Xinyang Fan1, Yongyun Zhang1,2, Lihua Qiu1, Wei Zhu1,3, Xingtiao Tu1, Yongwang Miao4. 1. Faculty of Animal Science and Technology, Yunnan Agricultural University, Kunming, 650201, Yunnan, China. 2. Teaching Demonstration Center of the Basic Experiments of Agricultural Majors, Yunnan Agricultural University, Kunming, 650201, Yunnan, China. 3. College of Veterinary Medicine, Yunnan Agricultural University, Kunming, 650201, Yunnan, China. 4. Faculty of Animal Science and Technology, Yunnan Agricultural University, Kunming, 650201, Yunnan, China. yongwangmiao1@126.com.
Abstract
Liver X receptor α (LXRα) is a ligand-dependent transcription factor and plays an important role in the regulation of cholesterol homeostasis, fatty acid biosynthesis and glucose metabolism. In this study, transcripts of LXRα gene were cloned and characterized from buffalo mammary gland, and three alternative splicing transcripts of buffalo LXRα gene were identified, named LXRα1, LXRα2 and LXRα3. The structure of the LXRα transcripts of buffalo and cattle was highly similar. Bioinformatics analysis showed that LXRα1 contains two complete functional domains of LXRα, one is the DNA-binding domain (NR_DBD_LXR) and the other is the ligand-binding domain (NR_LBD_LXR). The reading frame of LXRα2 is altered due to the skipping of exon 9, which truncates its encoding protein prematurely at the 400th amino acid residue, making it contain a complete DNA-binding domain and part of a ligand-binding domain. Due to the deletion of exon 4, the protein encoded by LXRα3 lacks 89 amino acid residues and contains only a complete ligand-binding domain, which makes it lose its transcriptional regulation function. In addition, motifs and conserved domains of three LXRα variants of buffalo were highly consistent with those of corresponding transcripts from other mammal species. Subcellular localization analysis showed that LXRα1 plays a functional role in the nucleus of buffalo mammary epithelial cells, while LXRα2 and LXRα3 are distributed in the nucleus and cytoplasm. Compared with non-lactating period, the mRNA abundance of the three LXRα transcripts in the mammary gland tissue of buffalo increased during lactating period, revealing that they play a key role in the synthesis of buffalo milk fat. Among the three LXRα transcripts, LXRα1 has the highest expression in the mammary gland, indicating that it is the major transcript in the mammary gland and has important regulatory functions, while LXRα2 and LXRα3 may have regulatory effects on the function of LXRα1. This study highlights the key role of LXRα alternative splicing in the post-transcriptional regulation of buffalo lactation.
Liver X receptor α (LXRα) is a ligand-dependent transcription factor and plays an important role in the regulation of cholesterol homeostasis, fatty acid biosynthesis and glucose metabolism. In this study, transcripts of LXRα gene were cloned and characterized from buffalo mammary gland, and three alternative splicing transcripts of buffalo LXRα gene were identified, named LXRα1, LXRα2 and LXRα3. The structure of the LXRα transcripts of buffalo and cattle was highly similar. Bioinformatics analysis showed that LXRα1 contains two complete functional domains of LXRα, one is the DNA-binding domain (NR_DBD_LXR) and the other is the ligand-binding domain (NR_LBD_LXR). The reading frame of LXRα2 is altered due to the skipping of exon 9, which truncates its encoding protein prematurely at the 400th amino acid residue, making it contain a complete DNA-binding domain and part of a ligand-binding domain. Due to the deletion of exon 4, the protein encoded by LXRα3 lacks 89 amino acid residues and contains only a complete ligand-binding domain, which makes it lose its transcriptional regulation function. In addition, motifs and conserved domains of three LXRα variants of buffalo were highly consistent with those of corresponding transcripts from other mammal species. Subcellular localization analysis showed that LXRα1 plays a functional role in the nucleus of buffalo mammary epithelial cells, while LXRα2 and LXRα3 are distributed in the nucleus and cytoplasm. Compared with non-lactating period, the mRNA abundance of the three LXRα transcripts in the mammary gland tissue of buffalo increased during lactating period, revealing that they play a key role in the synthesis of buffalo milk fat. Among the three LXRα transcripts, LXRα1 has the highest expression in the mammary gland, indicating that it is the major transcript in the mammary gland and has important regulatory functions, while LXRα2 and LXRα3 may have regulatory effects on the function of LXRα1. This study highlights the key role of LXRα alternative splicing in the post-transcriptional regulation of buffalo lactation.
