Literature DB >> 35739840

Selenium-Enriched Mushroom Powder Enhances Intestinal Health and Growth Performance in the Absence of Zinc Oxide in Post-Weaned Pig Diets.

Eadaoin Conway1, Torres Sweeney2, Alison Dowley1, Stafford Vigors1, Marion Ryan2, Supriya Yadav3, Jude Wilson3, John V O'Doherty1.   

Abstract

This study was conducted to examine the effects of varying selenium (Se) inclusion levels, in the form of Se-enriched mushroom powder (SeMP) and selenite, on post-weaning growth performance (Period 1; day 1-21), intestinal health and antioxidant capacity (Period 2; day 21-39). Weaned pigs were blocked according to live weight, sex and litter of origin and randomly assigned to the following experimental groups: basal (basal + selenite (0.3 ppm Se)); ZnO (basal + ZnO + selenite (0.3 ppm Se)); 0.15 SeMP (basal + SeMP (0.15 ppm Se)); 0.3 SeMP (basal + SeMP (0.3 ppm Se)) and 0.6 SeMP/Sel (basal + SeMP (0.3 ppm Se) + selenite (Sel) (0.3 ppm Se)) with eight replicates/experimental group. After 21 days, the ZnO experimental group was removed from the experiment and the remaining pigs continued on their respective diet until day 39 post-weaning (Period 2). In Period 1, 0.15 SeMP supplementation reduced (p < 0.05) average daily gain (ADG), average daily feed intake (ADFI) and day 21 body weight, and increased (p < 0.05) faecal scores compared to the ZnO group. Supplementation with 0.3 SeMP and 0.6 SeMP/Sel during Period 1 resulted in similar (p > 0.05) ADG, ADFI, gain-to-feed ratio (G:F) and body weight compared to the ZnO group. However, 0.6 SeMP/Sel supplementation increased (p < 0.05) faecal scores compared to the ZnO group. In Period 2, 0.6 SeMP/Sel increased (p < 0.05) ADG, feed efficiency and day 39 body weight compared to the basal group. Supplementation with Se-enriched mushroom powder, at all inclusion levels, increased (p < 0.05) the abundance of Prevotellaceae and Prevotella, decreased (p < 0.05) the abundance of Sporobacter and increased (p < 0.05) the expression of SELENOP in the jejunum compared to the basal group. Lactobacillaceae and Lactobacillus was increased (p < 0.05) in 0.15 SeMP and 0.3 SeMP pigs compared to the basal group. Selenium deposition in muscle and liver tissue increased (p < 0.001) as a function of inclusion level while pigs supplemented with 0.3 ppm organic Se (0.3 SeMP) had an increase (p < 0.05) in total Se in the muscle compared to pigs supplemented with 0.3 ppm inorganic Se (basal). In conclusion, 0.3 SeMP supplementation led to positive effects on faecal scores and had similar pig performance compared to ZnO in Period 1, while the addition of 0.3 ppm selenite to 0.3 SeMP (0.6 SeMP/Sel) in Period 2 led to enhanced pig performance and aspects of gastrointestinal health.

Entities:  

Keywords:  Agaricus bisporus; microbiota; pigs; post-weaning; selenium; zinc oxide; β-glucan

Year:  2022        PMID: 35739840      PMCID: PMC9219493          DOI: 10.3390/ani12121503

Source DB:  PubMed          Journal:  Animals (Basel)        ISSN: 2076-2615            Impact factor:   3.231


1. Introduction

In commercial pig production systems, weaning can negatively impact immunity, gut health, growth and feed efficiency of pigs [1]. Post-weaning intestinal dysfunction is characterised by the upregulation of pro-inflammatory cytokines, atrophy of the small intestinal architecture, the proliferation of pathogenic bacteria [2] and the onset of post-weaning diarrhoea [3]. To help alleviate the challenges associated with weaning, pharmacological levels of zinc oxide (ZnO) have been supplemented to the diets of post-weaned pigs to enhance growth and reduce the proliferation of pathogenic bacteria [4]. However, due to the long-term accumulation of zinc in soils and its association with antimicrobial resistance [5], the EU has begun phasing out the use of pharmacological levels of ZnO, with its complete ban by 2022 (Commission Implementing Decision of 26 June 2017, C(2017) 4, 529 Final). Thus, there is an urgent requirement to develop alternative feed additives to prevent the post-weaning growth check and intestinal dysfunction in the absence of pharmacological levels of ZnO. Selenium (Se) is an essential micronutrient which exerts various functions in enhancing antioxidant capacity, immunity, growth and meat quality in pigs [6]. Selenium is differentiated into either inorganic or organic sources which are commonly added to animal diets for enhancing growth performance and meat quality. However, inorganic selenium supplementation can have some disadvantages, such as toxicity, negative interaction with other minerals and have a low transfer efficiency to animal products [7] whilst organic sources of selenium are more bioavailable as it is readily absorbed in the digestive tract and has a higher threshold for toxicity compared to inorganic sources [8,9,10]. Dietary supplementation of organic Se, such as selenium-enriched yeast, could potentially help minimise post-weaning adversities as it has been shown to enhance antioxidant capacity, enhance immune function and suppress the inflammatory response in weaned pigs (0.25 ppm Se) [11] and also increases the immunoglobulin serum levels in finisher pigs (0.25 ppm Se) [12]. According to the National Research Council, 0.2–0.3 mg/kg (ppm) of added Se should meet the requirement for weaned pigs, with the maximum amount of added Se allowed in swine diets being 0.5 mg/kg of feed [13]. However, the supplementation of 0.7 mg/kg selenomethionine to post-weaned pig diets increased feed efficiency [14], suggesting that, in the absence of in-feed medication and ZnO, a higher Se inclusion level is required to enhance health, growth and antioxidant capacity of pigs. Mushrooms are a rich natural source of bioactive metabolites, such as phenolic compounds and polysaccharides, including β-glucans [15]. Beta-glucans exhibit biological activity, such as anti-inflammatory, antioxidant and immunomodulatory effects [16,17,18]. Beta-glucans present in mushrooms can act as a prebiotic by positively influencing the gut microbiota through increased abundance of Lactobacillus and Bifidobacteria in broiler chickens [19] and turkey poults [20]. When irrigated with inorganic sodium selenite, Agaricus bisporus mushrooms can become rich in organic Se, namely selenocystine [21]. The antioxidant potential of mushrooms, due to their ability to scavenge free radicals [22], along with the antioxidant role of selenium [23,24], may perhaps increase the antioxidant status of the weaned pig, thus enhancing its immunomodulatory status. Therefore, Agaricus bisporus mushrooms offer a unique opportunity to naturally incorporate both β-glucans and organic selenium into the diet of pigs as well as being a natural, sustainable and cost-effective source of selenium. Hence the objective of this study was to determine the optimum Se level, through the use of Se-enriched mushrooms and selenite, in weaned pig diets to enhance intestinal health, performance and antioxidant capacity. It was hypothesised that Se-enriched mushroom powder supplementation to the diet of post-weaned pigs would enhance gastrointestinal health, pig performance and antioxidant capacity, but may be influenced by Se inclusion level and time post-weaning.

2. Materials and Methods

All experimental procedures described in this work were approved under University College Dublin Animal Research Ethics Committee (AREC-20-22-O’Doherty) and conducted in accordance with Irish legislation (SI no. 543/2012) and the EU directive 2010/63/EU for animal experimentation. All efforts were taken to minimise pain and discomfort to the animal while conducting these experiments.

