGTGTATTATCTCCC	768 (60)	shv	[20]
blaSHV-R	CGCAGATAAATCACCACAATG
oxa1-F	TCAACAAATCGCCAGAGAAG	276 (55)	OXA group I	[21]
oxa1-R	TCCCACACCAGAAAAACCAG
oxa3-F	TTTTCTGTTGTTTGGGTTTT	427 (52)	OXA group III
oxa3-R	TTTCTTGGCTTTTATGCTTG
OXA 5 group-F	AGCCGCATATTTAGTTCTAG	644 (56)	OXA group V
OXA 5 group-R	ACCTCAGTTCCTTTCTCTAC
CTX-M-F	ATGTGCAGYACCAGTAARGT	593 (50)	ctxM	[22]
CTX-M-R	TGGGTRAARTARGTSACCAGA
cmy2-F	GCACTTAGCCACCTATACGGCAG	758 (58)	cmy	[23]
cmy2-R	GCTTTTCAAGAATGCGCCAGG
PER-1-F	ATGAATGTCATTATAAAAGCT	927 (48)	per	[24]
PER-1-R	TTAATTTGGGCTTAGGG
PER-2-F	ATGAATGTCATCACAAAATG	927 (49)
PER-2-R	TCAATCCGGACTCACT
tetA-F	GTGAAACCCAACATACCCC	888 (55)	tetA	[25]
tetA-R	GAAGGCAAGCAGGATGTAG
tetB-F	CCTTATCATGCCAGTCTTGC	774 (55)	tetB
tetB-R	ACTGCCGTTTTTTCGCC
aadB-F	ATGGACACAACGCAGGTCGC	534 (55)	aadB	[26]
aadB-R	TTAGGCCGCATATCGCGACC
aadA-F	GTGGATGGCGGCCTGAAGCC	528 (68)	aadA
aadA-R	AATGCCCAGTCGGCAGCG
rmtB-F	ATGAACATCAACGATGCCCT	769 (55)	rmtB	[27]
rmtB-R	CCTTCTGATTGGCTTATCCA
armA-F	CAAATGGATAAGAATGATGTT	774 (55)	armA	[28]
armA-R	TTATTTCTGAAATCCACT
aphA1-F	AAACGTCTTGCTCGAGGC	500 (55)	aphA1	[29]
aphA1-R	CAAACCGTTATTCATTCGTGA
aacA4-F	ATGACTGAGCATGACCTTGCG	487 (55)	aacA4	[30]
aacA4-R	TTAGGCATCACTGCGTGTTCG
aac(3)II-F	TGAAACGCTGACGGAGCCTC	369 (65)	aac(3)II	[31]
aac(3)II-R	GTCGAACAG GTAGCACTGAG
strA-F	CCTGGTGATAACGGCAATTC	546 (55)	strA	[32]
strA-R	CCAATCGCAGATAGAAGGC
strB-F	ATCGTCAAGGGATTGAAACC	509 (55)	strB
strB-R	GGATCGTAGAACATATTGGC
catII-F	ACACTTTGCCCTTTATCGTC	495 (55)	catII	[33]
catII-R	TGAAAGCCATCACATACTGC
cmlA-F	TTGCAACAGTACGTGACAT	293 (55)	cmlA	[34]
cmlA-R	ACACAACGTGTACAACCAG
sul1-F	TTCGGCATTCTGAATCTCAC	822 (55)	sul1-F	[35]
sul1-R	ATGATCTAACCCTCGGTCTC
sul2-F	CGGCATCGTCAACATAACC	722 (50)	sul2-F	[36]
sul2-R	GTGTGCGGATGAAGTCAG
sul3-F	GAGCAAGATTTTTGGAATCG	792 (51)	sul3-F
sul3-R	CATCTGCAGCTAACCTAGGGCTTTGA
Dfr1-F	ACGGATCCTGGCTGTTGGTTGGACGC	254 (55)	dfr1	[37]
Dfr1-R	CGGAATTCACCTTCCGGCTCGATGTC
Dfr5-F	GCBAAAGGDGARCAGCT	394 (44)	dfr5	[38]
Dfr5-R	TTTMCCAYATTTGATAGC
DfrA7-F	AAAATTTCATTGATTTCTGCA	471 (44)	dfr7	[39]
DfrA7-R	TTAGCCTTTTTTCCAAATCT
qnrA-F	ATTTCTCACGCCAGGATTTG	516 (53)	qnrA	[40]
qnrA-R	GATCGGCAAAGGTTAGGTCA
qnrB-F	GATCGTGAAAGCCAGAAAGG	469 (53)	qnrB
qnrB-R	ACGATGCCTGGTAGTTGTCC
qnrS-F	ACGACATTCGTCAACTGCAA	417(53)	qnrS
qnrS-R	TAAATTGGCACCCTGTAGGC
qepA-F	CAGTGGACATAAGCCTGTTC	218 (60)	qepA	[41]
qepA-R	CCCGAGGCATAGACTGTA
teg1-F	TTATTGCTGGGATTAGGC	164 (55)	integrase I class	[42]
teg1-R	ACGGCTACCCTCTGTTATC
teg2-F	ACGACATTCGTCAACTGCAA	233 (50)	integrase II class	[43]
teg2-R	TAAATTGGCACCCTGTAGGC