Nuclear receptors are composed of ligand-activated transcription factor superfamily, which can convert hormone signals into transcriptional responses[1]. The liver X receptor α (LXRα), as one of the main member of this superfamily, is an oxysterol-inducible transcription factor which can regulate the expression of genes involved in cholesterol and fatty acid metabolism, cellular proliferation and apoptosis, and immunity[2,3]. LXRα and retinoid X receptor (RXR) preferentially bind to LXR response elements (LXREs) of target genes in the form of obligate heterodimers[4]. Structurally, LXRα consists of an N-terminal ligand-independent activation function domain (AF-1), a DNA-binding domain (DBD) containing two zinc finger regions encoded by a single exon 4, a hinge domain and a ligand-binding domain (LBD) encoded by exons 6–10[1,5]. LBD is in charge of ligand binding, receptor dimerization, nuclear localization, and binding to co-activators or co-repressors and trans-activation[4,5]. Due to the absence of H2 and the contiguity of helices 10 and 11, LBD consists of 10 α-helices, of which the C-terminal helix 12 is also called AF-2[6]. Alternative splicing of biological genes is an important mechanism for regulating gene expression and generating protein diversity. So far, a total of five LXRα transcripts (α1, α2, α3, α4 and α5) have been identified in human, which are generated by alternative promoter usage and alternative splicing of pre-mRNA[3,7]. The expression levels of LXRα2, LXRα3, LXRα4 and LXRα5 are lower in many human tissues than that of LXRα1[3,7]. Two LXRα transcripts LXRα1 and LXRα2 have been identified in swine, and they differ only in the 5′ untranslated region (UTR)[8]. Among them, LXRα1 was expressed in various porcine tissues, while LXRα2 was mainly expressed in thymus and spleen. However, as far as we know, there is no report on the alternative splicing of LXRα gene in ruminants.Like other nuclear receptors, transcripts of LXRα have different expression patterns and altered transcriptional activities, and the expression of these transcripts can regulate LXR signaling[3]. In recent years, LXRα has been demonstrated to play a crucial role in milk fat synthesis in buffalo and cattle[9,10]. Elucidating the transcriptional and post-transcriptional regulation of buffalo LXRα gene in mammary gland is of great significance for understanding the mechanism of buffalo milk fat synthesis. The aim of this study was to identify potential alternative splicing variants of LXRα in buffalo mammary gland and investigate the molecular characteristics, expression patterns, and functional roles of different variants. This study will generate fundamental information for exploring the function and regulation of LXRα gene in buffalo milk fat synthesis.
Results
Identification of alternative splicing transcripts of buffalo LXRα
Through 5′ RACE-PCR, only one type of 5′ UTR sequence of LXRα gene was obtained, and further BLAST analysis showed that it was completely consistent with the published 5′ UTR sequence of buffalo LXRα with accession number XM_025266088. Further, thirty clones with recombinant LXRα-CDS-pMD18-T vectors were randomly selected for sequencing. Three alternative splicing transcripts of buffalo LXRα were obtained which were identical to the predicted transcripts reported in NCBI database. The CDS identical to XM_025266088 (1344 bp; predicted transcript variant X1) was referred as buffalo transcript LXRα1, identical to XM_025266090 (1203 bp; predicted transcript variant X2) as buffalo transcript LXRα2, and identical to XM_025266091 (1077 bp; predicted transcript variant X3) as buffalo transcript LXRα3. The CDS sequence consistency of the same type of LXRα transcripts between buffalo and cattle was higher than 98.51%. The CDSs of all three LXRα transcripts were submitted to GenBank with the accession numbers MZ927742, MZ927743 and MZ927744. The LXRα2 is generated by the deletion of exon 9, whereas LXRα3 is by absence of exon 4 (Figs. 1 and 2).
Figure 1
Schematic diagram of three splicing modes and translation termination sites of buffalo LXRα transcription products. The left panel depicts the exon/intron organization and structure of the three buffalo LXRα transcripts. The right panel displays the structural domains of the LXRα variants. Alternative splicing involving skipping of exon 9 or exon 4 generates the transcripts LXRα2 and LXRα3, respectively.
Figure 2
Alignment and structural characteristics of buffalo LXRα variants. The green and red shades denote the DNA-binding domain (NR_DBD_LXR) and ligand-binding domain (NR_LBD_LXR), respectively. The yellow shades represent the mismatched amino acids. Boxes indicate helices (H) in the ligand-binding domain (LBD). The region between the arrows represents the AF-2 region. LXRα2 is produced by the splicing removal of exon 9 resulting in a truncation of 47 amino acid residues at the C-terminus. LXRα3 is generated by the skipping of exon 4, leading to an in-frame deletion of 89 amino acid residues in the DNA-binding domain (DBD).