2.1. The Newly Weaned Pig (Period 1; Day 1–21)

2.1.1. Experimental Design and Animal Management

The experiment had a complete randomised block design and consisted of the following five experimental groups: basal (basal + selenite (0.3 ppm Se)); ZnO (basal + selenite (0.3 ppm Se) + ZnO); 0.15 SeMP (basal + SeMP (0.15 ppm Se)); 0.3 SeMP (basal + SeMP (0.3 ppm Se)); 0.6 SeMP/Sel (basal + SeMP (0.3 ppm Se) + selenite (0.3 ppm Se)). The 0.15 SeMP group contained an additional 3.25 g/kg of plain mushroom powder and 3.25 g/kg of Se-enriched mushroom powder to maintain the same level of β-glucans across all mushroom diets. One hundred and twenty pigs (progeny of Meatline boars × (Large White × Landrace sows)) with an average weaning weight of 6.7 kg (SD 0.84 kg) were sourced from a commercial pig farm at weaning (28 days of age) and were penned in groups of three. The pigs were blocked by weaning weight, sex and litter of origin and within each block assigned to one of five dietary groups for the duration of the experiment (eight replicates/experimental group). The ZnO (Cargill, Naas, Ireland) was included at 3100 mg ZnO/kg feed and contained 80% zinc, resulting in an inclusion level of 2500 mg Zn/kg of feed. The mushroom powders were sourced from Monaghan Mushroom (Tyholland, Co., Monaghan, Ireland) and were added at a rate of 6.5 g/kg to achieve a β-glucan content of 650 mg/kg across all mushroom groups (10% β-glucans). The Agaricus bisporus mushrooms were irrigated with sodium selenite as previously described by Maseko, et al. [21] to obtain an organic Se concentration of 45.8 mg/kg of mushroom powder in the form of selenocysteine. The diets were formulated to contain similar levels of net energy (10.6 MJ/kg) and standardised ileal digestible lysine (13.0 g/kg). The levels of amino acids were formulated to meet or exceed the requirements of the NRC (2012). All diets were milled on site and fed in meal form for the duration of the experiment. The ingredient composition and analysis of the diets are shown in Table 1.
Table 1

Ingredient and chemical composition of all diets.

Treatments
Ingredients (g/kg Unless Otherwise Stated)BasalZnO0.15 SeMP0.3 SeMP0.6 SeMP/Sel
Sodium selenite (mg/kg)6.56.5006.5
Mushroom Powder003.2500
Se Mushroom Powder003.256.56.5
Wheat355.4352.1348.9348.9348.9
Full-fat soya bean170170170170170
Soya bean meal105105105105105
Whey powder (90%)5050505050
Zinc oxide03.3000
Soya oil3030303030
Soya concentrate6565656565
Flaked wheat130130130130130
Flaked maize7070707070
Lysine-HCl44444
DI-Methionine22222
L-Threonine1.81.81.81.81.8
Tryptophan0.30.30.30.30.3
Sodium bicarbonate22222
Monocalcium phosphate44444
Vitamins and minerals a2.52.52.52.52.5
Calcium carbonate (limestone)66666
Salt22222
Analysed chemical analysis
DM899.0899.5897.5898.1898.1
NDF99.098.799.599.399.3
GE (MJ/kg)16.916.916.816.916.9
Ash46.246.146.046.246.0
Crude fat79.980.380.180.080.2
β-glucan * (mg/kg)3.04.0649.0652.0655.0
Crude fibre28.028.028.228.328.1
Crude protein208.0208.3208.5208.5208.4
Lysine (%) ¥1.41.41.41.41.4
Methionine (%) ¥0.50.50.50.50.5
Threonine (%) ¥0.90.90.90.90.9
Methionine and cysteine (%) ¥0.80.80.80.80.8
Tryptophan (%) ¥0.30.30.30.30.3
Valine (g/kg) ¥19.019.019.019.019.0
Lactose (g/kg) ¥34.034.034.034.034.0
Selenium (mg/kg)0.280.300.160.310.62

Abbreviations: ZnO, zinc oxide; 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite); DM, dry matter; GE, gross energy; NDF, neutral detergent fibre. *Analysed for β(1-3)-(1-6) β-glucan ¥ Calculated for the tabulated nutritional composition [25]. a Provided (per kg diet): 25 mg Cu; 140 mg Fe; 47 mg Mn; 120 mg Zn; 0.6 mg I; 0.3 mg S; 1.8 mg retinol; 0.025 mg cholecalciferol; 67 mg tocopherol; 4 mg menaquinone; 0.01 mg cyanocobalamin; 2 mg riboflavin; 12 mg nicotinic acid; 10 mg pantothenic acid; 250 mg choline chloride; 2 mg thiamine; and 0.015 mg pyridoxine.

2.1.2. Housing and Animal Management

The pigs were housed in groups of three on fully slatted pens (1.68 × 1.22 m). They were weighed at the beginning of the experiment (d0; day of weaning) and on days 7, 14 and 21. The ambient environmental temperature within the house was thermostatically controlled at 30 °C for the first 7 days and then reduced by 2 °C each week, and the humidity was maintained at 65%. Feed in meal form and water were available ad libitum from four-space feeders and nipple drinkers. Faecal scores were recorded twice daily from individual pens from day 0 until day 21 by the same operator on a scale ranging from 1 to 5. The following scoring system was used: 1 = hard, firm faeces; 2 = slightly soft faeces; 3 = soft, partially formed faeces; 4 = loose, semi-liquid faeces; and 5 = watery, mucous-like faeces.

2.2. Physiological Effects of Selenium-Enriched Mushroom Powder (Period 2; Day 21–39)

Due to common practice of ZnO removal from the diet after the initial post-weaning period, the ZnO experimental group was removed from the experiment on day 21. The remaining pigs continued on their respective diet described in Period 1. Pigs were weighed at the beginning of the experiment (day 21) and at the end of the experiment (day 39). The housing and animal management were as described in Period 1, apart from the ambient environmental temperature, which was maintained at 24 °C for the duration of the experiment and the faecal scores, which were no longer recorded.

2.2.1. Sample Collection

On day 39, eight pigs per experimental group (one pig/pen) received a lethal injection with pentobarbitone sodium (Euthatal Solution, 200 mg/mL; Merial Animal Health, Harlow, UK) at a rate of 0.71 mL/kg body weight to the cranial vena cava to humanely euthanise the animals. Euthanasia was performed by a competent person in a separate room away from sight and sound of the other pigs. The entire gastrointestinal tract was immediately removed. Sections from the duodenum (10 cm from the stomach), the jejunum (60 cm from the stomach) and the ileum (15 cm from the caecum) were excised and fixed in 10% neutral-buffered formalin (Teomics®, Houston, TX, USA). Digesta samples (approximately 10 g) from the caecum were aseptically collected into sterile containers (Sarstedt, Wexford, Ireland) and immediately frozen for subsequent 16 s rRNA sequencing and volatile fatty acid (VFA) analysis. In addition, tissue samples were taken from the duodenum, jejunum and ileum to measure the gene expression of cytokines, digestive enzymes, nutrient transporters, mucins, tight junctions and appetite regulators using qPCR. Tissue sections of 1 cm2 from the duodenum, jejunum and ileum were cut out, emptied by dissecting them along the mesentery and rinsed using sterile phosphate buffer saline (PBS) (Oxoid, Basingstoke, UK). The tissue sections were stripped of the overlying smooth tissue before storage in 5 mL RNAlater® solution (Applied Biosystems, Foster City, CA, USA) overnight at 4 °C. The RNAlater® was removed before storing the samples at −80 °C. Meat (muscle) and liver samples were taken for antioxidant analysis.

2.2.2. Gut Morphological Analysis

Preserved duodenal, jejunal and ileal tissue samples were prepared using standard paraffin-embedding techniques. The samples were sectioned at a thickness of 5 μm and stained with haematoxylin–eosin. Villus height (VH) and crypt depth (CD) were measured in the stained sections (4 × objective) using a light microscope fitted with an image analyser (Image-Pro Plus; Media Cybernetics, Oxford, UK). Measurements of fifteen well-orientated and intact villi and crypts were taken for each segment. The VH was measured from the crypt–villus junction to the tip of the villus, and CD was measured from the crypt–villus junction to the base. Results are expressed as mean VH or CD in μm.

