The Neisseria gonorrhoeae type IV pilus promotes resistance to hydrogen peroxide- and LL-37-mediated killing by modulating the availability of intracellular, labile iron.

The Neisseria gonorrhoeae Type IV pilus is a multifunctional, dynamic fiber involved in host cell attachment, DNA transformation, and twitching motility. We previously reported that the N. gonorrhoeae pilus is also required for resistance against hydrogen peroxide-, antimicrobial peptide LL-37-, and non-oxidative, neutrophil-mediated killing. We tested whether the hydrogen peroxide, LL-37, and neutrophil hypersensitivity phenotypes in non-piliated N. gonorrhoeae could be due to elevated iron levels. Iron chelation in the growth medium rescued a nonpiliated pilE mutant from both hydrogen peroxide- and antimicrobial peptide LL-37-mediated killing, suggesting these phenotypes are related to iron availability. We used the antibiotic streptonigrin, which depends on free cytoplasmic iron and oxidation to kill bacteria, to determine whether piliation affected intracellular iron levels. Several non-piliated, loss-of-function mutants were more sensitive to streptonigrin killing than the piliated parental strain. Consistent with the idea that higher available iron levels in the under- and non-piliated strains were responsible for the higher streptonigrin sensitivity, iron limitation by desferal chelation restored resistance to streptonigrin in these strains and the addition of iron restored the sensitivity to streptonigrin killing. The antioxidants tiron and dimethylthiourea rescued the pilE mutant from streptonigrin-mediated killing, suggesting that the elevated labile iron pool in non-piliated bacteria leads to streptonigrin-dependent reactive oxygen species production. These antioxidants did not affect LL-37-mediated killing. We confirmed that the pilE mutant is not more sensitive to other antibiotics showing that the streptonigrin phenotypes are not due to general bacterial envelope disruption. The total iron content of the cell was unaltered by piliation when measured using ICP-MS suggesting that only the labile iron pool is affected by piliation. These results support the hypothesis that piliation state affects N. gonorrhoeae iron homeostasis and influences sensitivity to various host-derived antimicrobial agents.

Introduction

Neisseria gonorrhoeae is an obligate human pathogen that is the sole cause of the sexually transmitted infection, gonorrhea. Over 87 million gonorrhea cases are reported globally each year [1] and 616,000 cases were reported to the Centers for Disease Control and Prevention in the United States in 2019, the highest number since 1991 [2]. Combined with the fact that there are strains resistant to commonly administered antibiotics, gonorrhea has become an increasingly alarming concern to public health [3-5], and has led to the CDC labeling N. gonorrhoeae as an urgent public health threat.

Colonization primarily occurs in the genitourinary tract but can also infect the ocular, nasopharyngeal, and rectal mucosa [6-8]. Purulent exudate, a genital secretion of a mix of fluid, bacteria, and neutrophils (or polymorphonuclear leukocytes, PMNs), and dysuria, pain during urination, are classic indications of symptomatic gonococcal infection [9]. Colonization with no observable symptoms can also occur in both men and women [10]. In women, an untreated infection can spread from the cervix to other areas of the reproductive organ to cause pelvic inflammatory disease. In men, infections can cause epididymitis which is inflammation of the epididymis. These mucosal gonococcal infections can also enter the bloodstream to develop disseminated gonococcal infection and can lead to dermatitis, arthritis, endocarditis, and neurological issues [11]. Additionally, one’s risk of HIV acquisition and transmission increases if the person is co-infected with N. gonorrhoeae [12-14].

The ability of N. gonorrhoeae to resist host immune responses is critical for pathogenesis. N. gonorrhoeae are equipped with multiple antioxidant mechanisms whose products protect N. gonorrhoeae against oxidative damage and neutrophils [15], including ngo1686, renamed to mpg for M23B metalloprotease active against peptidoglycan, recN [16,17], and a transcriptional response that consists of hundreds of genes when exposed to hydrogen peroxide [17,18]. Additionally, disrupting N. gonorrhoeae genes whose products have antioxidant functions (katA, sodB, ccp, or mntABC), as single mutants or in combination, did not affect neutrophil-mediated killing [19,20] or infection in a vaginal mouse model [21]. However, anti-gonococcal neutrophil activities are mainly non-oxidative; therefore, these gene products are likely acting in response to other sources of reactive oxygen species (ROS). In the absence of an oxidative burst, neutrophils from anoxic conditions [22] or from patients with chronic granulomatous disease [19,23], an immunodeficiency that renders neutrophils unable to elicit an oxidative burst due to mutations in NADPH oxidase, are still cytotoxic to N. gonorrhoeae. Even in the presence of a bactericidal oxidative response, live N. gonorrhoeae can suppress neutrophil ROS production [24]. These results support the conclusion that PMN anti-gonococcal activities are mainly non-oxidative and it has been proposed that N. gonorrhoeae genes that are involved in antioxidant responses are protective in certain oxidative conditions, such as from the mucosal epithelium, vaginal lactobacilli, and cellular respiration [25].

In addition to non-oxidative antibacterial effectors like cathepsin proteinases and peptidoglycan-targeting lysozyme, neutrophils release short, positively charged antimicrobial peptides (AMPs). LL-37 is an alpha-helical cathelicidin produced from PMNs that can kill N. gonorrhoeae, and the MtrCDE efflux pump system decreases AMP susceptibility [26]. The mechanism of how AMPs kill cells is not known but may depend on an interaction of the peptide with the bacterial membrane. The cationic nature of the peptide can mediate an electrostatic interaction with the negatively charged bacterial outer membrane and, subsequently, the cytoplasmic membrane. Once a critical local concentration of the peptide accumulates on the membrane, these amphipathic peptides can disrupt the cell membrane through the formation of holes that lead to cell death [27]. However, there is also evidence that AMPs have intracellular targets that are important for the AMP mechanism of action [27]. The increased sensitivity to LL-37 killing in efflux pump mutants raises the possibility that LL-37 has activity within the bacterial cytoplasm [28]. In support of this hypothesis is the report that LL-37 can gain access to the bacterial cytoplasm where it can bind to DNA, interrupt DNA replication, and cause DNA mutations [29]. LL-37 can also bind DNA and increase the viscosity of the cytoplasm [30]. Therefore, LL-37 may have different modes of action against N. gonorrhoeae.