Schematic diagram of three splicing modes and translation termination sites of buffalo LXRα transcription products. The left panel depicts the exon/intron organization and structure of the three buffalo LXRα transcripts. The right panel displays the structural domains of the LXRα variants. Alternative splicing involving skipping of exon 9 or exon 4 generates the transcripts LXRα2 and LXRα3, respectively.Alignment and structural characteristics of buffalo LXRα variants. The green and red shades denote the DNA-binding domain (NR_DBD_LXR) and ligand-binding domain (NR_LBD_LXR), respectively. The yellow shades represent the mismatched amino acids. Boxes indicate helices (H) in the ligand-binding domain (LBD). The region between the arrows represents the AF-2 region. LXRα2 is produced by the splicing removal of exon 9 resulting in a truncation of 47 amino acid residues at the C-terminus. LXRα3 is generated by the skipping of exon 4, leading to an in-frame deletion of 89 amino acid residues in the DNA-binding domain (DBD).In order to have a deeper understanding of the structure of the transcriptional region of LXRα gene in buffalo and the alternative splicing mode of the transcript, the structure of the transcriptional region of the transcript obtained in this study was compared with that of all the transcripts of LXRα gene of other Bovidae species. Buffalo and other Bovidae species have similar alternative splicing transcripts of LXRα. There are three main types of transcripts of this gene in Bovidae species, that is, in addition to the type containing all 10 exons, there are also deleted types of exon 4 or exon 9 (Fig. 3). In addition, there is a transcript in which exons 8 and 9 are removed together in sheep (XM_027979717.1). It is worth noting that the transcripts with the same splicing pattern in Bovidae species have essentially the same CDS length, but their UTR and intron lengths are inconsistent.
Figure 3
Transcriptional region structure of LXRα in some Bovidae species.
Transcriptional region structure of LXRα in some Bovidae species.
Characteristics, structures and functions of buffalo LXRα variants
The molecular characteristics and functions of LXRα variants encoded by the alternative splicing transcripts of buffalo LXRα were predicted using bioinformatics methods and shown in Table 1. All the variants of buffalo LXRα are hydrophilic proteins, distributed in the nucleus with high scores. The molecular functions and biological processes of the LXRα1 and LXRα2 are the same. Both of them are involved in lipid metabolism and transcriptional regulation. However, compared with the LXRα1 and LXRα2, the LXRα3 loses its DNA-binding activity as a transcription factor and could not participate in transcriptional regulation.
Table 1
Characteristics and functions of three variants of buffalo LXRα.
LXRα1
LXRα2
LXRα3
Amino acids
447
400
358
Isoelectric point (pI)
6.62
5.69
5.13
Grand average of hydropathicity
− 0.413
− 0.475
− 0.321
Subcellular localization
Nuclear (10.0)
Nuclear (9.9)
Nuclear (9.8)
Biological process
Lipid metabolic process and regulation of transcription
Lipid metabolic process and regulation of transcription
Lipid metabolic process
Molecular function
Nuclear receptor activity, DNA binding, zinc ion binding, sequence-specific DNA binding and DNA-binding transcription factor activity
Nuclear receptor activity, DNA binding, zinc ion binding, sequence-specific DNA binding and DNA-binding transcription factor activity
Nuclear receptor activity and DNA binding
Characteristics and functions of three variants of buffalo LXRα.The completed LXRα (LXRα1) contains a DNA-binding domain (NR_DBD_LXR) and a ligand-binding domain (NR_LBD_LXR). The NR_LBD_LXR domain is composed of 10 helices and the last helix is the AF-2 (Fig. 2). Because the length of exon 9 is 95 bp, its deletion leads to a change in the reading frame of LXRα2 and a mismatch of 30 amino acid residues at the C-terminus. The introduction of the stop codon (TAA) leads to the truncation of 47 amino acids at the C terminus of LXRα2, resulting in the deletion of helix 9 to helix 12 in its LBD, which contains AF-2. The skipping of exon 4 in this gene leads to the loss of DBD composed of 89 amino acids, which leads to the transcript LXRα3, but this does not change the reading frame (Fig. 2).
Phylogenetic and sequence identities analysis
The phylogenetic relationship and comparison of motifs and conserved domains between buffalo and 13 representative mammalian LXRα variants are illustrated in Fig. 4. In the phylogenetic tree, the variants with the same splicing pattern were clustered into one branch, and the buffalo showed a closer genetic relationship with other species of Bovidae (Fig. 4A). A total of 10 conserved motifs were found in LXRα variants across 14 representative mammals (Fig. 4B). Among them, motifs 3 and 10 are found in variants of all species. The protein encoded by the buffalo transcript with accession number MZ927743 lacks motifs 2 and 6 (skipping of exon 9), while the protein encoded by the buffalo transcript with accession number MZ927744 lacks motifs 1 and 7 (skipping of exon 4). In other species, variants with the same splicing pattern as buffalo contain the same motif pattern. In contrast, the motif pattern of LXRα variants in human is more complicated. As far as conserved domains are concerned, mammalian LXRα variants contain either two complete domains of DBD and LBD, one complete domain of DBD and part of LBD, or only one LBD domain or part of LBD (Fig. 4C). In all mammals, the LBD domain is incomplete due to exon 9 skipping, but it still belongs to the NR_LBD superfamily domain, while the variant with exon 4 skipping contains only LBD domain. The results here indicate that the motifs and conserved domains of mammalian LXRα variants are highly consistent.