2.2.3. Gene Expression

RNA Extraction and cDNA Synthesis

Total RNA was extracted from duodenal, jejunal, ileal and colonic tissue using TRI Reagent (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. The crude RNA extract was further purified using the GenElute™ Mammalian Total RNA Miniprep kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. A DNase removal step was included using an on-Column DNase 1 Digestion Set (Sigma-Aldrich). The total RNA was quantified using a Nanodrop-ND1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA) and the purity was assessed by determining the ratio of the absorbance at 260 nm and 280 nm. The RNA integrity was assessed using an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies, Santa Clara, CA, USA). All samples had a 260:280 ratio > 2.0 and an RNA integrity number (RIN) > 8.0. The total RNA (2 μg) was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA) and oligo (dT) primers in a final reaction volume of 40 μL, according to the manufacturer’s instructions. The cDNA was then adjusted to a volume of 360 μL with nuclease-free water.

Quantitative PCR

The quantitative PCR (qPCR) reaction mix (20 μL) contained GoTaq qPCR Master Mix (10 μL) (Promega, Madison, WI, USA), forward and reverse primers (1.2 μL) (5 μM), nuclease-free water (3.8 μL) and cDNA (5 μL). All qPCR reactions were performed in duplicate on the 7500 ABI Prism Sequence detection System (Applied Biosystems, Foster City, CA, USA). The cycling conditions included a denaturation step of 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All primers were designed using the Primer Express Software (Applied Biosystems, Foster City, CA, USA) and synthesised by MWG Biotech UK Ltd. (Milton Keynes, UK) and are presented in Table 2. Dissociation curves were generated to confirm the specificity of the resulting PCR products. The qPCR assay efficiencies were established by plotting the threshold cycle (Ct) values derived from 4-fold serial dilutions of cDNA against their arbitrary quantities and only assays exhibiting 90–110% efficiency and single products were used in this study. Normalised relative quantities were obtained using the qbase PLUS software (Biogazelle, Ghent, Belgium) from stable reference genes; ACTB, H3F3A and YWHAZ for the duodenum; H3F3A and YWHAZ for the jejunum; and ACTB and H3F3A for the ileum. These genes were selected as reference genes based on their M value (<1.5) generated by the GeNorm algorithm within GeNorm. The genes analysed in the current study are as follows: SLC15A1 (previously known as PEPT1); FABP2; SLC5A1 (previously known as SGLT1); SLC2A2 (previously known as GLUT2); SLC2A5 (previously known as GLUT5); CCK; PPY; GLP1; NPY; TNF; CXCL8 (previously known as IL8); IL6; IL10; IL17; IFNG; MUC1; MUC2; TLR4; CLDN1; CLDN3; SELENOP; TXNRD1; DI01; ACTB; H3F3A; YWHAZ. The qbase PLUS software uses a generalized model of the delta-delta-Ct approach, thereby supporting the use of gene-specific amplification efficiencies and normalisation with multiple reference genes. All formulas of this model are detailed in Hellemans et al. [26].
Table 2

Panel of porcine oligonucleotide primers used for real-time PCR.

GroupGeneAccession No.Forward Primer (5’-3’)Reverse Primer (5’-3’)Amplicon Length (bp)
Immune response IL6 NM 214399.1F: GACAAAGCCACCACCCCTAAR: CTCGTTCTGTGACTGCAGCTTATC69
CXCL8 NM 213867.1F: TGCACTTACTCTTGCCAGAACTGR: CAAACTGGCTGTTGCCTTCTT82
IL10 NM 214041.1F: GCCTTCGGCCCAGTGAAR: AGAGACCCGGTCAGCAACAA71
IL17 NM 001005729.1F: CCCTGTCACTGCTGCTTCTGR: TCATGATTCCCGCCTTCAC57
INFG NM 213948.1F: TCTAACCTAAGAAAGCGGAAGAGAAR: TTGCAGGCAGGATGACAATTA81
TNF NM 214022.1F: TGGCCCCTTGAGCATCAR: CGGGCTTATCTGAGGTTTGAGA68
TLR4 NM 001293317.1F: TGCATGGAGCTGAATTTCTACAAR: GATAAATCCAGCACCTGCAGTTC140
Tight junctions and Mucins MUC1 XM 001926883.1F: ACACCCATGGGCGCTATGTR: GCCTGCAGAAACCTGCTCAT68
MUC2 AK 231524F: CAACGGCCTCTCCTTCTCTGTR: GCCACACTGGCCCTTTGT70
CLND1 NM 001244539.1 F: CTGGGAGGTGCCCTACTTTGR: TGGATAGGGCCTTGGTGTTG 72
CLND3 NM 001160075.1F: GAGGGCCTGTGGATGAACTGR: GAGTCGTACACTTTGCACTGCAT65
Appetite regulators CCK NM 214237.2F: GGACCCCAGCCACAGAATAAR: GCGCCGGCCAAAATC61
PPY XM 005668763.1F: CTCCTGATTCGGTTTGCAGAAR: GGACAGGAGCAGCAGGAAGA61
GLP1 NM 214237.2F: CAGTGCAGAAATGGCGAGAAR: GGTGGAGCCTCAGTCAGGAA61
NPY NM 001256367.1F: CAGGCAGAGATACGGAAAACGR: TCCGTGCCTCTCTCATCAAG71
Nutrient transporters FABP2 NM 001031780.1F:CAGCCTCGCAGACGGAACTGAAR:GTGTTCTGGGCTGTGCTCCAAGA102
SLC2A2/GLUT2 XM 001097417.1F:CCAGGCCCCATCCCCTGGTTR:GCGGGTCCAGTTGCTGAATGC96
SLC2A5/GLUT5 XM 021095252.1F:CCCAGGAGCCGGTCAAGR:TCAGCGTCGCCAAAGCA60
SLC5A1/SGLT1 NM 001164021F: GGCTGGACGAAGTATGGTGTR: ACAACCACCCAAATCAGAGC153
SLC15A1/PEPT1 NM 214347.1F:GGATAGCCTGTACCCCAAGCTR:CATCCTCCACGTGCTTCTTGA73
Selenium transporters SELENOP NM 001134823.1F:CAGGCCAGCTGATACCTGTGTR:TTAGAATATCCTTCTTTCTCCAGTTTTACTC21
TXNRD1 NM 214154.3F:CACCGTGACGGACTCAAAACTR:GCTTGAGGCTGGTGACTTCAT20
DIO1 NM 001001627.1F:GGCTCTGGGTGCTCTTTCAGR:CAGGAAACAATGTCATGAGCACTT21
Reference genes ACTB AY550069.1F: CAAATGCTTCTAGGCGGACTGTR: TCTCATTTTCTGCGCAAGTT75
H3F3A NM 001014389.2F: CATGGCTCGTACAAAGCAGAR: ACCAGGCCTGTAACGATGAG136
YWHAZ XM 001927228.1F: GGACATCGGATACCCAAGGAR: AAGTTGGAAGGCCGGTTAATTT71

2.2.4. Microbial Analysis

Microbial DNA Extraction

Microbial genomic DNA was extracted from the pigs caecal digesta samples using a QIAamp PowerFecal Pro DNA stool kit (Qiagen, Crawley Down, UK) according to the manufacturer’s instructions. The quantity and quality of DNA were assessed using a Nanodrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA).

Illumina Sequencing

High-throughput sequencing of the V3-V5 hypervariable region of the bacterial 16S rRNA gene was performed on an Illumina MiSeq platform according to their standard protocols (Eurofins, Genomics, Ebersberg, Germany). Briefly, the V3–V5 region was PCR-amplified using universal primers containing adapter overhang nucleotide sequences for forward and reverse index primers. Amplicons were purified using AMPure XP beads (Beckman Coulter, Indianaopolis, IN, USA) and set up for the index PCR with Nextera XT index primers (Illumina, San Diego, CA, USA). The indexed samples were purified using AMPure XP beads, quantified using a fragment analyser (Agilent, Santa Clara, CA, USA), and equal quantities from each sample were pooled. The resulting pooled library was quantified using the Bioanalyzer 7500 DNA kit (Agilent, Santa Clara, CA, USA) and sequenced using the v3 chemistry (2 × 300 bp paired-end reads).