2.5. Data Analysis

Statistical analysis was performed using the IBM SPSS Statistics package, version 27 (SPSS Inc., Chicago, IL, USA). For percentage estimates, Wilson (score) 95% confidence intervals (CI 95%) and their ranges for true population proportions were calculated. Comparison between categorical variables was calculated using a chi-squared test or Fisher’s exact test for small counts. Results were considered statistically significant if p < 0.05. The number of genes encoding resistance to separate antimicrobials was expressed in % from the number of resistant isolates tested.

3. Results

3.1. Salmonella Prevalence in Reptiles

In total, 97 reptile samples were tested, of which 22 samples came from wild reptiles and 75 samples from domesticated animals. Fifty animals were positive for Salmonella (51.5%; 95% CI 41.2–61.2), as determined by isolation of the cultures with further biochemical identification. All of the isolates belonged to a single species, Salmonella enterica. The results demonstrated that the frequency of Salmonella prevalence was significantly higher in domesticated reptiles than in wild ones (p < 0.0475). Forty-six isolates (61.3% 95% CI 50.0–71.5) were obtained from domesticated reptiles and four (18.2%; 95% CI 7.3–38.5) were obtained from wild individuals. Overall, Salmonella was isolated from 17 out of the 25 reptile species (68%) included in this study. The prevalence of Salmonella in different reptile species is presented in Table 3.

Table 3

Species of reptiles carrying Salmonella isolates.

Domesticated Reptile Species	Number of Salmonella Carriers/Tested
California kingsnake (Lampropeltis californiae)	8 of 9
Desert kingsnake (Lampropeltis splendida)	5 of 5
Mexican vine snake (Oxybelis aeneus)	5 of 6
Taiwan beauty rat snake (Elaphe taeniura friesei)	5 of 6
Corn snake (Pantherophis guttatus)	4 of 5
Milk snake (Lampropeltis triangulum)	4 of 5
King ratsnake (Elaphe carinata carinata)	4 of 7
Crested gecko (Correlophus ciliatus)	2 of 4
Boa constrictor (Boa constrictor)	2 of 3
Brown house snake (Boaedon capensis)	2 of 2
Western hognose snake (Heterodon nasicus)	1 of 1
Great plated lizard (Gerrhosaurus major)	1 of 3
Banded water snake (Nerodia fasciata)	1 of 1
Common leopard gecko (Eublepharis macularius)	1 of 1
Chinese water dragon (Physignathus cocincinus)	1 of 2
Total:	46 of 60
Wild reptile species	Number
Grass snake (Natrix natrix)	3 of 13
Smooth snake (Coronella austriaca)	1 of 4
Total:	4 of 17

3.2. Serological Variety of the Salmonella Isolates

In total, 34 Salmonella isolates showing antimicrobial resistance were serotyped. Twenty-seven out of thirty-four (79.4%) isolates had a positive reaction only with O (somatic) antisera, whereas only three strains had a positive reaction with H grouping antisera. Different serogroups and serovars were identified including IIIa, enterica arizonae/IIIb, enterica diarizonae, Sherbrooke, Maiduguri, Waycross, Macallen, and others. Most of the isolates belonged to O:4, O:8 and O:18 serogroups; some serogroups, including O:41, O:30 and O:3.10 were only detected in up to three isolates, and some were detected just by single isolates. Characteristics of Salmonella isolated from domesticated and wild reptiles according to their serological patterns are presented in Table 4 and Table 5.