Type IV pili are critical in establishing infection by mediating adherence of the bacterial cells to the host mucosal epithelium. Type IV pili are dynamic appendages that can extend and retract, are critical in microcolony formation, host adherence, twitching motility, and natural DNA competence [31]. The pilus undergoes phase variation and antigenic variation, processes that contribute to adaptive immune evasion and can change the expression level of the pilus.

Pili are also important for gonococcal resistance to hydrogen peroxide-, LL-37-, and neutrophil-mediated killing [32]. In characterizing the transcriptional response to hydrogen peroxide, we reported that the gene in the ngo1686 locus mpg was upregulated by oxidative damage [17]. In multiple mpg loss-of-function mutants, N. gonorrhoeae cells were underpiliated and sensitive to hydrogen peroxide, suggesting that the pilus promoted hydrogen peroxide resistance [33]. In addition, a predominantly Opa-negative, pilE mutant was more sensitive to hydrogen peroxide-, LL-37-, and nonoxidative neutrophil-mediated killing than the isogenic piliated strain [32]. A double mpg/pilE mutant was equally sensitive as the pilE mutant, supporting that these genes are part of the same pathway. Here, we follow up on those phenotypes to report that the pilus-mediated resistance to hydrogen peroxide and LL-37 killing is due to a reduced level of intracellular available iron pool, suggesting that pilus expression modulates iron homeostasis within the bacterial cell to protect against the antibacterial action of neutrophils.

Results

Iron chelation rescues the pilE mutant from hydrogen peroxide- and LL-37-mediated killing

We previously reported that a pilE mutant is more sensitive to various antimicrobial agents than the FA1090 piliated strain [32]. We confirmed that the pilE mutant was more sensitive to both hydrogen peroxide and LL-37 than the parental strain ( and ). We reasoned that there could be increased sensitivity to hydrogen peroxide through iron-generating hydroxyl radicals using Fenton chemistry. To determine whether the available iron affects sensitivity to hydrogen peroxide- and LL-37-mediated killing in the pilE mutant, we compared the effect of iron chelation on survival using desferal (also named desferrioxamine) [34]. When we added desferal to the growth medium, relative survival of the pilE mutant against hydrogen peroxide increased about five-fold when comparing an average relative survival of 0.79 with 10 mM desferal to 0.15 without desferal (). Desferal also affected the sensitivity of the pilE mutant to LL-37, increasing resistance by seven-fold when comparing an average relative survival of 5.7x10-4 with 10 mM desferal to 7.8x10-5 without desferal (). We tested the effect of desferal on the parental piliated strain and have found that there was no difference in sensitivity to either hydrogen peroxide or LL-37 ().

Non-piliated cells are hypersensitive to streptonigrin in an iron-dependent manner

Sensitivity of the bacterial cells to the antibiotic streptonigrin is influenced by differences in bacterial iron levels. This antibiotic presently has limited clinical use due to its toxicity and side-effects [35]. Streptonigrin is a hydrophobic compound that is poorly soluble in water and often dissolved in an organic solvent. Streptonigrin can, therefore, diffuse across the membrane, bind to ferrous iron in the bacterial cytoplasm, and generate cytotoxic reactive oxygen species [36]. As a result, the amount of streptonigrin required to kill a bacterial cell is proportional to the intracellular, labile iron pool [37-39]. We tested whether a pilE mutant was more sensitive to streptonigrin compared to the piliated parental strain (). The nonpiliated mutant was more sensitive to streptonigrin killing at all levels of antibiotic tested and increasing the concentration of streptonigrin resulted in a greater differential killing between the strains (). For example, the pilE mutant showed over 55 thousand-fold greater sensitivity to 1.6 μM streptonigrin than the piliated parent.

Because the loss of membrane integrity in Vibrio cholerae increases oxidative stress and labile, intracellular iron [40], we tested whether the differential sensitivity of the nonpiliated cells could be due to a general leakiness of the bacterial envelope. We assayed the sensitivity of the pilE mutant to several antibiotics representing different classes. While the pilE mutant displayed some differences in sensitivities to some antimicrobials relative to the piliated parent strain, the absence of piliation did not lead to a hypersensitivity to other antibiotics (), similar to the results from a previous study [41].

To test whether streptonigrin hypersensitivity is due to iron, we treated the pilE mutant or the parent strain with either streptonigrin alone, desferal alone, or desferal before streptonigrin treatment, and determined the relative survival. Iron-chelation by desferal had a considerable effect on streptonigrin-mediated killing of the pilE mutant () and the parental strain (). These results are consistent with a previous report showing desferal reduced killing by streptonigrin [42].

Desferal has a high affinity for iron (Km ~10−26) but can also complex with other metal ions with lower affinities [34]. To determine whether desferal chelating other metals in the media could be responsible for desferal-mediated rescue in the pilE mutant, we tested the effect of adding various metals, including iron, on desferal-mediated rescue from streptonigrin killing. We preincubated desferal with increasing concentrations of iron(III) chloride, manganese(II) chloride, zinc(II) chloride, and magnesium(II) chloride and exposed cells to these desferal-metal mixtures before streptonigrin killing. While we did observe that excess iron promoted streptonigrin resistance, iron also interfered with desferal-dependent rescue from streptonigrin killing in the pilE mutant (Figs and ). We detected similar effects of excess magnesium (); however, the fold reduction in desferal rescue was greater with iron (over 100-fold) compared to magnesium (less than 10-fold). While zinc and manganese increased resistance to streptonigrin, they did not affect desferal-dependent streptonigrin rescue ( and ).

Pilus expression promotes streptonigrin resistance

While the piliated and nonpiliated strains we used are isogenic since the nonpiliated strain was derived from the piliated parent, it remained a possibility that second site mutation(s) could be responsible for the differential sensitivity phenotypes [43]. To directly test whether pilE expression alone affected the level of streptonigrin sensitivity, we used an IPTG-inducible pilE construct where the lacIOP regulatory region was inserted in the 5’ untranslated region of pilE, between the pilE promoter and the open reading frame [44] (). In the absence of pilE induction, cells were hypersensitive to streptonigrin-mediated killing like the pilE mutant. When piliation was restored by adding IPTG into the growth medium, killing was reduced by over 1000-fold. We confirmed that as previously reported, 1 mM IPTG increased transformation competence by over seven hundred-fold confirming the differential pilus expression (). These results confirm that it is pilin expression that affects streptonigrin resistance and this effect was most likely due to type IV pilus expression.