Bioinformatics

The bioinformatic analyses of the resulting sequences were performed by Eurofins Genomics (Eberberg, Germany) using the open source software package (version 1.9.1) Quantitative Insights into Microbial Ecology (Qiime) [27]. All raw reads passing the standard Illumina chastity filter were demultiplexed according to their index sequences (read quality score >30). The primer sequences were clipped from the starts of the raw forward and reverse read. If primer sequences were not perfectly matched, read pairs were removed to retain only high-quality reads. Paired-end reads were then merged if possible, to obtain a single, longer read that covered the full target region using the software FLASH 2.2.00 [28]. Pairs were merged with a minimum overlap size of 10 bp to reduce false-positive merges. The forward read was only retained for the subsequent analysis steps when merging was not possible. Merged reads were quality filtered according to the expected length and known length variations in the V3–V5 region (ca. 445 bp). The ends of retained forward reads were clipped to a total read length of 285 bp to remove low quality bases. Merged and retained reads containing ambiguous bases were discarded. The filter reads (merged and quality clipped retained forward reads) were used for the microbiome profiling. Chimeric reads were identified and removed based on the de-novo algorithm of UCHIME [29], as implemented in the VSEARCH package [30]. The remaining set of high-quality reads was processed using minimum entropy decomposition (MED) to partition reads to operational taxonomic units (OTU) [31,32]. DC-MEGABLAST alignments of cluster representative sequences to the NCBI nucleotide sequence database were performed for taxonomic assignment (from phylum to species) of each OTU. A sequence identity of 70% across at least 80% of the representative sequence was the minimal requirement for considering reference sequences. Abundances of bacterial taxonomic units were normalised using lineage-specific copy numbers of the relevant marker genes to improve estimates [33]. The normalised OTU table combined with the phenotype metadata and phylogenetic tree comprised the data matrix. This matrix was then put into the phyloseq package within R (http://www.r-project.org; version 3.5.0, accessed on 25 March 2022). Differential abundance testing was performed on tables extracted from the phyloseq object at phylum, family and genus levels. The model assessed the effect of ‘group,’ with the individual pig being the experimental unit. Eight pigs per group were used for the statistical analysis of the relative bacterial abundances.

2.2.5. Volatile Fatty Acids Analysis

The VFA concentrations in caecal digesta were determined using gas liquid chromatography (GLC) according to the method described by Clarke, et al. [34]. A 1 g sample of digesta was diluted with distilled water (2.5 × weight of sample) and centrifuged at 1400× g for 10 min using a Sorvall GLC-2B laboratory centrifuge (DuPont, Wilmington, DE, USA). The supernatant (1 mL) and internal standard (1 mL; 0.05% 3-methyl-n-valeric acid in 0.15 M oxalic acid dihydrate) were mixed with 3 mL of distilled water. The mixture was centrifuged at 500× g for 10 min and the supernatant was filtered through 0.45 TFE (polytetrafluoroethylene) syringe filter into a chromatographic sample vial. An injection volume of 1 μL was injected into a Varian 3800 GC (Ottawa, ON, Canada) equipped with an EC™ 1000 Grace column (15 m × 0.53 mm I.D) with 1.20 μm film thickness. The temperature programme set was 75–95 °C increasing by 3 °C/min, and 95–200 °C increasing by 20 °C/min, which was held for 0.50 min. The detector and injector temperature were 280 °C and 240 °C, respectively, while the total analysis time was 12.42 min.

2.2.6. Feed Analysis

The feed samples were milled through a 1 mm screen (Christy and Norris Hammer Mill, Ipswich, UK). The dry matter content of the feed was determined after drying overnight at 104 °C. Ash content was determined after ignition of a weighted sample in a muffle furnace (Nabertherm) at 550 °C for 6 h. The gross energy content was determined using an adiabatic bomb calorimeter (Parr Instruments, St, Moline, IL, USA). The nitrogen content was determined using the LECO FP 528 instrument (Leco Instruments, Stockport, UK Ltd.). The neutral-detergent fibre content was determined according to Van Soest, et al. [35] using the Ankom 220 Fibre Analyser (AnkomTM Technology, New York, NY, USA). The total glucans of the MP were determined using the kit K-YBGL, purchased from Megazyme (Bray, Co Wicklow, Ireland), following the manufacturer’s recommendations, and as previously described [36]. The selenium content was measured by Eurofins Food Testing UK Ltd. (Wolverhampton, United Kingdom) using the selenium in food method. All samples were measured in duplicate.

2.2.7. Antioxidant Activity Analysis

Five grams of muscle/liver sample were homogenised (Stomacher 400 circulator, Steward Ltd., Fareham, UK) with 50 mL phosphate buffer (0.05 M, pH 7) for 3 min. The resulting homogenate was centrifuged at 4600 rpm at 4 °C for 15 min (Rotanta 460 R, Zentrifugen, Hettich, Kirchlengern, Germany) and the supernatant was collected for further analysis. The collected meat supernatant was tested for the determination of total antioxidant status (TAS) by 2,2-diphenyl-1-picrylhydrazyl radical scavenging capacity (DPPH) and ferric reducing antioxidant power (FRAP) assays.

DPPH Free Radical Scavenging Assay

The DPPH radical scavenging assay was carried out by adding 1 mL of DPPH to 1 mL of sample. This was incubated at room temperature for 20 min and then centrifuged at 2500 rpm for 15 min and read on the spectrometer at 515 nm. The amount of scavenging can be quantified by the change in colour from a deep violet to a yellow [37]. where ‘A control’ is the absorbance of the control (DPPH solution without sample) and A sample is the absorbance of the test sample (DPPH solution plus test sample).

FRAP Assay

The FRAP assay was carried out to assess the reducing power of the sample according to the method reported by Benzie and Strain [38], with some modifications by Rajauria, et al. [39]. Trolox (6-hydroxy-2, 5, 7, 8-tetrametmethylchroman-2-carboxyl acid) was used as a standard, and the results were expressed as mg of Trolox equivalents/kg muscle/liver sample. Increased absorbance of the reaction mixture indicated higher reducing power of the supplements in the meat samples.

2.2.8. Total Selenium Analysis

Total selenium content was determined in muscle and liver samples according to the method reported by Bierla, et al. [40]. Briefly, samples were freeze dried (<500 µm) and digested on a hot plate at 65 °C with a mixture of nitric acid and hydrogen peroxide for 6 h. Total selenium was measured using size-exclusion chromatography-inductively couples plasma mass spectroscopy (ICP MS).

2.2.9. Statistical Analysis

All data on growth performance, gastrointestinal morphology, gene expression, antioxidant analysis and VFA were checked for normality using the univariate procedure of Statistical Analysis Software (SAS) 9.4 and transformed, if required. The general linearized model (GLM) procedure within SAS was used to analyze the data on growth performance, gastrointestinal morphology, gene expression (Bonferroni adjusted p < 0.05), antioxidant analysis and VFA concentrations. The model examined the effects of treatment, using weight at weaning as a covariate. Faecal scores were averaged for every three days for the first 21 days and analysed using the PROC MIXED procedure of SAS. The model examined the effect of treatment, time and the associated interaction and using weight at weaning as a covariate The microbiome data were analysed using PROC GLIMMIX. Results are presented using Benjamini–Hochberg (BH) adjusted p-values. The pen was the experimental unit for growth performance and faecal scores, while the individual pig was the experimental unit for gastrointestinal morphology, gene expression, antioxidant analysis, microbiome and VFA data. The results are presented as least-square means with their standard errors. The probability level that denotes significance is p < 0.05.

3. Results

3.1. Period 1 (Day 1–21 Post-Weaning)

Performance and Faecal Scores

The effects of diet on average daily feed intake (ADFI), average daily gain (ADG), gain-to-feed ratio (G:F) and body weight up to day 21 post-weaning (Day 1–21) are presented in Table 3. Pigs supplemented with 0.15 SeMP had reduced (p < 0.05) ADG, ADFI and day 21 body weight compared to pigs supplemented with ZnO. Pigs supplemented with 0.3 SeMP had reduced (p < 0.05) ADFI compared to the basal and ZnO groups while pigs supplemented with 0.6 SeMP/Sel had a reduced (p < 0.05) ADFI compared to the basal group.
Table 3

Effect of dietary treatment on pig growth performance and faecal scores (Period 1; Day 1–21).