Table 4

Characteristics of Salmonella isolated from domesticated reptiles.

Reptile Species	Identification by Biochemical Testing	Phenotypic Resistance	Genotypic Resistance	Serovar or Serogroup
Boa constrictor (Boa constrictor)	Salmonella sub.2	TE, CN, PX	tetA	IIIa, enterica arizonae; IIIb enterica diarizonae
Milk snake (Lampropeltis triangulum)	Salmonella sub.3 A S. enterica subsp. arizonae	TE, CN, C, PX	aadA,	IIIa, enterica arizonae; IIIb enterica diarizonae
Boa constrictor(Boa constrictor)	Salmonella sub.4	TE, CN, C, STR, AMP, CIP	aadA,	O:8
Brown house snake (Boaedon capensis)	Salmonella sub.3B	CN, STR	aadA,	Florida
Taiwan beauty rat snake(Elaphe taeniura friesei)	Salmonella sub.5	CN	-	O:4
Corn snake (Pantherophis guttatus)	Salmonella sub.3 A S. enterica subsp. arizonae	CN	armA	O:65
King ratsnake (Elaphe carinata carinata)	Salmonella sub.2	FOX, CN, STR, PX	armA	O:4
Crested gecko (Correlophus ciliatus)	Salmonella sub.3 A S. enterica subsp. arizonae	FOX, C	-	Sherbrooke
Crested gecko (Correlophus ciliatus)	Salmonella sub.3 A S. enterica subsp. arizonae	STR	-	Maiduguri
Desert kingsnake (Lampropeltis splendida)	Salmonella sub.I A S. enterica	FOX, TE,	tetA, tet B	O:41
Mexican vine snake (Oxybelis aeneus)	Salmonella sub.3 A S. enterica subsp. arizonae	STR	-	Waycross
California kingsnake (Lampropeltis californiae)	Salmonella sub.1 S. enterica	DO, TE,	tetA, tet B	Waycross
California kingsnake (Lampropeltis californiae)	S. enterica subsp. S bongori V	STX, STR	dfr1	O48, IIIa/IIIb
Corn snake (Pantherophis guttatus)	Salmonella group 2 S. enterica subsp. arizonae	CN, SXT, STR, AMP	armA, sul2, dfr1	O:4
Corn snake (Pantherophis guttatus)	Salmonella group2 S. enterica subsp. arizonae	STR	-	O44 IIIa/IV
Milk snake (Lampropeltis triangulum)	Salmonella sub.3 A S. enterica subsp. arizonae	STR	-	O:57
Western hognose snake (Heterodon nasicus)	Salmonella sub.3 A S. enterica subsp. arizonae	STR	-	O:65 IIIb
Great plated lizard (Gerrhosaurus major)	Salmonella sub.2	C	-	O:41
California kingsnake (Lampropeltis californiae)	Salmonella sub.2	STR	-	O:8
Banded water snake (Nerodia fasciata)	Salmonella sub.3 A S. enterica subsp.arizonae	STR	-	O:50
Milk snake (Lampropeltis triangulum)	Salmonella sub.2	AMP	-	O:30
Common leopard gecko (Eublepharis macularius)	Salmonella sub.2	STR	-	O:18
Taiwan beauty rat snake (Elaphe taeniura friesei)	Salmonella sub.3 A S. enterica subsp. arizonae	STR	-	O:18 (K)
Brown house snake (Boaedon capensis)	Salmonella sub.3 A S. enterica subsp. arizonae	C	-	O:8 (C2–C3)
Desert kingsnake (Lampropeltis splendida)	Salmonella sub.2	CIP	-	O:3,10 (E1)
King ratsnake (Elaphe carinata carinata)	Salmonella sub.3 A S. enterica subsp. arizonae	TE	tetA, tet B	O:3.10 (E1)
California kingsnake (Lampropeltis californiae)	Salmonella sub.3 A S. enterica subsp. arizonae	FOX, TE, SXT, PX, AMP, OFX	tetA,tetB	O:1; 3.19 (E)
Taiwan beauty rat snake (Elaphe taeniura friesei)	Salmonella sub.3 A S. enterica subsp. arizonae	FOX, CIP,	-	O:40 (R)
Mexican vine snake (Oxybelis aeneus)	Salmonella sub.3 A S. enterica subsp. arizonae	TE	tetA, tetB	O:44 (V)
Chinese water dragon (Physignathus cocincinus)	Salmonella sub.3 A S. enterica subsp. arizonae	FOX, TE, SXT, C, STR, PX, AMP	sul2, dfr7	O:30