PilE-dependent resistance to streptonigrin occurs in multiple N. gonorrhoeae strains

To determine whether this pilus-dependent phenotype was specific to the FA1090 strain, we tested if two other common lab strains of N. gonorrhoeae exhibit hypersensitivity to streptonigrin in nonpiliated cells. The pilE gene was deleted in isolates F62 and FA19, and each parental strain and isogenic pilE mutant was treated with increasing concentrations of streptonigrin. Both the F62 and FA19 strains are hypersensitive to streptonigrin in the absence of pilE and FA19 was more sensitive than F62 ().

The N. gonorrhoeae strain background impacts the PilE-dependent streptonigrin resistance phenotype.

A. The F62 (n = 3) and B. FA19 (n = 4) strains and their isogenic pilE mutants were treated with increasing concentrations of streptonigrin. The average and standard error of biological replicates are shown.

Streptonigrin kills the pilE mutant in a ROS-dependent manner and LL-37 kills in a ROS-independent manner

Elevated labile iron pools can lead to greater ROS through the Fenton chemistry. To determine whether intracellular levels of ROS are elevated in the pilE mutant, we tested several ROS scavengers that quench various ROS species. Consistent with a previous report that anaerobically grown N. gonorrhoeae cells are resistant to streptonigrin [42], we found that the ROS scavengers dimethylthiourea (DMTU) and tiron can rescue the pilE mutant from streptonigrin-dependent killing. There was an approximately 330-fold increase in relative survival to streptonigrin when cultures were treated with 15 mM DMTU and a 150-fold increase when treated with 0.5 mM tiron (). We tested whether DMTU or tiron affected LL-37-mediated killing in the pilE mutant but did not observe any rescue (). These results suggest that the level of iron in non-piliated cells affect sensitivity to streptonigrin through a ROS-dependent mechanism, while the iron-dependent LL-37 killing occurs through a ROS-independent manner.

ROS scavengers DMTU and tiron protect against SPN-mediated killing in pilE mutant.

Streptonigrin sensitivity of the pilE mutant after pre-treatment with either DMTU or tiron. The mean and standard error of the mean are plotted and analyzed with one-way ANOVA.

Total iron content is unaffected by piliation

Due to the iron-dependent, differential sensitivities of the pilE mutant to streptonigrin, hydrogen peroxide, and LL-37, we tested the hypothesis that piliation affected total iron levels in both the parental strain and pilE mutant by comparing the level of iron measured by ICP-MS [45,46]. The parental strain and the pilE mutant showed no significant difference in total iron normalized to total protein (parent = 0.127 average Fe/total protein, SD = 0.02; pilE mutant = 0.126 average Fe/total protein, SD = 0.014; pilE mutant/parent ratio = 0.995, p-value = 0.96 Student t-test). These results indicated that pilE hypersensitivity to streptonigrin, hydrogen peroxide, and LL-37 is not due to differential levels of total intracellular iron.

Discussion

Iron is a critical metal in the competition between bacteria and their hosts [47]. While iron is a necessary co-factor of many enzymes, it can exacerbate the toxic effects of oxygen through the Fenton reaction. We had previously reported that piliation provides N. gonorrhoeae resistance to hydrogen peroxide, LL-37, and neutrophils [32]. We now have shown that both hydrogen peroxide and LL-37 sensitivity are dependent on the cells being iron-replete and that hydrogen peroxide sensitivity is due to the development of ROS. LL-37 sensitivity is dependent on iron; however, iron is mediating LL-37 non-oxidative killing of non-piliated cells through unknown factors.

We propose that the differential sensitivity to streptonigrin, hydrogen peroxide, and LL-37 is from the effect of pilus expression on modulating the intracellular labile iron pool. This elevated level of available iron in non-piliated cells would favor the hydroxyl-radical-forming Fenton reaction and alter the sensitivity threshold to oxidative damage. This hypothesis is supported by the fact that pilE mutant survival from streptonigrin killing is reduced by the ROS scavengers DMTU and tiron. DMTU is regarded as a hydrogen peroxide and hydroxyl radical scavenger [48,49], while tiron is characterized as a superoxide anion scavenger [50], which are all molecules that are produced after hydrogen peroxide treatment. In a study comparing transcriptional changes in piliated and nonpiliated N. gonorrhoeae, recN and ngo1769 (a cytochrome c peroxidase) showed approximately two times higher expression in piliated gonococci [51], suggesting that increased expression of proteins with antioxidant activities may be involved in pilin-dependent resistance to oxidative killing by hydrogen peroxide and streptonigrin.

Interestingly, while LL-37 also exhibited enhanced, iron-dependent killing of nonpiliated strains, the bactericidal activity was unaffected by DMTU or tiron treatment, suggesting that its antimicrobial activity is non-oxidative. A similar iron-dependent toxic effect of LL-37 was found for Pseudomonas aeruginosa [52]. The authors suggested that LL-37 promoted the influx of iron into the cells and that promoted DNA damage through Fenton reactions. This would be a possible explanation if piliation modulates iron import and, in the absence of the pilus, iron influx is uninhibited, leading to differential killing in the pilE mutant. However, if piliation affected membrane permeability, then we would expect the pilE mutant to have increased sensitivity to other antibiotics, which we did not observe (Table 2).

Table 2

Strains and plasmids.

Strain	Description	Reference/source
N-1-60	FA1090 multisite G4 mutant 1-81-S2 pilE variant, pilC2PLon	[66]
N-1-69	An unmarked ΔpilE mutant (deletion from the 6th amino acid to the stop codon in pilE from Dr. Alison Criss) in N-1-60	[66]
N-1-5	FA1090 Tn#9/G4 mutant Avd-1 1-81-S2 pilE variant KanR	[68]
N-1-56	IPTG-regulatable pilE variant RM11.2 in N-1-5 ErmR	[44]
N-4-47	F62	Lab stock
N-4-46	FA19	Lab stock
N-4-53	pilE deletion from N-1-69 in N-4-47	this study
N-4-54	pilE deletion from N-1-69 in N-4-46	this study

There are several possibilities for how piliation could affect iron homeostasis (). The pilus could directly sequester iron extracellularly and limit intracellular labile iron by either binding to iron or transporting iron either in its free form or complexed to another compound ( and ). The pilus facilitates the entry of diverse substrates, including DNA, certain antibiotics, heme, and triton X-100 and, therefore, could transport iron [53]. Piliation may impact iron homeostasis through transcriptional changes () of genes involved in iron transport or iron storage ( and ). In a microarray analysis of a mutant that lacked the retraction ATPase PilT, the transcription of 63 genes were altered, including an iron transporter gene fetA [54]. The effect of the pilus on iron is not found in every type IV pili expressing species as Pseudomonas aeruginosa does not exhibit pilus-dependent resistance to hydrogen peroxide [32]; therefore, pilin-dependent iron homeostasis depends on additional factors in N. gonorrhoeae that is absent in P. aeruginosa or there are factors in P. aeruginosa that interfere with pilus-mediated iron regulation.