Figure 4
Phylogenetic relationships, motifs and conserved domains of LXRα in 14 mammalian species. (A) phylogenetic tree; (B) motif pattern; (C) conserved domain. The conserved motifs and domains in LXRα were marked with different color boxes.
Phylogenetic relationships, motifs and conserved domains of LXRα in 14 mammalian species. (A) phylogenetic tree; (B) motif pattern; (C) conserved domain. The conserved motifs and domains in LXRα were marked with different color boxes.
Subcellular localization of buffalo LXRα variants
Subcellular localization experiments were carried out to determine the distribution of the three LXRα variants in BuMECs. The recombinant vectors of pEGFP-LXRα encoding the three LXRα variants of buffalo were constructed and transfected into BuMECs respectively. The results of transfection with pEGFP-LXRα1 revealed that all the green fluorescent protein (GFP) overlapped with the blue fluorescence of the nucleus, but did not coincide with the red fluorescence of mitochondria (Fig. 5). Although most of the GFP of pEGFP-LXRα2 and pEGFP-LXRα3 coincided with the blue fluorescence of the nucleus, some of the GFP overlapped with the red fluorescence of the mitochondria. More results of positive cells are shown in Supplementary Fig. S1. The above results indicate that buffalo LXRα1 protein functions in the nucleus, while the LXRα2 and LXRα3 proteins are mainly distributed in the nucleus of BuMECs, but some are also distributed in the cytoplasm.
Figure 5
Subcellular localization of three variants of buffalo LXRα in BuMECs. (A) Mitochondria stained by Mito Tracker; (B) nucleus stained by Hoechst 33342; (C) green fluorescent protein (GFP); (D) merged overlaid GFP and mitochondria; (E) merged overlaid with GFP and nucleus; (F) merged overlaid GFP, mitochondria and nucleus.
Subcellular localization of three variants of buffalo LXRα in BuMECs. (A) Mitochondria stained by Mito Tracker; (B) nucleus stained by Hoechst 33342; (C) green fluorescent protein (GFP); (D) merged overlaid GFP and mitochondria; (E) merged overlaid with GFP and nucleus; (F) merged overlaid GFP, mitochondria and nucleus.
Expression of buffalo LXRα in mammary tissue
To investigate the role of LXRα in lactation, the mRNA expression differences of the three splicing transcripts of buffalo LXRα in the mammary glands between lactation and non-lactation were analyzed (Fig. 6). Although the expression of LXRα1 alone could not be detected in this study, the expression of LXRα1 and LXRα2 together, and the expression of LXRα2 alone could be detected. Therefore, the expression level of LXRα1 in mammary gland can be inferred. Compared with non-lactating stage, the mRNA abundance of the three splicing transcripts was significantly increased in lactating stage (P < 0.05) (Fig. 6). Furthermore, the relative mRNA abundance of LXRα2 was the lowest in the mammary gland of the two stages, while the expression of LXRα1 in the two stages was the highest. The transcript with the highest expression of the same gene is the major transcript[11]. Therefore, LXRα1 is identified as the major transcript expressed in buffalo mammary gland.
Figure 6
Expression of buffalo LXRα transcripts in mammary gland tissue. Data are presented as means ± SEM; *P < 0.05, **P < 0.01.
Expression of buffalo LXRα transcripts in mammary gland tissue. Data are presented as means ± SEM; *P < 0.05, **P < 0.01.