AMP: ampicillin; FOX: cefoxitin; STR: streptomycin; CN: gentamicin; TE: tetracycline; DO: doxycycline; C: chloramphenicol; CIP: ciprofloxacin; OFX: ofloxacin; SXT: sulfamethoxazole-trimethoprim; PX: cefpodoxime.

Table 5

Characteristics of Salmonella isolated from wild reptiles.

Reptile Species	Identification by Biochemical Testing	Phenotypic Resistance	Genotypic Resistance	Serovar or Serogroup
Smooth snake (Coronella austriaca)	Salmonella group I	TE, STR	tetA, tetB	O:43 (U)
Grass snake (Natrix natrix)	Salmonella sub.3 A S. enterica subsp. arizonae	DO, FOX, TE, SXT, STR, PX, AMP	dfr1	O:3,10 (E1),Macallen
Grass snake (Natrix natrix)	Salmonella sub.2	FOX, TE, C, STR, AMP	tetA, tetB	O:18
Grass snake(Natrix natrix)	Salmonella sub.2	TE, SXT, AMP, CIP, OFX	sul2	O:18 (K)

AMP: ampicillin; FOX: cefoxitin; STR: streptomycin; TE: tetracycline; DO: doxycycline; C: chloramphenicol; CIP: ciprofloxacin; OFX: ofloxacin; SXT: sulfamethoxazole-trimethoprim; PX: cefpodoxime.

3.3. Antimicrobial Resistance

Of 50 Salmonella isolates, 34 (68%) were resistant to at least one tested antimicrobial. The resistant isolates recovered from domesticated and wild reptiles are presented in Table 6.

Table 6

Species of reptiles carrying antimicrobial resistant Salmonella isolates.

Domesticated Reptile Species	Number
California kingsnake (Lampropeltis californiae)	4
Corn snake (Pantherophis guttatus)	3
Milk snake (Lampropeltis triangulum)	3
Taiwan beauty rat snake (Elaphe taeniura friesei)	3
Desert kingsnake (Lampropeltis splendida)	2
Mexican vine snake (Oxybelis aeneus)	2
King ratsnake (Elaphe carinata carinata)	2
Crested gecko (Correlophus ciliatus)	2
Boa constrictor (Boa constrictor)	2
Brown house snake (Boaedon capensis)	2
Western hognose snake (Heterodon nasicus)	1
Great plated lizard (Gerrhosaurus major)	1
Banded water snake (Nerodia fasciata)	1
Common leopard gecko (Eublepharis macularius)	1
Chinese water dragon (Physignathus cocincinus)	1
Total:	30
Wild reptile species	Number
Grass snake (Natrix natrix)	3
Smooth snake (Coronella austriaca)	1
Total:	4

In total, 24 of 50 isolates were resistant (48%) to a single or two antimicrobial agents, whereas 10 (20%) of the isolates were multi-resistant, i.e., resistant to three or more antimicrobial classes. Multi-resistant isolates were obtained from grass snakes (Natrix natrix) (n = 3), boa constrictors (Boa constrictor) (n = 2), a Chinese water dragon (Physignathus cocincinus) (n = 1), a California kingsnake (Lampropeltis californiae) (n = 1), a corn snake (Pantherophis guttatus) (n = 1), a milk snake (Lampropeltis triangulum) (n = 1) and a king ratsnake (Elaphe carinata carinata) (n = 1). The phenotypical resistance of the isolates is presented in Figure 1.