Possible mechanism underlying pilin-dependent iron homeostasis and resistance to hydrogen peroxide and LL-37.

A. The pilus may bind to iron and/or B. transport hydrogen peroxide, LL-37, streptonigrin, and iron (Fe*) which could be in an unbound state or complexed with another substrate. C. Piliation could affect the transcription of genes that are important for D. iron transport, E. storage, or G. antibiotic efflux. F. Reduced pilin can quench reactive oxygen species and form disulfide bonds. H. Electrons from reduced pilin subunits can affect the electron transport chain to influence the activity of antibiotic efflux pumps. These pumps may transport streptonigrin, LL-37, hydrogen peroxide, and/or iron in its free or complexed form. Abbreviations for electron transport chain (ETC), inner membrane (IM), and outer membrane (OM) are used.

Likewise, there are multiple ways for how piliation could affect sensitivity to hydrogen peroxide and LL-37. If piliation directly alters the level of free iron, the basal level of intracellular ROS would be affected through the Fenton reaction. The effect of piliation on labile iron can also impact antibiotic efflux. The ferric uptake regulator Fur affects the level of the repressor mpeR [55], which impacts the transcription of mtrR and farR, the transcriptional repressors of the mtrCDE and farAB operons, respectively [56-58]. Alternatively, reduced, free disulfide bonds on pilin subunits can also directly scavenge ROS, forming disulfide bonds (). Additionally, piliation may influence antibiotic efflux through the Mtr or Far systems (). It was reported that a pilT mutant increased expression of mtrF that encodes an inner membrane multiple transferable resistant protein [59]. This PilT-dependent effect occurs through the transcriptional repressor FarR that is also known to regulate the expression of the FarAB transport system [59]. Lastly, the effect of piliation on antibiotic efflux may be less direct. It was reported that an increase in NADH activated both the electron transport chain activity and antibiotic efflux pumps in P. aeruginosa [60]. A pilin subunit in its reduced state with two free disulfide bonds could affect electron transport like NADH by acting as an electron donor and ultimately activating antibiotic efflux pumps in N. gonorrhoeae ().

There was no major difference in iron levels between piliated and non-piliated cells by ICP-MS. Most of the cellular iron is bound in iron-sulfur clusters. Given that streptonigrin and desferal can only access the labile iron pool, the pilus predominantly influences the level of free or loosely bound iron. If piliation only affects the labile iron pool, then the difference may be too small to measure the difference in the labile iron pool relative to the total iron in the cell.

We observed that the addition of iron or magnesium promoted survival in streptonigrin-treated pilE cells. We predict that the iron-dependent increase in streptonigrin resistance may be due to the repair of iron-sulfur clusters. The addition of magnesium may stabilize the outer leaflet of the outer membrane [61].

Since neutrophil oxidative antimicrobial activity is not required to kill N. gonorrhoeae, the antioxidative defense mechanisms may be particularly important during certain phases of infection. It has been proposed that these defense mechanisms may play a role early in the course of an infection [15,19] when gonococci encounter hydrogen peroxide from the epithelium [62] and commensal lactobacilli [63]. Alternatively, as an infection progresses, the immunostimulatory dead bacterial debris may outweigh the oxidative suppression of live cells, resulting in a strong PMN respiratory response. The pilus may, therefore, act as an antioxidant resistance mechanism that may also be sufficient to allow bacteria to survive and multiply at this stage of the infection [64,65]. Our results may explain why only piliated isolates are recovered from typically symptomatic clinical infections due to the protective effect of the type IV pili against PMN killing by limiting intracellular iron, promoting transmission, and continuing the chain of gonorrhea infections.

Methods

Strains and reagents

Strains used in this study are listed in . The parental strain N-1-60 [66] is N. gonorrhoeae strain FA1090 pilin variant 1-81-S2 (confirmed using primers pilRBS and SP3A (Table 3) [67]). N-1-60 carries multiple point mutations in the pilE guanine quadruplex sequence upstream of pilE [68] (confirmed with primers USS2 and pilAREV [66] ()) and the phase-locked “on” pilC2 (NGO0055) sequence (confirmed using primers pilCfor and pilCdownstream ()), not pilC1 as previously indicated [66]. For all strains, the 1-81-S2 pilE sequence was confirmed in PCR products using primers pilRBS and SP3A () in addition to the non-variable guanine quadruplex and the phase-locked pilC2. This work was supported by the Northwestern University Sanger Sequencing Facility. Solid growth media was prepared with GC medium base (Difco) plus 1.25 g agar/liter, Kellogg supplement I [22.2 mM glucose, 0.68 mM glutamine, 0.45 mM cocarboxylase], and Kellogg supplement II [1.23 μM Fe(NO3)3] (GCB) at 37°C in 5% CO2. For liquid growth, cells were grown in liquid GCB media (GCBL) [containing 15 g/liter Bacto protease peptone 3, 23 mM potassium phosphate dibasic, 7.35 mM potassium phosphate monobasic, and 17.11 mM sodium chloride], Kellogg supplement I, and 5 mM sodium bicarbonate.

Table 3

Oligonucleotides.

Name	Sequence (5’-3’)	Source/reference
PILRBS	GGCTTTCCCCTTTCAATTAGGAG	[67]
SP3A	CCGGAACGGACGACCCCG	[67]
USS2	TGAACCAACTGCCACCTAAGG	[68]
pilAREV	GGGCGGCAGTGTCGAAAATTGTCAGTTTTAGTGC	[66]
pilCfor	GGCGGAGGTGGCGGGGCC	[69]
pilCdownstream	CCATCTTTGGCGGTACCCTCGCTG	[69]

Determination of FA1090 transformation efficiency

The efficiency of FA1090 carrying an IPTG-regulatable pilE transformation was performed similarly to the protocol that was described in reference [70] except that 50 ng of pSY6 plasmid DNA was used. After 20 minutes of incubation of the cells and DNA in the presence and absence of IPTG at 37°C, 1 U DNase I was added to the transformation reaction mixtures, and they were incubated for 10 min at 37°C followed by 4 hours of incubation with and without IPTG in 2 ml of GCBL in a 12-well plate. Cells were diluted and grown on GCB agar plates without antibiotic selection and plates that contained 1 μg/ml nalidixic acid. Transformation efficiencies are reported as the means from four independent experiments.