Discussion
Pre-messenger RNA splicing is an essential process required for the expression of most genes in eukaryotic cells, which provides an important way to regulate gene expression[12,13]. Alternative splicing is the process of producing different mRNA splicing isoforms through different splicing methods in a mRNA precursor, which can cause the final protein product to exhibit different or mutually antagonistic structural and functional properties[14,15]. It can increase the diversity of mRNAs expressed from the genome and is a source of increase in genomic expression and organism complexity[16,17]. As a core element of gene regulation, it is involved in almost all biological processes, such as cell proliferation, growth, differentiation, metabolism, apoptosis and signal transduction[18,19], and previous studies have shown that it is also related to lactation[20,21]. From the perspective of protein products, there are two main types of alternative splicing: one is the splicing that leads to insertion or deletion, and the other is the splicing that leads to exon substitutions[22]. Notably, RNA editing is also closely related to alternative splicing. RNA editing and alternative splicing synergistically regulate gene transcription[23], while SNPs associated with RNA editing are also able to alter the translation efficiency of transcripts[24]. In this study, three variants of LXRα were identified in buffalo mammary glands. Among them, the variants LXRα2 and LXRα3 are derived from variant LXRα1 via the skipping of exon 9 and exon 4, respectively. It is worth noting that the skipping of exon 4 in LXRα3 does not cause a shift in the reading frame. Exons that do not cause frame-shifting when removed are called cassette exons, and most eukaryotic genes have evolved such exons[25]. In the present study, deletion of exon 9 resulted in a preceding stop codon (TAA) in the ORF of the LXRα2 transcript, resulting in a truncated protein terminated at the 400th amino acid residue. Comparative analysis showed that the structure of the LXRα transcripts of buffalo and cattle was highly similar, and the corresponding LXRα CDSs of buffalo and cattle were highly consistent. Phylogenetic analysis also showed that buffalo had close genetic relationship with other Bovidae species. In addition, the motifs and conserved domains of buffalo LXRα protein are highly consistent with those of other mammal species. These results suggest that buffalo LXRα may have similar functions with other mammals, especially Bovidae species, indicating that the LXRα gene is functionally conserved in mammals.LXRα is ligand-dependent transcription factor and plays a crucial role in the regulation of cholesterol homeostasis, fatty acid biosynthesis and glucose metabolism[8]. LXRα binds with RXR to form a heterodimer, which trans-activates some of lipogenic target genes of LXRα[5]. During lactation, the mammary gland is one of the most active metabolic organs with high short-term lipid synthesis capacity[26]. In this study, all three LXRα transcripts were expressed in buffalo mammary gland, indicating that the buffalo RXR-LXRα heterodimer regulates the transcription of multiple lipogenesis-related downstream genes in the buffalo mammary gland. LXRα has been shown to promote lipid synthesis in mammary gland by regulating the expression of multiple genes during the process of milk fat synthesis in buffalo and cattle, especially through the regulation of LXRE site in the core promoter region of its target genes[10,27]. Consistent with previous reports of increased expression levels of LXRα in murine mammary epithelial cells and bovine mammary gland tissues from non-lactation to lactation[28,29], this study showed that the mRNA abundance of the three LXRα transcripts of buffalo in lactation stage were all significantly higher than those in the non-lactation period, indicating that LXRα is an important regulator of milk fat synthesis, which is also consistent with previous finding[10]. Notably, although there was a significant difference in the expression of LXRα2 and LXRα3 between lactation and non-lactation, the magnitude of the difference is very small. Compared with the transcripts LXRα2 and LXRα3, the expression of LXRα1 in buffalo mammary gland was higher during lactation and non-lactation, and there was an extremely significant difference in expression between the two periods. Therefore, we speculate that the transcript LXRα1 plays a major regulatory role in the mammary gland of buffalo.It was confirmed that LXRα1 was the main transcript in the mammary gland of buffalo by expression analysis. It contains all 10 exons with CDS length of 1344 bp and encodes a precursor of 447 amino acid residues, which corresponds to the human LXRα1 protein[3]. Buffalo LXRα1 contains two complete functional domains, namely NR_DBD_LXR (DBD) and NR_LBD_LXR (LBD). Previous studies have shown that the domain DBD is composed of two highly conserved C4-type zinc fingers that confer the ability to bind DNA[5]. The LBD domain of LXRα has a dimerization interface and a ligand-dependent AF-2 region at the carboxyl terminus[30]. Upon binding of ligand to the LBD, a conformational change leads to recruitment of co-factors and transcriptional activation[31]. In addition, 10 α-helices in the LBD play an important role in the overall topography of LBD[6]. When the agonist binds to the core of the LBD, the conformational change involving helix 12 occurs, and the helix 12 forms a groove with the helices 3 and 4 to introduce the binding site of the co-activators[6]. Deletion of the 9–12 helix at the carboxyl terminus of LXRα2 (skipping exon 9) results in an incomplete LBD domain, which may affect its binding to the ligand and lead to a decrease in the ability of transcriptional activation of target genes. Surprisingly, this study revealed that