Figure 1

Phenotypical antimicrobial resistance (%) patterns of the Salmonella isolates from reptiles (n = 50). Intermediate describes the zone of inhibition in between “susceptible” and “resistant”. The numbers in brackets near the antimicrobial agent represent the antimicrobial concentrations (µg) of the discs.

The data demonstrated that the frequency of the resistance to different antimicrobials was not high; however, the spectrum of resistance was wide, i.e., there was no antimicrobial substance tested that was effective against all Salmonella isolates. The most frequent resistance prevalence of the isolates was against streptomycin (26%; chi-squared test, p < 0.00073), cefoxitin, gentamicin, tetracycline and chloramphenicol (16%; chi-squared test, p < 0.001).

The genes encoding antimicrobial resistance to different antibiotics were as follows: aadA (37.5%) and armA (37.5%) encoding resistance to aminoglycosides, sul2 (50%) encoding resistance to sulphonamides, dfr1 (50%) and dfr7 (16.6%) encoding resistance to trimethoprim and tetA (61.5%) and tetB (53.8%) encoding resistance to tetracyclines. No genes were detected for encoding the resistance to β-lactams, fluoroquinolones, and amphenicols. No integrons associated with horizontal gene transfer were detected. The data of susceptibility profiles as well as the genes encoding resistance are presented in Table 4 and Table 5.

4. Discussion

Salmonella is a gram-negative pathogen that causes various host-specific diseases. It is one of the most widespread agents causing human gastrointestinal infections, as well as infections in pigs, poultry and calves. Although the clinical significance of Salmonella infections in wild and captive reptiles is poorly understood, it is thought that the majority of infections lead to an asymptomatic carrier state and do not result in disease [1]. In this study, all tested reptiles were clinically healthy, therefore our data support this opinion. From the reptiles sampled in this study, Salmonella was found in 61% and 18% of domesticated and wild individuals, respectively, across Lithuania. In other studies, the data were quite similar. For example, in central Europe (Poland, Germany and Austria), the prevalence of Salmonella in domesticated snakes and lizards ranged from 33% to 54.1% [44]. In Norwegian zoos, Salmonella was recovered from 62% of snakes and 67% of lizards [1]. Although there is a lack of data about Salmonella prevalence in wild reptiles, a study performed by Scheelings et al. demonstrated a higher prevalence of this bacterium in reptiles held in captivity (47%) compared to wild reptiles (14%) [2]. Such data are very similar to the data obtained in our study; however, the number of wild animals used in our study was low. More wild animals should be investigated in order to answer whether domesticated animals more often carry Salmonella than wild individuals. The origin of Salmonella in both captive and wild reptiles is also unclear. As some of the wild species, such as Coronella austriaca, dwell far away from the urban areas, it may be assumed that the carriage of Salmonella in reptiles is not necessarily associated with human activity, but this microorganism can be a part of the natural microbiota of reptiles. On the other hand, a higher prevalence of Salmonella in domesticated reptiles rather than in wild individuals, as detected in this study, may be explained by the mixing of different reptile species in a single premise, restricted area, and carriage by humans. Feed intended for reptiles can also be a reason for Salmonella spread because either raw feed (such as live or frozen rodents) or concentrated feed may be contaminated by Salmonella.

In this study, the most frequent carriage of Salmonella was detected in snakes, especially in Lampropeltis californiae, Pantherophis guttatus, Lampropeltis triangulum and Elaphe taeniura friesei and less frequently in lizards. This may be associated with a smaller number of investigated lizards, as in other studies, Salmonella was more frequently isolated from lizards rather than from snakes [1,44]. This may also depend on investigated species of lizards, as different species of lizards both in the wild and in captivity have different feed diets; some lizards eat arthropods and other invertebrates while larger species include small vertebrates in their diet [45]. As rodents are known as reservoirs of different pathogens including Salmonella, this fact of Salmonella epidemiology in reptiles could be considered very important and should be further studied.