Hydrogen peroxide sensitivity assay

Cells were grown on GCB solid medium from -80 C freezer stocks for approximately 18 hours at 37 C with 5% CO2. GCBL with supplement I and 5 mM sodium bicarbonate was inoculated to an OD550 between 0.03–0.05 and grew for 2–3 hours, shaking at 220 rpm at 37°C. Cultures were diluted to an OD550 ~0.1 and grew for approximately 2 hours, shaking at 220 rpm at 37°C or until the cultures reached mid-exponential phase OD550 ~0.4–0.6. Cultures were normalized to an OD550 = 0.07 and treated with a gradient of hydrogen peroxide (Sigma 323381) for 15 minutes at 37°C with aeration either on a drum rotor or shaking at 220 rpm. For experiments using desferal, cultures were normalized to an OD550 = 0.055 and pretreated with the desferal for 15 minutes at 37°C and then exposed to hydrogen peroxide for 15 minutes at 37°C in a 12-well plate. Relative survival was determined by serially diluting the cells onto GCB agar plates and comparing the number of CFU after hydrogen peroxide treatment to no hydrogen peroxide.

LL-37 sensitivity assay

LL-37 (Peptide Sciences) stock solutions of 2.5 mg/ml or 556.42 μM was prepared in 0.01% (v/v) glacial acetic acid [26], stored at -20°C, and serially diluted in water before use. Strains were grown similar to that described for growing cells for hydrogen peroxide sensitivity assays. Cells were then diluted to an OD500 of 0.05 in GCBL (supplemented with Supp I and 50 mM sodium bicarbonate). Cells were treated with LL-37 for 30 minutes at 37°C shaking at 220 rpm. In experiments that involve treatment with desferal, DMTU, or tiron, cells were exposed to these compounds for 15 minutes at 37°C shaking at 220 rpm prior to LL-37 treatment. For Fig 1C and 1D, the cells were washed by centrifuging at 3381 rcf for 2 minutes at room temperature, resuspended with GCBL, and 10-fold serial dilutions were spotted onto GCB agar plates. Relative survival was calculated by comparing the number of LL-37 resistant CFUs to the total number of CFUs in the absence of LL-37. The results are the averages and standard error of the means and representative of independent experiments.

Fig 1

Iron chelation rescues the pilE mutant from HP- and LL-37-mediated killing.

Relative survival of the parental strain (N-1-60) and the isogenic pilE mutant (N-1-69) after (A) hydrogen peroxide (HP) treatment or (B) LL-37 exposure. C. Relative survival of the FA1090 pilE mutant after pre-treatment with desferal before HP exposure. D. LL-37 sensitivities of the pilE mutant after desferal treatment. The data are presented with lines to indicate the matched pairs and analyzed by a paired t test in panel C and a Wilcoxon matched pairs signed-rank test in panel D with GraphPad Prism.

Streptonigrin sensitivity assay

Cells were grown overnight on GCB plates at 37°C and 5% CO2 were inoculated into GCBL (supplemented with Supp I and 50 mM sodium bicarbonate) at an OD550 of 0.04–0.15 and grown shaking at 37°C for 2–3 hours. To test if pilE expression was necessary for streptonigrin resistance, either no IPTG or 1 mM IPTG was added to the media to induce pilE expression from the native locus during the three-hour incubation period. To determine if various metals affected desferal-mediated rescue, 1 mM desferal was mixed with increasing concentrations of metal salts for 5–10 minutes before being added this mixture to a culture diluted to OD550 ~0.05 for 5 minutes. Cultures were treated with dimethyl sulfoxide (Sigma D2650) or streptonigrin from Streptomyces flocculus (Sigma S1014) for 30 minutes (or 1 hour for Fig 2A) at 37°C with aeration. Except for in Fig 2A, the cells were washed by centrifuging at 3381 rcf for 2 minutes at room temperature, and resuspended with GCBL before 10-fold serial dilutions were spotted onto GCB agar plates. Relative survival was calculated by comparing the number of CFU that survived streptonigrin treatment to DMSO vehicle control. DMSO was kept at or under 0.5% v/v final concentration.

Fig 2

Pilus expression mediates resistance to streptonigrin killing in an iron-dependent manner.

A. The effect of streptonigrin (SPN) on the parental strain FA1090 and the pilE mutant. Strains were treated with DMSO or streptonigrin and the relative survival was determined (n = 15). The average and standard error are shown. The data were analyzed by ANOVA and p values are indicated. B. The effect of desferal (des) on streptonigrin resistance in the pilE mutant (n = 11). C. The effect of des on streptonigrin resistance in the parent (n = 7). D. The effect of ferric chloride on desferal-mediated rescue from streptonigrin killing in the pilE mutant. E. The effect of pilE expression on streptonigrin resistance. IPTG in the growth medium was used to induce chromosomal pilE expression prior to treatment with streptonigrin (n = 4). Relative survival was determined by plating CFUs from the various conditions. Averages and standard error of independent biological replicates are shown and significance measured using a paired t-test in panel B, a Wilcoxan matched pairs signed-rank test in panel C, a Tukey’s multiple comparison test in panel D, and a paired t test in panel E with GraphPad Prism.

Antibiotic sensitivity tests

Cells that grew overnight on GCB agar plates were swabbed into 1 ml of GCBL and normalized to an OD550 of 0.05 and 100 μl of the cell suspension was spread and absorbed into GCB agar plates. An Etest strip (bioMérieux, Durham, NC) was laid on top and patted down to ensure contact between the strip and the surface of the growth medium. After incubating for 17 hours at 37°C in the presence of 5% CO2, zones of clearance were recorded. The results are the ranges from three biological replicates.