Treatments *SEMp-Value
BasalZnO0.15 SeMP0.3 SeMP0.6 SeMP/Sel
ADG (kg)0.27 b0.27 b0.23 a0.26 a,b0.26 a,b0.0130.017
ADFI (kg)0.39 c0.38 b,c0.32 a0.35 a,b0.36 b0.008<0.001
G:F0.650.660.630.690.660.0450.939
Weight (kg)12.6 b12.5 b11.6 a12.2 a,b12.3 a,b0.2660.034
Faecal score $2.57 c2.37 a2.52 b,c2.44 a,b2.61 c0.038<0.001

Abbreviations: ZnO, zinc oxide; 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite); ADG, average daily gain; ADFI, average daily feed intake; G:F, gain-to-feed ratio. a,b,c Mean values within a row with unlike superscript letters were significantly different (p < 0.05). * A total of eight replicates were used per experimental group (replicate = pen, three pigs/pen). $ There was no treatment x time interaction (p > 0.05). (Least-square mean values with their standard errors).

The effects of diet on faecal scores from days 1 to 21 post-weaning are presented in Table 3. Pigs supplemented with ZnO had reduced (p < 0.05) faecal scores compared to 0.15 SeMP, 0.6 SeMP/Sel and basal groups, while pigs supplemented with 0.3 SeMP had reduced (p < 0.05) faecal scores compared to the basal and 0.6 SeMP/Sel groups.

3.2. Period 2 (Day 21–39 Post-Weaning)

3.2.1. Performance

The effects of diet on ADFI, ADG, G:F and body weight from days 21 to 39 are presented in Table 4. Pigs supplemented with 0.6 SeMP/Sel had increased (p < 0.05) ADG compared to all other dietary groups and had increased (p < 0.05) G:F and day 39 body weight compared to the basal group. There was no effect (p > 0.05) of diet on ADFI.
Table 4

Effect of dietary treatment on pig growth performance (Period 2; Day 21–39).

Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
ADG (kg)0.59 a0.62 a0.62 a0.67 b0.0190.025
ADFI (kg)0.900.900.910.930.0230.772
G:F0.67 a0.68 a,b0.68 a,b0.74 b0.0250.049
Weight (kg)22.9 a23.5 a,b23.5 a,b24.3 b0.3420.046

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite); ADG, average daily gain; ADFI, average daily feed intake; G:F, gain-to-feed ratio. a,b Mean values within a row with unlike superscript letters were significantly different (p < 0.05). * A total of eight replicates were used per experimental group (replicate = pen, three pigs/pen). (Least-square mean values with their standard errors).

3.2.2. Small Intestinal Morphology on Day 39

The effects of diet on the small intestinal morphology are presented in Table 5. There was no effect (p > 0.05) of diet on villus height, crypt depth or villus height to crypt depth ratio in the duodenum, jejunum or ileum.
Table 5

Effect of dietary treatment on villus height and crypt depth in the small intestine on day 39 post-weaning.

Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
Duodenum
VH (µm)306.55329.24312.07337.5114.5870.414
CD (µm)136.16133.69140.18126.826.8220.574
VH:CD2.312.532.252.670.1610.250
Jejunum
VH (µm)290.12303.03281.47324.0320.5990.501
CD (µm)138.30146.86137.90132.508.7780.715
VH:CD2.132.072.042.470.1170.056
Ileum
VH (µm)267.90265.69265.27283.6813.6300.744
CD (µm)134.41127.89127.05130.986.1270.827
VH:CD2.032.082.122.170.1120.843

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite); VH, villus height; CD, crypt depth; VH:CD, villus height to crypt depth ratio. * A total of eight replicates were used per experimental group (replicate = pig). (Least-square mean values with their standard errors).

3.2.3. Differential Bacterial Abundance Analysis on Day 39

The effects of diet on bacterial phylum, family and genus in caecal digesta are presented in Table 6a–c, respectively.
Table 6

Effect of dietary treatment on differential relative abundance of bacterial taxa at the (a) phylum level, (b) family level and (c) genus level in pig caecal digesta on day 39 post-weaning.

(a)
Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
Bacteroidetes9.808 a25.447 c18.144 b20.927 a,b1.546<0.001
Actinobacteria0.7240.3191.4310.9660.3230.194
Firmicutes83.19472.09177.63776.4133.1670.116
Proteobacteria1.0520.3811.3420.8000.3310.315
(b)
Treatments * SEM p-Value
Basal 0.15 SeMP 0.3 SeMP 0.6 SeMP/Sel
Prevotellaceae 9.860 a25.904 c18.707 b21.558 a,b1.564<0.001
Clostridiaceae 9.9146.3678.4646.5681.0000.059
Selenomonadaceae 0.1750.4770.4430.3620.2160.752
Oscillospiraceae 0.7960.3240.2690.3070.2260.364
Hungateiclostridiaceae 0.9570.9680.6450.8280.3310.888
Atopobiaceae 0.3170.2360.9640.6100.2530.252
Lactobacillaceae 1.218 a4.270 b3.285 b0.983 a0.5410.001
Ruminococcaceae 43.546 b31.490 a34.813 a41.439 b2.2100.002
Lachnospiraceae 18.87921.84122.90217.2651.6190.080
Eubacteriaceae 2.4892.3801.4173.2660.5530.177
Acidaminococcaceae 0.9480.8090.7760.5810.3160.880
Veillonellaceae 0.5740.7801.0831.5800.3570.263
Erysipelotrichaceae 1.1270.8400.6190.8160.3300.736
Streptococcaceae 1.0170.2881.5351.0100.3390.192
Coriobacteriaceae 0.2690.1110.5600.4130.2010.549
Campylobacteraceae 0.1180.1900.6120.2780.1890.357
Rikenellaceae 0.2600.5200.1610.2580.1940.652
(c)
Treatments * SEM p-Value
Basal 0.15 SeMP 0.3 SeMP 0.6 SeMP/Sel
Blautia 2.2922.4602.3302.1580.5480.986
Prevotella 4.776 a18.365 c13.494 b13.851 b1.263<0.001
Clostridium 9.446 b5.729 a7.852 a,b5.951 a0.9600.037
Dorea 1.3651.2041.8211.6490.4420.766
Prevotellamassilia 3.138 a3.813 a4.054 a6.550 b0.7520.023
Anaerovibrio 0.1240.3470.4470.3650.2010.703
Coprococcus 2.5471.7811.3832.0530.4980.405
Oscillibacter 0.6790.2290.2110.3080.2070.408
Anaerobacterium 0.8180.7950.6110.5840.3010.922
Olsenella 0.3150.2380.9870.6150.2550.234
Lactobacillus 1.235 a4.285 b3.334 b0.990 a0.5440.001
Faecalibacterium 16.095 a14.448 a17.747 a24.937 b1.5380.001
Agathobacter 5.053 a6.407 a,b9.051 b5.988 a0.9240.027
Fournierella 1.2261.4042.1401.4910.4490.496
Anaerobium 0.9530.2460.5660.3300.2490.284
Eubacterium 2.5072.3841.4373.2980.5550.176
Butyrivibrio 0.0970.0260.0140.0950.0810.893
Lachnobacterium 0.4300.7540.4070.3890.2520.735
Phascolarctobacterium 0.9380.6840.7760.5870.3090.872
Dialister 0.3800.5170.6281.2310.2940.250
Butyricicoccus 0.4180.4560.6510.6030.2620.902
Gemmiger 9.2556.6558.2199.1871.0370.301
Megasphaera 0.1930.2710.4730.3510.2030.786
Streptococcus 1.0160.2891.5611.0200.3410.181
Roseburia 2.9644.6604.4002.1640.6720.058
Mediterraneibacter 0.8051.0490.6280.6740.3190.808
Pseudobutyrivibrio 0.2100.4640.5790.3590.2260.690
Sporobacter 9.496 b3.727 a3.872 a2.365 a0.758<0.001
Enorma 0.2700.1120.4270.2030.1750.705
Agathobaculum 0.2040.1630.3570.5660.2000.557
Ruminococcus 5.343 b3.703 a,b2.500 a2.325 a0.6580.013
Oribacterium 0.0450.3450.3610.2490.1730.650
Intestinimonas 0.4010.2770.1390.1250.1690.669
Campylobacter 0.1210.1910.6180.2800.1900.353
Alistipes 0.1630.3800.1660.2590.1760.810
Pseudoflavonifractor 1.3610.5090.1140.4500.2580.055
Kineothrix 1.1241.3180.4100.0470.2740.115

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite). a,b,c Mean values within a row with unlike superscript letters were significantly different (p < 0.05). * A total of eight replicates were used per experimental group (replicate = pig). (Least-square mean values with their standard errors).