LXRα2 and LXRα1 may have the same molecular functions and participate in the same biological processes. Because LXRα2 has a complete DBD, but does not have a complete LBD domain, it is speculated that LXRα2 may compete with LXRα1 at the target gene DNA binding site, and thus interfere with the transcriptional activation process in which LXRα1 participates. This suggests that the principal function of exon 9 skipping may be the regulation of transcriptional regulation involving LXRα1. Furthermore, previous study has shown that RXR mediates nuclear import of RXR-LXRα isoforms[32], and deletion of helices 9 and 10 affects the relative stability of RXR-LXRα2 heterodimers, which may result in the inability of LXRα2 to fully transfer to the nucleus to perform its functions. This was reinforced by subcellular localization analysis of LXRα2 in this study. However, due to the low expression of LXRα2 in the mammary gland, the extent of its effect on LXRα1 is likely to be small. As for LXRα3, skipping of exon 4, which encodes the DBD domain, causes it to lose its ability to bind to target gene promoters. This DBD-free variant may be inactive, but because it possesses an intact LBD domain, it may compete with LXRα1 for ligand binding, thereby antagonizing the transcriptional activation activity of LXRα1. Interestingly, LXRα3 still has partial DNA binding function, which may be due to the ability of N-terminal AF-1 to coordinate gene expression with AF-2[33]. Indeed, the loss of DBD may also lead to the cytoplasmic localization of certain LXRα3, as does FOXP2[34], which was also confirmed by the subcellular localization of LXRα3 in this study. In conclusion, three LXRα variants of buffalo have different functions in the mammary gland. Among them, LXRα1 may play a key role in the transcriptional regulation of target genes, while LXRα2 and LXRα3 may have an antagonistic regulatory relationship with LXRα1. Whether this is the case for the functions inferred here for LXRα2 and LXRα3 requires further experimental verification.Alternative splicing events may also accelerate paths of evolution[25]. If the rapidly evolving exon is endowed with a useful function, and the new function has only local benefits, it can make the splice sites tissue-specific[35]. Therefore, alternative splicing contributes to the tissue-specific function of the gene. Tissue-specific alternative splicing may be due to the tissue-specific expression of splicing factors and the corresponding regulation of target mRNA transcripts[13]. A previous study reported the existence of a variant of “LXRα3” in humans with a deletion of 60 amino acids in exon 6[3], but we did not identify this transcript in the buffalo mammary gland. Based on the fact that this “LXRα3” was identified in human embryonic kidney cells, we believe that the variant may not exist in the mammary gland and is not associated with lactation. This also gives us reason to believe that exon 6 is essential for the function of LXRα in lactation. Exon 6 may have been acquired by alternative splicing during the evolution of mammalian mammary glands. Whether this is the case requires further research.
Materials and methods
Ethics declarations
All experiments involving the use of animals were approved by the Experimental Animal Use and Ethics Committee of Yunnan Agricultural University under Contract No. YNAU2019llwyh019. All methods were performed in accordance with the relevant guidelines and regulations and the study is reported in accordance with ARRIVE guidelines.
Sampling, RNA extraction, and cDNA synthesis
Ten female healthy Binglangjiang buffalo (approximately 4-year-old, river type buffalo) were selected for the sampling of expression analysis in Tengchong city, Yunnan, China. The samples of mammary gland tissues from five lactating buffalo (60 d postpartum) and five non-lactating buffalo (60 d before parturition) were obtained surgically as previously described[36], and immediately stored in liquid nitrogen for subsequent RNA extraction. Total RNA was extracted from the mammary gland tissue according to manufacturer’s instructions for Trizol reagent (Invitrogen, USA). The quantity and quality of RNA extracted were determined by the NanoDrop 2000UV–Vis spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and electrophoresis in 1.5% denatured agarose gel electrophoresis. The cDNA was synthesized from 2 μg of purified total RNA using a RT reagent Kit with gDNA Eraser (TaKaRa, China) and SMARTer® RACE 5′/3′ Kit (TaKaRa).
Isolation of 5′ UTR of buffalo LXRα gene
The 5′ UTR sequence of the LXRα gene was obtained based on the Rapid amplification of cDNA ends (RACE) technique using SMARTer® RACE 5′/3′ Kit following the protocol of the manufacturer. The gene specific primer (GSP) and nested antisense primer (NGSP) were designed on the basis of intermediate known sequences of buffalo LXRα (XM_025266088, XM_025266090 and XM_025266091) (Table 2). The 5′ RACE PCR was performed in a 50 μL reaction mixture contained 2 μL 5′ RACE-Ready cDNA, 5 μL of 10× UPM, 1 μL of GSP (10 μM), 16 μL of PCR-Grade H2O, 25 μL of 2× SeqAmp Buffer and 1 μL of SeqAmp DNA Polymerase. A touchdown PCR program was employed as follows: (A) 5 cycles of 94 °C for 30 s and 72 °C for 2 min, then (B) 5 cycles of 94 °C for 30 s, 70 °C for 30 s and 72 °C for 2 min, following (C) 25 cycles of 94 °C for 30 s, 68 °C for 30 s and 72 °C for 2 min. Further, a nested PCR was carried out by the UPM short (supplied in kit) and NGSP (10 μM). PCR product was detected on 1.5% agarose gel and purified using Gel Extraction Kit (OMEGA, USA). The purified products were inserted into the pMD18-T vector (Takara) and sequenced bidirectionally by Shanghai Biological Engineering Technology Services Co., Ltd (Shanghai, China).
Table 2
Primer information for cloning, subcellular localization and qPCR analysis.