Metal analysis

The parent and pilE mutant were grown to mid-exponential phase in 40–50 ml. Cells were pelleted and washed with phosphate-buffered saline at least two times. The wash buffer contained 10 mM of a membrane-impermeable iron chelator diethylenetriaminepentaacetic acid (also known as DETAPAC or DTPA) to remove extracellular iron. The pellet was dried in a heat block for one hour at 100°C. The condensation within the tube was wicked away with a clean Kimwipe. The samples were acid digested by adding 250 μl of trace grade nitric acid (OmniTrace Ultra nitric acid NX0408) and 50 μl of trace grade hydrogen peroxide (Sigma 95321). The samples were incubated in a heat block at 65°C overnight and then diluted with 4.7 ml of water to a final volume of 5 ml and analyzed by the Quantitative Bio-element Imaging Center at Northwestern University on a computer-controlled (QTEGRA software) Thermo iCapQ ICP-MS (Thermo Fisher Scientific, Waltham, MA, USA) operating in KED mode and equipped with an ESI SC-2DX PrepFAST autosampler (Omaha, NE, USA). Internal standard was added inline using the prepFAST system and consisted of 1 ng/mL of a mixed element solution containing Bi, In, 6Li, Sc, Tb, Y (IV-ICPMS-71D from Inorganic Ventures). Each sample was acquired using 1 survey run (10 sweeps) and 3 main (peak jumping) runs (40 sweeps). Instrument performance is optimized daily through autotuning followed by verification via a performance report (passing manufacturer specifications). The results were normalized to total protein in each sample was determined by the Pierce BCA Protein Assay Kit (Thermo Scientific 23227).

Desferal does not affect hydrogen peroxide or LL-37 killing in the piliated parent strain.

Relative survival of the FA1090 parent strain N-1-60 to hydrogen peroxide or LL-37 after desferal treatment was determined. The lines indicate the paired samples. The average relative survival of the parent to hydrogen peroxide was 0.0059 with 10 mM desferal and 0.0059 without desferal. The average relative survival of the parent to LL-37 was 0.033 with 10 mM desferal and 0.045 without desferal.

(TIF)

Click here for additional data file.

The effect of various metals on desferal-mediated rescue of pilE mutant from streptonigrin killing.

The pilE mutant was treated with either desferal alone or desferal mixed with various concentrations of FeCl3, n = 3 (A), MgCl2, n = 3 (B), ZnCl2 n = 3 (C), or MnCl2 n = 3 (D) before streptonigrin killing. Relative survival was determined by calculating the ratio of streptonigrin resistant colonies to the total number of cells in the reaction. The averages and the standard error of the mean are shown.

(TIF)

Click here for additional data file.

Transformation efficiency of IPTG-regulatable pilE strain.

The transformation efficiency of the FA1090 strain carrying an IPTG inducible pilE was determined using pSY6, a plasmid that carries a gyrA point mutation. The number of nalidixic acid-resistant colonies was compared to the total number of colonies in four biological replicates. The average and standard error are shown.

(TIF)

Click here for additional data file.

The antioxidants DMTU and tiron do not affect sensitivity to LL-37 in a pilE mutant.

The effect of DMTU (A, n = 3) and tiron (B, n = 4) on LL-37 sensitivity in the pilE mutant. The mean and standard error of the mean are plotted and analyzed by Wilcoxon matched-pairs signed-rank test but are not statistically significant.

(TIF)

Click here for additional data file.

8 Dec 2021

Dear Professor Seifert,

Thank you very much for submitting your manuscript "The Neisseria gonorrhoeae type IV pilus promotes resistance to hydrogen peroxide- and LL-37-mediated killing by modulating the availability of intracellular, labile iron" for consideration at PLOS Pathogens. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

The reviewers acknowledged the quality of this work. But they also pointed out that: (i) no clear mechanism is identified as to how pili alter iron homeostasis and (ii) the results could be discussed further. I also encourage the authors to pay particular attention to points 14 and 15 of reviewer #1.

These points should be addressed before resubmission.

I apologize for the duration of the review process, which was necessary to produce an effective evaluation of this work.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Mathieu Coureuil

Guest Editor

PLOS Pathogens

Xavier Nassif

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************

The reviewers acknowledged the quality of this work. But they also pointed out that: (i) no clear mechanism is identified as to how pili alter iron homeostasis and (ii) the results could be discussed further. I also encourage the authors to pay particular attention to points 14 and 15 of reviewer #1.

These points should be addressed before resubmission.

I apologize for the duration of the review process, which was necessary to produce an effective evaluation of this work.

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: The manuscript by Hu et al addresses the mechanism as to why piliated cells of N. gonorrhoeae are more resistant to oxidative killing by hydrogen peroxide and to killing by the antimicrobial peptide LL-37. The manuscript builds on previous results of the authors showing that: i) the metalloprotease MPG (NGO1686) is highly expressed in response to sublethal levels of hydrogen peroxide, ii) MPG is required for full piliation of gonococcal strains and the latter is required for resistance to hydrogen peroxide and LL-37 killing. N. gonorrhoeae is provided with multiple genetic mechanisms to resist oxidative damage. This mechanistic redundancy highlights the importance of resistance to oxidative killing for pathogenesis. However, very often the mechanism by which these gene products afford resistance to oxidative damage is unknown. Base on this, the theme of the paper is highly relevant in the context of gonococcal pathogenesis. However, there are some problems, which can be addressed editorially, in the way data is presented and the conclusions drawn from the results (see below). This reviewer believes that although evidence is presented to suggest that the way full piliation protects cells from hydrogen peroxide oxidative damage is by restricting the intracellular pool of labile iron, an additional experiment is required to fully validate the evidence as conclusive (see point 14 below).

Reviewer #2: Hu Linda I. et al is a manuscript supporting evidence that the piliation state affects iron homeostasis in N. gonorrhoeae and influences the sensitivity to various antimicrobial agents, including hydrogen peroxide and the antimicrobial peptide LL-37. The topic is of interest to the field and is well done; The manuscript is excellent written, methods are robust and contain appropriate controls.

Reviewer #3: This report investigates the interesting observation that gonococcal pili protect against ROS and CAMPs by showing that there is a pilus-dependent effect on iron homeostasis. This is an interesting aspect of bacterial pathogenesis that is not well-explored and the data broaden the importance of the multi-functional type 4 pili in N. gonorrhoeae (Ng)

Strengths of the manuscript include the straightforward description of experiments and the way the data are clearly shown in the figures. The authors also test numerous mutants to explore their hypothesis. The results show that the process is likely multi- factorial, which makes defining the mechanism more difficult. This manuscript could be improved in terms of impact, however, if the authors at least provided a model that shows all the factors that might be involved and discussed each possible factor in more detail.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: Major editorial changes required:

1. In figure 1C and D the pilE mutant should be presented side-by-side with the wild type, so that one can compare the magnitude by which desferal rescue survival in the mutant and the wild type. Given that hydrogen peroxide requires iron in order to kill cells, addition of an iron chelator (desferal) is expected to protect any type of cell; therefore, the problem here is that without comparing the magnitude of protection between mutant and wild type one cannot conclude whether sensitivity of the mutant is due to iron content.