At phylum level, the relative abundance of Bacteroidetes was increased (p < 0.05) in 0.15 SeMP, 0.3 SeMP and 0.6 SeMP/Sel groups compared to the basal group, with 0.15 SeMP having the highest abundance. At family level, the relative abundance of Prevotellaceae was increased (p < 0.05) in the 0.15 SeMP, 0.3 SeMP and 0.6 SeMP/Sel groups compared to the basal group, with 0.15 SeMP having the highest abundance. The relative abundance of Lactobacillaceae was increased (p < 0.05), while Ruminococcaceae was decreased (p < 0.05) in the 0.15 SeMP and 0.3 SeMP groups compared to the basal and 0.6 SeMP/Sel groups. At genus level, the relative abundance of Prevotella was increased (p < 0.001) in the 0.15 SeMP, 0.3 SeMP and 0.6 SeMP/Sel groups compared to the basal group with, 0.15 SeMP having the highest abundance. Clostridium was decreased (p < 0.05) in the 0.15 SeMP and 0.6 SeMP/Sel groups compared to the basal group, while Ruminococcus was decreased (p < 0.05) in the 0.3 SeMP and 0.6 SeMP/Sel groups compared to the basal group. Prevotellamassilia and Faecalibacterium were increased (p < 0.05) in 0.6 SeMP/Sel compared to all other dietary groups. Lactobacillus was increased (p < 0.05) in the 0.15 SeMP and 0.3 SeMP groups compared to the 0.6 SeMP/Sel and basal groups. Agathobacter was increased (p < 0.05) in the 0.3 SeMP group compared to the 0.6 SeMP/Sel and basal groups, and Sporobacter was decreased (p < 0.05) in all dietary groups compared to the basal group.

3.2.4. Volatile Fatty Acids on Day 39

The effects of diet on the concentrations of caecal VFAs are presented in Table 7. Surprisingly, there was no effect (p > 0.05) of diet on VFA concentrations.
Table 7

Effect of dietary treatment on total volatile fatty acids (VFA) in caecal digesta on day 39 post-weaning.

Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
VFA (mmol/l digesta)
Total170.64160.76175.87169.5315.1120.912
Acetate126.24109.84123.51122.7012.1200.788
Propionate32.2331.5434.0031.582.4770.880
Butyrate12.7315.5216.0312.111.7320.296
Isobutyrate0.690.430.500.730.1200.260
Isovalerate1.262.060.641.070.4360.165
Valerate1.751.371.191.340.2330.365
Branch3.703.872.333.140.6570.347

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite). * A total of eight replicates were used per experimental group (replicate = pig). (Least-square mean values with their standard errors).

3.2.5. Gene Expression in the Small Intestine on Day 39

The effects of diet on the expression of genes related to appetite regulators, tight junctions, nutrient transporters, selenium transporters, cytokines and mucins in the duodenum, jejunum and ileum are presented in Table 8a, Table 8b and Table 8c, respectively.
Table 8

Effect of dietary treatment on the expression appetite regulators, tight junctions, nutrient transporters, selenium transporters, cytokines and mucins in the (a) duodenum, (b) jejunum and (c) iluem on day 39 post-weaning.

(a)
Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
Appetite regulators
PYY 1.0681.1881.0391.2230.2100.906
GLP1 0.6761.0170.6530.9330.3000.758
NPY 0.8640.9530.9441.4480.1760.096
CCK 1.1281.3071.0491.4060.1960.557
Tight junctions
CLDN1 1.3741.2891.0270.9210.2490.535
CLDN3 0.8131.5961.4951.3350.2680.214
Nutrient transporters
SLC2A2/GLUT2 0.9341.1380.9731.0260.1320.721
SLC2A5/GLUT5 0.9981.1821.3121.2520.2640.859
SLC15A1/PEPT1 0.8221.1911.1860.8880.1430.165
FABP2 0.7841.2801.1960.9770.1400.085
Cytokines
IFNG 0.9301.1321.1260.9630.2100.858
TNF 1.0371.0731.0710.9230.0890.590
TLR4 1.1481.0920.8681.0670.1790.709
IL10 1.0391.2341.0310.6990.2190.380
IL6 1.2471.0200.8800.8320.1540.267
IL17 1.0891.5160.9361.2480.2840.516
CXCL8/IL8 1.2180.9681.1211.1290.1960.842
Mucins
MUC1 1.1041.0631.4621.4210.2920.671
MUC2 1.0221.4881.4001.3210.2880.706
Selenium transporters
SELENOP 1.2181.0890.8720.9590.2190.709
TXNRD1 0.9211.0191.2481.0180.1550.506
DIO1 0.9711.4511.2691.2920.2080.464
(b)
Treatments * SEM p-Value
Basal 0.15 SeMP 0.3 SeMP 0.6 SeMP/Sel
Appetite regulators
PYY 1.0931.3140.7161.1460.2430.359
GLP1 0.9471.1670.8821.1240.1580.519
NPY 0.8360.9880.9151.5470.2550.199
CCK 1.3151.1381.2031.3780.2120.849
Tight junctions
CLDN1 0.8951.1441.2960.9470.2080.510
CLDN3 1.1121.3820.8981.1460.1680.251
Nutrient transporters
SLC2A2/GLUT2 1.1961.1121.0691.2340.1800.909
SLC15A1/PEPT1 1.1311.1891.1251.2260.1660.967
SLC5A1/SGLT1 0.902 a1.329 b0.901 a1.276 b0.1070.037
FABP2 1.2151.2711.1271.2640.1670.920
Cytokines
IFNG 0.777 a1.554 b1.149 a,b1.212 a,b0.1660.027
TNF 0.9871.0881.0340.9490.0900.720
TLR4 0.9871.0481.1621.2310.1650.729
IL10 1.1030.9961.1011.1360.1710.941
IL6 0.8911.0121.1541.0210.2480.908
IL17 0.7221.5310.7851.5750.2750.059
CXCL8/IL8 1.0121.1300.9011.2940.1700.405
Mucins
MUC1 1.2541.5700.5581.0800.3630.232
MUC2 1.3341.1510.6991.2510.2010.138
Selenium transporters
SELENOP 0.664 a1.058 b1.252 a,b1.423 c0.090<0.001
TXNRD1 0.9671.0541.1301.1420.1340.791
DIO1 0.8301.1710.9451.1730.2990.824
(c)
Treatments * SEM p-Value
Basal 0.15 SeMP 0.3 SeMP 0.6 SeMP/Sel
Appetite regulators
PYY 0.9241.2970.8651.4410.2750.382
NPY 0.7981.2691.0541.0920.2420.625
CCK 0.7190.7950.9130.6340.1010.211
Tight junctions
CLDN1 1.2141.3400.8631.0150.2000.307
CLDN3 1.8931.1850.6421.0170.2930.059
Nutrient transporters
SLC2A2/GLUT2 1.7170.8800.9601.0840.2700.227
SLC2A5/GLUT5 1.6310.8660.7821.1190.2460.145
SLC15A1/PEPT1 1.8310.8960.9951.1510.2560.098
SLC5A1/SGLT1 1.5800.9991.1221.4130.2760.456
FABP2 1.5780.9491.1441.5720.3600.500
Cytokines
IFNG 1.0301.0541.0581.0510.1520.999
TNF 0.8821.3021.1580.9720.1580.256
TLR4 1.2991.0551.4581.0820.2880.694
IL10 1.1261.1511.2830.9830.2090.781
IL6 0.7691.2511.3581.1500.1860.208
IL17 0.9971.5800.8101.9530.3390.082
CXCL8/IL8 1.2970.9801.0691.1690.2000.725
Mucins
MUC1 1.852 b0.910 a0.606 a1.541 b0.2630.011
MUC2 1.2131.3780.6681.3600.2320.098
Selenium tranporters
SELENOP 1.1910.9611.1251.3180.2560.781
TXNRD1 1.0281.0730.9021.2040.1430.505
DIO1 0.3511.1500.7930.9570.2050.112