Primer name
Primer sequences (5′–3′)
Product length (bp)
Annealing temperature (°C)
Purpose
Efficiency
GSP
TTTTCCGCTTTTGTGGACGAA
68
5′ RACE
NGSP
TGTGCTGGATTCCTCCCTGA
68
LXRα_F1
GGTTTAAGAGTGGCCCTGACATCACA
1601
61.6
Gene cloning
LXRα_R1
CTTTAATGCCACGTGAGGATCTCCC
LXRα_F2
ctcgagATGTCTTTGTGGCTGGAGGC
1344/1203/1077
60.1
Subcellular localization
LXRα_R2
gaattcGTTCGTGCACATCCCAGATCT
LXRα1 + 2_qF
CCAGAGGCCACAGAGCTTCGTC
289
62.4
LXRα1 + LXRα2
1.90
LXRα1 + 2_qR
ATAAGACACACTCCTCCCGCAT
LXRα2_qF
AGGCCACAGGTGTCTTATCAGAA
225
60.1
LXRα2
1.91
LXRα2_qR
GCCAAGGCGTGACTCGAAGC
LXRα3_qF
CCAGATCGCCCTGCTGAAGACG
269
59.1
LXRα3
1.87
LXRα3_qR
AACATCAGTCGGTCCTGCTG
ACTB_qF
TGGGCATGGAATCCTG
196
60
ACTB
1.94
ACTB_qR
GGCGCGATGATCTTGAT
GAPDH_qF
ATGGAGAAGGCTGGGGCTCA
144
60
GAPDH
1.92
GAPDH_qR
GCAGGAGGCATTGCTGACAA
RPS23_qF
ACCGACGAGACCAGAAGT
306
60
RPS23
1.91
RPS23_qR
CTCCAGGAATGTCACCAA
The lowercase letters are the restriction sites of XhoI and EcoRI.
Primer information for cloning, subcellular localization and qPCR analysis.The lowercase letters are the restriction sites of XhoI and EcoRI.
Cloning of buffalo LXRα CDS
A pair of primers for cloning the complete CDS of buffalo LXRα were designed according to the obtained 5′ UTR sequence in this study and middle known sequence of buffalo LXRα (accession no. XM_025266088) (Table 2 and Fig. 7). The cDNA producing from mammary gland was invoked as the template for PCR reaction, and the reaction mixture and protocol were performed in agreement with the manufacturer’s protocols of 2× PCR Master Mix (CWBIO, China). The target PCR products were purified and then introduced into the pMD18-T vector. At least thirty independent clones were sequenced.
Figure 7
Schematic locations of CDS cloning, subcellular localization and qPCR primers of LXRα in this study. Primer pairs of LXRα_F1/R1 were used to clone buffalo LXRα CDS. LXRα_F2/R2 were designed to identify the subcellular localization of LXRα1, LXRα2 and LXRα3. LXRα1 + 2_qF/R were designed to detect the relative expression of LXRα1 + LXRα2. LXRα2_qF/R and LXRα3_qF/R were utilized to detect the relative expression of LXRα2 and LXRα3, respectively.
Schematic locations of CDS cloning, subcellular localization and qPCR primers of LXRα in this study. Primer pairs of LXRα_F1/R1 were used to clone buffalo LXRα CDS. LXRα_F2/R2 were designed to identify the subcellular localization of LXRα1, LXRα2 and LXRα3. LXRα1 + 2_qF/R were designed to detect the relative expression of LXRα1 + LXRα2. LXRα2_qF/R and LXRα3_qF/R were utilized to detect the relative expression of LXRα2 and LXRα3, respectively.
Identification and characterization of buffalo LXRα transcripts
The raw sequencing data were assembled, checked and edited by programs SeqMan and EditSeq (DNAstar Inc., USA) to obtain transcript sequences. The open reading frame (ORF) of each transcript and its corresponding amino acid sequence were determined by EditSeq. The gene was identified by homologous search using the BLAST program (http://www.ncbi.nlm.nih.gov/Blast.cgi). The sequence of buffalo LXRα gene (NC_059172.1) was downloaded and the exon sequences of this gene were obtained according to the gene structure annotation information. The alternative splicing pattern of this gene was determined by comparing the exon sequences of this gene with the transcripts obtained in this study. Physicochemical characteristics and subcellular localization of LXRα variants were predicted by the ProtParam tool (https://web.expasy.org/protparam/) and ProtComp 9.0 (http://linux1.softberry.com/berry.phtml). Biological process and molecular function analysis were conducted using InterProScan (http://www.ebi.ac.uk/interpro/search/sequence-search). Furthermore, a phylogenetic tree was constructed using the Mega 6 based on the amino acid sequences using the maximum likelihood method[37].The genome annotation GTF file of buffalo, cattle, zebu, bison, sheep and goat was downloaded from NCBI Datasets (https://www.ncbi.nlm.nih.gov/datasets/) to obtain all the transcription information of LXRα gene. Genetic structure information was added to the LXRα transcripts of these species using the GXF Fix function of TBtools software[38]. Further, all the gene structure information of the transcripts was submitted to the Gene Structure Display Server 2.0 (http://gsds.gao-lab.org/) for gene structure visualization. Conserved motifs of LXRα proteins were analyzed by website MEME (http://meme-suite.org/tools/meme). Conservative domains were determined using NCBI Batch Web CD-Serach Tool (https://www.ncbi. nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi).