2. Similar to point 1 above, in figure 2B the side-by-side comparison with the wild type is not presented. In fact, in line 169 the authors discuss the result of desferal and streptonigrin treatment on the wild type strain, but I could not find the result..

3. In figure 2C the addition of extra iron seems to increase survival to streptonigrin in the absence of desferal (results discussed in text in line 179-181), while extra iron in the presence of desferal lowered survival (expected). This result seemingly contradicts the logic of figure 2B in which desferal protects mutant cells from streptonigrin killing. The author should explain why extra iron in the absence of desferal seems to increase survival. Perhaps statistical comparisons between the ±iron without desferal conditions and ±iron with desferal conditions are required to understand the significance of this result.

4. The result describing the survival in the presence of other metals as presented in line 182 is not represented anywhere. PloS Pathogens does not allow “Data not shown”; hence, the authors should show the results in a supplemental figure.

5. The authors do not explain why the survival ratio (approx. 6E-4 in Fig.3) of the IPTG-inducible pilE mutant without IPTG seems to be significantly lower than the pilE mutant strain (N-1-69) in figure 2B. Perhaps the authors should present results from both strains in the same graph, or comment about this difference.

6. I may have missed it, but in line 218 the authors present figure 3B which is not in the manuscript.

7. In figure 4 the authors did not find any statistical differences among different mutations with the isogenic wild type in relation to streptonigrin resistance (lines 218-220); however, they concluded that there is a biological effect on the mutations. Thus, the importance of this finding is highly questionable.

8. In line 251, the authors state that the WT result is represented in figure 6, but it is not. As in point 1 above, the WT should be represented side- by-side with the pilE mutant to compare the magnitude of protection granted by the antioxidants against streptonigrin.

9. The result for the total iron content described in line 269 is not represented anywhere.

10. In line 286-287 author discuss the effect of other ROS scavengers, but the result is not presented. Again, the data should be shown in a supplemental figure.

11. In lines 297-299 the explanation about the higher iron influx, which can fuel the Fenton reaction (and the consequent production of hydroxyl radicals and oxidative damage) in the pilE mutant seems to contradict the discussed result of figure S2 in which LL37 killing is not affected by addition of antioxidants.

12. In line 332 the authors suggest that “desferal could only access labile iron pool”. Do the authors know for sure that desferal can penetrate gonococci? If the authors have a reference in which it is shown that desferal makes it through the cell membrane, they should add it to the text.

13. The authors should consider a summary figure that highlights the proposed mechanism of HP and LL-37 resistance with respect to pili and labile iron.

Major technical concerns:

14. The authors did not find any difference in total iron content by ICP-MS. Perhaps the difference between wild type and pilE mutant cells is where the iron is stored. If pilus bundles have some iron-chelation properties, then the wild type strain would accumulate iron at the cell surface or perhaps in the periplasm while the mutant would transport it directly into the cells. Have the authors considered performing the ICP-MS assay from gonococcal spheroplasts? Another alternative is to measure directly labile iron content using the colorimetric unified-ferene (u-ferene) assay, reported elsewhere. These experiments would help in supporting the conclusion that the way full piliation protect cells from hydrogen peroxide killing is by restricting the intracellular pool of labile iron.

15. Pyruvate can be a scavenger of toxic radicals produced by the Fenton reaction. Thus, the authors should consider testing the susceptibility of gonococci to HP and LL-37 when grown in pyruvate or by including pyruvate in the killing assays.

Reviewer #2: Additional experiments required:

- Figure 5: the authors should show data from three independent experiments for FA19.

Reviewer #3: Only one experiment is suggested (see below); the main issue is a need to at least help the reader visualize how the many factors hypothesized to play a role, based on the mutant testing, may do so, in absence of one or two easily tested mechanisms.

The authors should be commended for testing such a large number of mutants to explore their hypothesis. Results from the testing of pilus biogenesis genes and the complementation data with an inducible pilE gene support the hypothesis that the presence or assembled pili modulates intracellular iron. The conclusion that the effect of pili on streptonigrin killing is multifactorial also appears likely based on mutant data; however, more discussion of how these different is needed. For example, the results with the penicillin-binding protein mutants are interesting but more discussion would help the reader visualize what might be going on at the level of cell wall integrity or whatever the authors are thinking. No mention of the mpg gene is made after the introduction, and since Mpg also can affect PG, a more detailed discussion of the role of these three genes (dacB, dacC and mpG) in PG biosynthesis and/or degradation, and how their loss might lead to changes in iron homeostasis would increase the value of the data.

Perhaps one possible mechanism could be tested: The authors state “Based on all the data presented, we propose that the differential sensitivity to streptonigrin, hydrogen peroxide, and LL-37 is due to piliation reducing the intracellular labile iron pool. This would be a possible explanation if piliation modulates iron import and, in the absence of the pilus, iron influx is uninhibited, leading to differential killing in the pilE mutant”. The authors showed that nonpiliated Ng do not have increased membrane permeability. Can the hypothesis that piliation modulates iron import be tested?

The authors mention pilin-dependent iron homeostasis (line 311). Some discussion about what is known about iron homeostasis in Ng is needed. Is there a known homeostasis system? Are there transcriptional regulators that alter this process? Is it known how ferrous iron enters the cell?

Numerous possibilities are listed in the discussion on page 17 as to how pilin or pilus may protect against ROS and elsewhere, how pili may directly or indirectly influence intracellular labile iron stores. A figure showing a model of all the possible forces that might lead to increased intracellular iron in nonpiliated Ng [– all of which are listed within the text in the discussion section (~lines 302 – 329)] - would help the reader think more about different mechanisms that contribute to this process (i.e. transcriptional networks (i.e. published data that are mentioned in the text), cell wall changes, direct or indirect of pilin on the electron transport chain (can this be tested?), efflux differences)

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: 1. Line 101 correct “predominantly”

2. Line 373 describe the concentration unit of glutamine

3. Line 373 double check concentration of Fe(NO3)3 in GC broth. In our GC broth recipe is 12.3 µM the final concentration.