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite); PYY, peptide YY; GLP1, glucagon-like peptide-1; NPY, neuropeptide Y; CCK, cholecystokinin; CLND1, claudin 1; CLDN3, claudin 3; SLC2A2/GLUT2, glucose transporter 2; SLC2A5/GLUT5, glucose transporter 5; SLC15A1/PEPT1, peptide transporter 1; FABP2, fatty acid binding protein 2; IFNG, interferon gamma; TNF, tumor necrosis factor alpha; TLR4, toll-like receptor 4; IL10, interleukin 10; IL6, interleukin 6; IL17, interleukin 17; CXCL8, interleukin 8; MUC1, mucin 1; MUC2, mucin 2; SELENOP, selenoprotein P; TXNRD1, thioredoxin reductase 1; DIO1; deiodinase 1. a,b,c Mean values within a row with unlike superscript letters were significantly different (p < 0.05). * A total of eight replicates were used per experimental group (replicate = pig). (Least-square mean values with their standard errors).

There was no effect (p > 0.05) of diet on gene expression in the duodenum. In the jejunum, SELENOP was upregulated (p < 0.05) in all dietary groups compared to the basal group, with 0.6 SeMP/Sel having the highest abundance. SGLT1 was upregulated (p < 0.05) in the 0.15 SeMP and 0.6 SeMP/Sel groups compared to the 0.3 SeMP and basal groups. IFNG was upregulated (p < 0.05) in the 0.15 SeMP group compared to the basal group. In the ileum, MUC1 was downregulated (p < 0.05) in the 0.15 SeMP and 0.3 SeMP groups compared to the basal and 0.6 SeMP/Sel groups.

3.2.6. Total Antioxidant of Muscle and Liver on Day 39

The effects of diet on total antioxidant in the muscle and liver is presented in Table 9. There was no effect (p > 0.05) of diet on FRAP or DPPH assays in the muscle and liver.
Table 9

Effect of dietary treatment on antioxidant activity, including FRAP and DPPH in the muscle and liver on day 39 post-weaning.

Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
Muscle
FRAP52.3957.5651.6443.945.0680.316
DPPH15.9216.4814.5114.480.8130.221
Liver
FRAP55.1253.4449.3657.4833.6530.467
DPPH15.2413.4314.9714.750.6410.223

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite); FRAP, ferric reducing antioxidant power; DPPH, 2,2-diphenyl-1-picrylhydrazyl. * A total of eight replicates were used per experimental group (replicate = pig). (Least-square mean values with their standard errors).

3.2.7. Total Selenium Content of Muscle and Liver on Day 39

The effects of diet on total selenium content in the muscle and liver is presented in Table 10. In the muscle, total selenium was increased (p < 0.001) in the 0.3 SeMP and 0.6 SeMP/Sel groups compared to the basal and 0.15 SeMP groups, with 0.6 SeMP/Sel having the highest concentration (p < 0.05) compared to all other groups. In the liver, total selenium was increased (p < 0.001) in the basal, 0.3 SeMP and 0.6 SeMP/Sel groups compared to the 0.15 SeMP group, with 0.6 SeMP/Sel having the highest concentration (p < 0.05) compared to all other groups.
Table 10

Effect of dietary treatment on total selenium content in the muscle and liver on day 39 post-weaning.

Treatments *SEMp-Value
Basal0.15 SeMP0.3 SeMP0.6 SeMP/Sel
Muscle (µg/kg)632.78 a616.59 a754.88 b841.92 c25.009<0.001
Liver (µg/kg)1791.69 b1430.26 a1685.18 b2166.21 c70.569<0.001

Abbreviations: 0.15 SeMP, 0.15 ppm Se (selenium-enriched mushrooms); 0.3 SeMP, 0.3 ppm Se (selenium-enriched mushrooms); 0.6 SeMP/Sel, 0.6 ppm Se (0.3 ppm selenium-enriched mushrooms + 0.3 ppm selenite) a,b,c Mean values within a row with unlike superscript letters were significantly different (p < 0.05). * A total of eight replicates were used per experimental group (replicate = pig). (Least-square mean values with their standard errors).