The exact serotyping of Salmonella in reptile isolates is not always successful because of a wide variety of serovars and that the most well-known serovars with epidemiological importance for humans and domestic animals are less frequently presented in cold-blooded animals. Different serovars of Salmonella were detected in this study, including Salmonella Florida, Salmonella Sherbrooke, Salmonella Maiduguri, Salmonella Waycross and others, whereas the most widespread serovars in humans and farm animals according to responsible institutions and previous data in Lithuania were Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Choleraesuis, Salmonella Infantis, Salmonella Derby and Salmonella Dublin [46]. Although studies about Salmonella serotypes in reptiles are scarce, some data from other countries exist. For instance, in Norway, 26 different Salmonella serovars in captive reptiles were detected, including those with high zoonotic potential, such as Salmonella Paratyphi B, subsp. arizonae, and those with low or moderate zoonotic potential, such as serovar Salmonella Lome, subsp. salamae, diarizonae and others [1]. In neighbouring Poland, 209 serovars of Salmonella were detected in reptiles, from which the most prevalent were Salmonella Oranienburg, Salmonella Tennessee, Salmonella Agona, Salmonella Fluntern and Salmonella Muenchen [47]. In French Guiana, 14 different Salmonella serovars were detected among wild reptiles. Interestingly, nearly two-thirds of the Salmonella serovars isolated from reptiles were also isolated from patients in this country [48]. The high prevalence of Salmonella in humans and overlapping serotypes was explained by the handling and consumption of reptiles by humans. Such data support the fact that Salmonella, regardless of the serovars, is pathogenic and can easily be transmitted from reptiles to humans.

The data on antimicrobial susceptibility of the isolates revealed a wide spectrum of resistance, as there were no antimicrobials tested that would be effective for all Salmonella isolates. This can be explained by the large diversity of Salmonella among reptiles. In a recent study performed in Poland, Salmonella isolates from reptiles were most frequently resistant to streptomycin [47], which is in accordance with the results obtained in our study. In Taiwan, the most frequent resistances were to streptomycin and tetracycline [8]. In Spain, the most frequent resistances among Salmonella from reptiles were to gentamicin, colistin, and ampicillin [49]. In this study, 20% of all Salmonella isolates were multi-resistant. Such strains usually pose a high risk not only for the treatment of infections but also for the transfer of resistance genes to other microbiota. Horizontal gene transfer is very common among Enterobacteriaceae including Salmonella; however, we did not detect integrons that are associated with horizontal gene transfer. Nevertheless, as Salmonella can be easily transferred to humans or other animals and are pathogenic, multi-resistant strains are of great concern. Different studies demonstrate the unequal frequency of multi-resistant Salmonella isolated from reptiles. For example, in Poland, only single multi-resistant strains were isolated [47], whereas, in Spain, 72% of the isolates were multi-resistant [49]. Such data also prove the large diversity of Salmonella among reptiles. Although we have detected some genes encoding antimicrobial resistance, their variety was not high, especially when compared with isolates from farm animals or humans. Genes encoding resistance to tetracyclines, aminoglycosides, sulphonamides and trimethoprim were detected. Although the same genes were recently detected in Enterobacteriaceae from domestic (unpublished data) and wild animals in Lithuania [50], it is difficult to make any conclusion about their origin in Salmonella isolates from reptiles. Further studies are needed to analyse possible relations of microorganism transfer between reptiles and other hosts.

5. Conclusions

Reptiles are carriers of a wide variety of serovars and multi-resistant strains of Salmonella. Although the prevalence of Salmonella was higher in domesticated reptiles than in wild individuals, further studies are needed to support this theory, as the number of tested wild animals was much lower than in domesticated ones. Reptiles can be a reservoir of Salmonella, therefore hygienic measures should be kept when maintaining and carrying them, as well as when keeping reptiles in close contact with other animals.