The quantitative real-time PCR (qPCR)
Specific qPCR primers were designed to measure the relative expression of three LXRα transcripts according to the obtained CDS sequences of buffalo LXRα in this study (Table 2 and Fig. 7). The geometric mean of the Ct values of β-actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and ribosomal protein S23 (RPS23) genes was utilized to normalize the expression of target mRNA. The primer pair LXRα1 + 2_qF/R were designed to detect the relative expression of both LXRα1 and LXRα2 (there was no suitable primer pair to detect the expression of LXRα1 alone), and LXRα2_qF/R and LXRα3_qF/R were used to detect the relative expression of LXRα2 and LXRα3, respectively. The qPCR was performed on a CFX96 Real-Time System (Bio-Rad, Hercules, CA) with TB Green® Advantage® qPCR Premix (TaKaRa) under manufacturer’s protocols. The qPCR analyses of each transcript in this study were performed using cDNA from 5 biological replicates, with 3 technical replicates per biological replicate.
Cell culture
Buffalo mammary epithelial cells (BuMECs) were obtained from a lactating buffalo (60 d postpartum; 5-year-old) and purified based on the differential sensitivity of the cells to trypsin digestion as previously described by our lab[39,40]. Dulbecco modified Eagle medium (Gibco, USA) supplemented with 5 μg/mL insulin (Sigma, USA), 5 μg/mL hydrocortisone (Sigma), 1 μg/mL epidermal growth factor (Sigma), 2% penicillin/streptomycin (Gibco) and 10% fetal bovine serum (Gibco) were used for the culture of purified BuMECs. BuMECs were cultured under constant conditions of 37 °C and 5% CO2, and the medium was altered every 24 h.
Subcellular localization of buffalo LXRα
The CDSs of three buffalo LXRα transcripts that did not contain the stop codon were amplified via PCR. The pEGFP-N1 vector (CLONTECH Laboratories, Inc.) was constructed to express buffalo LXRα gene. The CDS of LXRα was subcloned into the vector via XhoI and EcoRI sites to generate pEGFP-LXRα recombinant. The details about the primers are presented in Table 2. When the confluence of BuMECs in the 6-well cell culture plates was about 80%, 3 μg of pEGFP-LXRα was transiently transfected into the cells according to the instructions of FuGENE® 6 transfection reagent (Invitrogen, USA). After transfection for 48 h, the medium was removed and the cells were washed twice with PBS. After adding Mito-Tracker Red CMXRos (Beyotime, Shanghai, China) with a final concentration of 200 nM, the cells were incubated for 20 min at 37 °C for mitochondrial staining. After the staining solution was removed, the cells were washed twice with PBS (Gibco), Hoechst 33342 (Beyotime) cell nucleus staining solution was added, and further incubated for 20 min at 37 °C. After the staining solution was removed, the cellular localization of LXRα protein was observed by confocal laser scanning microscope (OLYMPUS, Japan).
Data analysis
The qPCR data obtained were displayed with means ± SEM. Data of qPCR were calculated by the 2−ΔΔCt method. Statistical comparison of the means between the two groups was performed using Student’s t-test by software GraphPad Prism 5, and P value < 0.05 were considered as significant.
Conclusions
We report for the first time the existence of three transcripts of the LXRα gene in buffalo mammary gland, which are derived from alternative splicing of the exons of a single gene. Among these three transcripts, LXRα1 was the dominant transcript with the highest expression in lactating mammary glands and played a functional role in the nucleus. The mRNA expression of the three LXRα transcripts in buffalo mammary glands was significantly increased during lactation compared with non-lactation, suggesting that they may play a crucial role in buffalo milk fat synthesis. The function of buffalo LXRα1 protein is very similar to that of other species of Bovidae. The other two LXRα variants (LXRα2 and LXRα3) exhibited some differences from LXRα1 in protein properties, structure, molecular function and subcellular localization, suggesting that they have different functions in buffalo mammary glands. The LXRα1 may play a key role in transcriptional regulation of target genes, while LXRα2 and LXRα3 may antagonize the transcriptional regulation of LXRα1. This study revealed that post-transcriptional processing of LXRα gene plays an important role in the lactation of buffalo.Supplementary Figure S1.
Authors: Ville Veikkolainen; Katri Vaparanta; Kalle Halkilahti; Kristiina Iljin; Maria Sundvall; Klaus Elenius Journal: Cell Cycle Date: 2011-08-15 Impact factor: 4.534