4. Discussion

It was hypothesised that Se-enriched mushroom powder supplementation to the diet of post-weaned pigs would enhance gastrointestinal health, pig performance and antioxidant capacity, but may be influenced by Se inclusion level and time post-weaning. In Period 1, dietary supplementation with 0.15 SeMP reduced ADG, ADFI and day 21 body weight and increased faecal scores compared to ZnO supplementation. Supplementation with 0.3 SeMP during Period 1 resulted in positive effects on faecal scores and similar pig performance compared to ZnO supplementation, while also leading to the increased abundance of Prevotella and Lactobacillus, decreased abundance of Sporobacter and increased expression of SELENOP at the end of Period 2. Dietary supplementation with 0.6 SeMP/Sel during Period 2 led to increased ADG, G:F and day 39 body weight, while also increasing the abundance of Prevotella and Faecalbacterium, decreasing the abundance of Sporobacter and increasing the expression of SELENOP. Faecal scoring has been considered as an indicator of gut health [41]. According to the scoring system used in the current study, faecal scores between 3 and 5 are representative of diarrhoea, and all groups in this study had faecal scores between 2 and 3, indicating that pigs were not under major immunological or microbiological stress. These healthy scores are likely due to the good hygiene and husbandry practices observed in research facilities [42,43]. However, it is worth noting that pigs supplemented with 0.3 SeMP had similar faecal scores and performance results compared to pigs supplemented with ZnO, perhaps suggesting that 0.3 ppm Se supplementation is the desired inclusion level of organic Se for the immediate post-weaned period. Interestingly, the Se inclusion level of 0.6 ppm (0.6 SeMP/Sel) resulted in increased faecal scores compared to 0.3 SeMP and ZnO groups during the first 21 days post-weaning. However, the faecal scores were still within the normal healthy range (<3). During days 21 to 39, pigs supplemented with 0.6 SeMP/Sel had increased daily gain, gain-to-feed ratio and day 39 body weight. Similarly, Cao, Guo, Zhang, Dong and Gong [14] concluded that dietary supplementation with 0.7 ppm selenomethionine for 42 days post-weaning increased feed efficiency in post-weaned pigs, perhaps suggesting that a higher Se inclusion in the diet of pigs, after the initial post-weaning period, has the potential to enhance pig growth performance. Maximising feed intake during the post-weaning period is critical, as low feed intake in newly weaned pigs negatively affects nutrient uptake and utilisation, leading to undesired physiological, morphological and microbial changes in the gastrointestinal tract (GIT) [3]. In Period 1, Se-enriched mushroom powder supplementation, at all inclusion levels, reduced feed intake compared to basal fed pigs. While the aim of the study was not to explore the mechanism behind the reduced feed intake, it may be due to the mushroom powder having a satiety effect and/or reduced palatability. Food components present in mushroom powder, such as the non-digestible polysaccharide chitin, may increase the satiety effect, leading to a reduction in feed intake. Chitin supplementation, through its deacetylated form, reduces feed intake in both mice [44] and pigs [45,46]. Mushrooms contain a spectrum of anti-nutritional compounds, such as tannins, alkaloids, saponins and phytases [47], which, due to their astringent taste, may negatively affect their palatability, resulting in a reduced feed intake [48]. Nevertheless, while 0.3 SeMP and 0.6 SeMP/Sel reduced feed intake compared to the basal diet during Period 1, there was no adverse effects on average daily gain or feed efficiency. Dietary intervention with natural bioactives can positively influence the microbial composition of the large intestine of pigs, leading to enhanced animal health and performance and inhibiting pathogenic colonisation. Dietary supplementation with Se-enriched mushroom powder, at all inclusion levels, increased the relative abundance of the family Prevotellaceae and genus Prevotella. Research has shown Prevotella to be associated with fibre intake and the degradation of carbohydrates [49], with a higher abundance of Prevotella being associated with improved weight gain and feed efficiency and decreased incidence of diarrhoea [50,51,52]. These findings suggest that Prevotella promotes pig growth performance and health and that the high β-glucan content (650 mg/kg) present in the mushroom-based diets led to the increased abundance. Within the phylum Firmicutes, Se-enriched mushroom powder supplementation decreased the abundance of Sporobacter, while pigs supplemented with 0.15 SeMP and 0.3 SeMP had a greater abundance of the family Lactobacillaceae and genus Lactobacillus. Recent research has suggested that Sporobacter may have a detrimental impact on pig gut health [53], thus a lesser abundance is optimal for enhanced pig health. Lactobacillus species can enhance GIT health through the competitive exclusion of pathogens, antioxidant activities and aiding in immune system regulation [54,55]. We suspect the increase in Lactobacillaceae and Lactobacillus is due to the presence of organic Se (selenocystine) in the mushroom powder, as a negative effect was associated with the addition of selenite in both the 0.6 SeMP/Sel and basal groups (both groups containing 0.3 ppm selenite). Dietary supplementation with 0.6 SeMP/Sel increased the relative abundance of Faecalibacterium, which has been associated with increased intestinal health in weaned pigs [56], while Faecalibacterium prausnitzii is considered a promising probiotic in human medicine due to its use in treating inflammatory-related diseases [57]. These results indicate that Se-enriched mushroom powder supplementation positively influenced the microbial composition of post-weaned pigs. The exact mode of action of Se-enriched mushroom powder on the caecal microbiome was beyond the scope of this study, but it warrants further exploration. Despite selenium-enriched mushroom powder supplementation increasing the abundance of Prevotella, Lactobacillus and Faecalbacterium, there were no effects on VFA production or proportions. Gastrointestinal homeostasis is critical to the health of weaned pigs and the disruption to this gives rise to intestinal inflammation. There was minimal change in the expression of cytokines between groups in this experiment and as a result, there were no effects on the epithelial barrier function or intestinal architecture. The current results show that the highest Se deposition in both the muscle and liver was found in pigs fed 0.6 ppm Se, indicating that Se was increased as a function of inclusion level. Interestingly, pigs supplemented with 0.3 ppm organic Se (0.3 SeMP) had an increase in total Se in the muscle compared to pigs supplemented with 0.3 ppm inorganic Se (basal). Although there are several selenoproteins in vertebrae, the selenoproteins measured in this study are the best known [58]. The expression of SELENOP, a selenium transporter, was upregulated in the jejunum of pigs supplemented with Se-enriched mushroom powder, irrespective of Se inclusion level, suggesting that the bioavailability, absorption and utilisation of organic Se is higher compared to inorganic Se sources. In the muscle, there was no difference in Se deposition between pigs supplemented with 0.3 ppm inorganic Se (basal) and pigs supplemented with 0.15 organic Se (0.15 SeMP), suggesting that organic Se has a greater ability to deposit in muscle compared to inorganic Se. The differences in total Se deposition between the muscle and liver may perhaps be due to the different roles they play in Se metabolism. The liver is a main organ for selenoprotein synthesis, Se metabolism and Se transport to other tissues, while the muscle is a major organ for Se storage [59,60]. Selenium plays an important role in antioxidant activity, as it can prevent peroxidation and protect the immune cells and tissues from damage caused by the free radicals [23,24]. It was anticipated that antioxidant activity would increase as a function of Se inclusion level. However, there was no effect on FRAP or DPPH assays in both the muscle and liver at all Se inclusion levels.

5. Conclusions

Selenium-enriched mushroom powder supplementation at Se inclusion level of 0.3 ppm led to positive effects on faecal scores and similar post-weaning pig performance compared to ZnO supplementation during the first 21 days post-weaning. Selenium-enriched mushroom powder supplementation in combination with selenite, at a Se inclusion of 0.6 ppm, increased ADG and feed efficiency during days 21 to 39 and increased day 39 body weight. Selenium-enriched mushroom powder supplementation increased the abundance of Prevotella, Lactobacillus and Faecalbacterium, decreased the abundance of Sporobacter and increased the expression of SELENOP, while Se deposition in muscle and liver tissue increased as a function of inclusion level. These results suggest that 0.3 ppm organic Se supplementation is satisfactory for the immediate post-weaning period in terms of maintaining performance and enhancing faecal scores. However, a higher level of Se (0.6 ppm), led to enhanced pig performance while positively modulating intestinal microbiota after the initial post-weaning period. Selenium-enriched mushroom powder supplementation to pigs is therefore a novel and sustainable way to incorporate selenium and β-glucans into the diet of weaned pigs.
  42 in total

1.  Early-life establishment of the swine gut microbiome and impact on host phenotypes.

Authors:  Núria Mach; Mustapha Berri; Jordi Estellé; Florence Levenez; Gaëtan Lemonnier; Catherine Denis; Jean-Jacques Leplat; Claire Chevaleyre; Yvon Billon; Joël Doré; Claire Rogel-Gaillard; Patricia Lepage
Journal:  Environ Microbiol Rep       Date:  2015-05-06       Impact factor: 3.541

2.  Speciation of selenium dietary supplements; formation of S-(methylseleno)cysteine and other selenium compounds.

Authors:  Prince O Amoako; Peter C Uden; Julian F Tyson
Journal:  Anal Chim Acta       Date:  2009-08-19       Impact factor: 6.558

3.  Antioxidant properties and phenolic profile of the most widely appreciated cultivated mushrooms: a comparative study between in vivo and in vitro samples.

Authors:  Filipa S Reis; Anabela Martins; Lillian Barros; Isabel C F R Ferreira
Journal:  Food Chem Toxicol       Date:  2012-02-18       Impact factor: 6.023

4.  Plasma proteome analysis for anti-obesity and anti-diabetic potentials of chitosan oligosaccharides in ob/ob mice.

Authors:  Suresh G Kumar; Md Atiar Rahman; Sung Hak Lee; Hee Sun Hwang; Hyun Ah Kim; Jong Won Yun
Journal:  Proteomics       Date:  2009-04       Impact factor: 3.984

5.  VSEARCH: a versatile open source tool for metagenomics.

Authors:  Torbjørn Rognes; Tomáš Flouri; Ben Nichols; Christopher Quince; Frédéric Mahé
Journal:  PeerJ       Date:  2016-10-18       Impact factor: 2.984

6.  The pharmacological potential of mushrooms.

Authors:  Ulrike Lindequist; Timo H J Niedermeyer; Wolf-Dieter Jülich
Journal:  Evid Based Complement Alternat Med       Date:  2005-09       Impact factor: 2.629

7.  Characterisation of Early-Life Fecal Microbiota in Susceptible and Healthy Pigs to Post-Weaning Diarrhoea.

Authors:  Samir Dou; Pascale Gadonna-Widehem; Véronique Rome; Dounia Hamoudi; Larbi Rhazi; Lyes Lakhal; Thibaut Larcher; Narges Bahi-Jaber; Arturo Pinon-Quintana; Alain Guyonvarch; Isabelle L E Huërou-Luron; Latifa Abdennebi-Najar
Journal:  PLoS One       Date:  2017-01-10       Impact factor: 3.240

8.  The biological stress of early weaned piglets.

Authors:  Joy M Campbell; Joe D Crenshaw; Javier Polo
Journal:  J Anim Sci Biotechnol       Date:  2013-04-30

9.  CopyRighter: a rapid tool for improving the accuracy of microbial community profiles through lineage-specific gene copy number correction.

Authors:  Florent E Angly; Paul G Dennis; Adam Skarshewski; Inka Vanwonterghem; Philip Hugenholtz; Gene W Tyson
Journal:  Microbiome       Date:  2014-04-07       Impact factor: 14.650

Review 10.  Selenium-Related Transcriptional Regulation of Gene Expression.

Authors:  Mikko J Lammi; Chengjuan Qu
Journal:  Int J Mol Sci       Date:  2018-09-08       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.