4. Line 126 it should be panel D not C

5. The syntax of sentence in line 132 is hard to understand

6. Line 212 delete “for”

7. Improve sentence writing in line 213. It is not easy to read

8. Declare what the acronym of “ROS” stands for

9. Line 245 add “the” after “through”

10. Line 250 change “then” to “when”

11. Line 292 change “with” to “by”

12. Please clarify if N-1-60 is isogenic to FA1090.

Reviewer #2: General comment:

I would like to recommend to the authors to shorten the introduction and to focus better on the subject, which is dealt with in the manuscript. For example, the paragraph beginning at line 44 "N. gonorrhoeae primarily..." until line 54 could be deleted in its entirety.

Minor comments:

- Page 6, line 91 and throughout the whole manuscript (e.g. line 198): type IV pili should be used consistently throughout the document or abbreviated

- Figure 2: the authors should name the concentration of DMSO used or mention it in the material and methods section

- Figure 4: have the authors characterized the piliation status of the different mutants phenotypically (Immunoblotting, dot blot, EM)?

- Paragraph: Total iron content is unaffected by piliation : the authors mention that the parental strain and the pilE mutant showed no significant difference in total iron . data should be shown if possible (for example as Suppl figure S3)

Reviewer #3: Minor corrections

Page 4 “In men, infections can cause inflammation of the epididymis or epididymitis”. As written it sounds like epididymitis is a different condition than inflammation of the epididymis.

Page 4: “These local gonococcal infections can also enter the bloodstream to develop disseminated gonococcal infection” The word “local” should be changed to “localized” or “mucosal”. Ascending infections (upper reproductive tract, male or female) aren’t actually considered localized (they are “locally disseminated” infections that can involve 2-3 organs, and so “mucosal” is the best adjective.

Page 5 “Even in the presence of a bactericidal oxidative response when N. gonorrhoeae expressing outer membrane opacity (Opa) proteins variants can engage specific receptors on PMNs [25]… “This is a complicated sentence that may lose the reader who is not familiar with Ng Opa proteins/CEACAMS on neutrophils, etc.

Page 8 Vibrio cholera should be Vibrio cholerae

Page 34 “… determined using pSY6, a plasmid that carries a gyrA point mutant” - mutant should be mutation.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, . PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at .

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here on PLOS Biology: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

21 Mar 2022

Submitted filename: Response to reviewers.docx

Click here for additional data file.

29 Apr 2022

Dear Hank,

We are pleased to inform you that your manuscript 'The Neisseria gonorrhoeae type IV pilus promotes resistance to hydrogen peroxide- and LL-37-mediated killing by modulating the availability of intracellular, labile iron' has been provisionally accepted for publication in PLOS Pathogens.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Mathieu Coureuil

Guest Editor

PLOS Pathogens

Xavier Nassif

Section Editor

PLOS Pathogens

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

***********************************************************

Reviewer Comments (if any, and for reference):

Reviewer's Responses to Questions

Part I - Summary

Please use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.

Reviewer #1: The authors have responded to my previous concerns and modified their paper accordingly. Critically, they now propose a model, which will require additional experiments in the future io test. While I am satisfied with the revisions and find the paper to be of high quality, I would like to suggest a mechanism that involves transcriptional control of the mtrCDE efflux pump and availability of free iron. In this respect, evidence has been presented that Fur+Fe regulates the level of the MpeR repressor. MpeR represses expession of mtrR, which encodes a repressor of the mtrCDE efflux pump operon, and this could result in increased levels of the MtrCDE efflux pump thereby impacting levels of LL-37 susceptibility.

Reviewer #2: The manuscript is excellently written, the topic is of interest to the field, and the experiments are well done; the methods used are robust and include adequate controls.

All objections and criticisms noted have been addressed to my complete satisfaction.

Reviewer #3: This manuscript by Hu et al. is a follow-up on the previous observation reported by this group that piliation protects Neisseria gonorrhoeae (Ng) from H2O2, cathelicidins, and non-oxidative PMN killing. This work has several merits including further investigation of this finding, the results of which expand the impressive list of pilus-mediated functions in this pathogen.

Other strengths include the clear presentation of the data, the testing of metals in addition to iron, complementation of the pilE mutants, examination of intracellular iron pools, and the demonstration that the resistance to both ROS and CAMPs afforded by piliation is iron-dependent, but ROS are not involved in the latter. The authors conscientiously responded to the reviewers’ critiques including the addition of Figure 5 to provide a model for the reader to put this all together, which was a good suggestion by the reviewers and helps round out the manuscript.

**********

Part II – Major Issues: Key Experiments Required for Acceptance

Please use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.

Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".

Reviewer #1: None

Reviewer #2: no further objections

Reviewer #3: None

**********

Part III – Minor Issues: Editorial and Data Presentation Modifications

Please use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.

Reviewer #1: None

Reviewer #2: no further objections

Reviewer #3: One minor correction: Lines 47-49 – should read: In women, infection spreads from the cervix to other areas of the reproductive tract to cause pelvic inflammatory disease (the cervix is the primary site of infection, not the vagina; Ng is not a vaginal pathogen in women of reproductive age)

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

13 Jun 2022

Dear Professor Seifert,

We are delighted to inform you that your manuscript, "The Neisseria gonorrhoeae type IV pilus promotes resistance to hydrogen peroxide- and LL-37-mediated killing by modulating the availability of intracellular, labile iron," has been formally accepted for publication in PLOS Pathogens.

We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.

Best regards,

Kasturi Haldar

Editor-in-Chief

PLOS Pathogens

​orcid.org/0000-0001-5065-158X

Michael Malim

Editor-in-Chief

PLOS Pathogens

orcid.org/0000-0002-7699-2064

Table 1

Antibiotic sensitivity of the piliated parent and a pilE mutant.

Antibiotic	Ampicillin	Polymyxin B	Tetracycline	Naladixic acid	Rifampicin
Target	Cell wall	Cell wall	Translation	DNA replication	Transcription
Parent	0.13	48–64	0.13	0.50	0.02
ΔpilE	0.125–0.19	64.00	0.125–0.19	0.50	0.02

The minimum inhibitory concentrations ranges from various antimicrobials on three biological replicates of the parental strain (N-1-60) and the pilE mutant (N-1-69) using Etest strips (μg/ml).