Shintaro Mikami1, Yoko Miura2, Shinji Kondo3, Kosuke Sakai1, Hiroaki Nishimura1, Hiroyuki Kyoyama1, Gaku Moriyama1, Nobuyuki Koyama1, Hideki Noguchi3, Hirotsugu Ohkubo4, Satoshi Kanazawa2, Kazutsugu Uematsu1. 1. Department of Pulmonary Medicine, Saitama Medical Center, Saitama Medical University, Kawagoe, Saitama, Japan. 2. Department of Neurodevelopmental Disorder Genetics, Nagoya City University Graduate School of Medical Sciences, Nagoya, Aichi, Japan. 3. Center for Genome Informatics, Joint Support Center for Data Science Research, Research Organization of Information and Systems, Mishima, Shizuoka, Japan. 4. Department of Respiratory Medicine, Allergy and Clinical Immunology, Nagoya City University Graduate School of Medical Sciences, Nagoya, Aichi, Japan.
Abstract
Nintedanib is a multi-tyrosine kinase inhibitor widely used to treat progressive fibrosing interstitial lung diseases because it slows the reduction in forced vital capacity. However, the prognosis for patients treated with nintedanib remains poor. To improve nintedanib treatment, we examined the effects of nintedanib on gene expression in the lungs of induced-rheumatoid arthritis-associated interstitial lung disease model mice, which develop rheumatoid arthritis and subsequent pulmonary fibrosis. Using next-generation sequencing, we identified 27 upregulated and 130 downregulated genes in the lungs of these mice after treatment with nintedanib. The differentially expressed genes included mucin 5B and heat shock protein 70 family genes, which are related to interstitial lung diseases, as well as genes associated with extracellular components, particularly the myocardial architecture, suggesting unanticipated effects of nintedanib. Of the genes upregulated in the nintedanib-treated lung, expression of regulatory factor X2, which is suspected to be involved in cilia movement, and bone morphogenetic protein receptor type 2, which is involved in the pathology of pulmonary hypertension, was detected by immunohistochemistry and RNA in situ hybridization in peripheral airway epithelium and alveolar cells. Thus, the present findings indicate a set of genes whose expression alteration potentially underlies the effects of nintedanib on pulmonary fibrosis. It is expected that these findings will contribute to the development of improved nintedanib strategies for the treatment of progressive fibrosing interstitial lung diseases.
Nintedanib is a multi-tyrosine kinase inhibitor widely used to treat progressive fibrosing interstitial lung diseases because it slows the reduction in forced vital capacity. However, the prognosis for patients treated with nintedanib remains poor. To improve nintedanib treatment, we examined the effects of nintedanib on gene expression in the lungs of induced-rheumatoid arthritis-associated interstitial lung disease model mice, which develop rheumatoid arthritis and subsequent pulmonary fibrosis. Using next-generation sequencing, we identified 27 upregulated and 130 downregulated genes in the lungs of these mice after treatment with nintedanib. The differentially expressed genes included mucin 5B and heat shock protein 70 family genes, which are related to interstitial lung diseases, as well as genes associated with extracellular components, particularly the myocardial architecture, suggesting unanticipated effects of nintedanib. Of the genes upregulated in the nintedanib-treated lung, expression of regulatory factor X2, which is suspected to be involved in cilia movement, and bone morphogenetic protein receptor type 2, which is involved in the pathology of pulmonary hypertension, was detected by immunohistochemistry and RNA in situ hybridization in peripheral airway epithelium and alveolar cells. Thus, the present findings indicate a set of genes whose expression alteration potentially underlies the effects of nintedanib on pulmonary fibrosis. It is expected that these findings will contribute to the development of improved nintedanib strategies for the treatment of progressive fibrosing interstitial lung diseases.
Interstitial lung diseases are a large group of mostly progressive diseases of known or unknown causes that are characterized by chronic inflammation and fibrosis of the pulmonary interstitium. Chronic interstitial lung diseases, including idiopathic interstitial pneumonias originating from an unknown etiology and collagen vascular diseases, mostly lead to irreversible fibrotic lesions and a very poor prognosis. Although the mean survival time is 3–5 years in patients with idiopathic pulmonary fibrosis, it varies greatly among patients, making accurate assessments of prognosis difficult [1]. Although attempts to identify the causes of interstitial lung disease have been made, the pathobiological mechanisms remain elusive, leading to a range of treatment approaches. Antifibrotic drugs, nintedanib and pirfenidone, are expected to improve prognosis, and evidence has accumulated regarding their treatment efficacy in patients with interstitial lung diseases; however, in clinical practice, their efficacies vary greatly and adverse events often inhibit their treatment [2, 3].Nintedanib is a multi-tyrosine kinase inhibitor that targets platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR), and fibroblast growth factor receptor (FGFR), and it is used clinically to slow the decrease of forced vital capacity in patients with idiopathic pulmonary fibrosis as well as in systemic scleroderma [4]. Similar effects have been reported in patients with progressive fibrosing interstitial lung disease of various origins [5]. Although the indications for nintedanib have been extended, its cost-effectiveness and frequent induction of adverse events hinder its clinical use. Thus, a better understanding of the mechanisms regulating the efficacy of and adverse events related to nintedanib treatment is needed. Anticipating that alteration of gene expression in the nintedanib-treated lung provides a clue to elucidate mechanisms regulating efficacy and adverse events of nintedanib treatment, we performed a comprehensive analysis of gene expression in the nintedanib-treated lung of a mouse model with interstitial pneumonia to identify predictors of treatment response or adverse events associated with nintedanib. Genome-wide association study is an important means of examining the relationship between gene expression and pathogenesis, and it has been used to elucidate the genetic mechanisms underlying many diseases, including idiopathic interstitial pneumonia [6]. Peyser et al. used single-cell sequencing and a bleomycin-induced pulmonary fibrosis model to characterize molecular response to fibrotic injury [7]. In that study, treatment of nintedanib reduced the bleomycin-induced cluster shift of fibroblasts to the extracellular matrix-enriched cluster, and no specific upregulation of gene expression was observed in pulmonary fibrosis lesion cells. A tissue-based sequencing approach has yet to be used to examine the gene expression alterations in nintedanib-treated lung.Several mouse models, in which interstitial pneumonia was mostly induced by bleomycin administration via the respiratory tract, have already been used to validate the efficacy of nintedanib, including one with rheumatoid arthritis–associated lung fibrosis, in which nintedanib was found to reduce collagen levels in the lungs [8, 9]. The D1CC×D1BC mouse is a double-homozygous transgenic mouse carrying human class II major histocompatibility complex transactivator and the murine B7.1 gene under the control of the type II collagen promoter and enhancer [10, 11]. Immunization of these mice with bovine type II collagen induces rheumatoid arthritis and subsequent pulmonary fibrosis in this mouse model, thereby named the induced-rheumatoid arthritis–associated interstitial lung disease (iRA-ILD) model. Histopathological and biochemical analyses have shown that these mice develop nonspecific interstitial pneumonia pattern represented by lung inflammation [12].Here, we examined gene expression in the nintedanib-treated lung of iRA-ILD mice. We identified 27 upregulated and 130 downregulated genes in the nintedanib-treated lung and conducted functional analyses of the identified genes to elucidate their potential roles in the activity of nintedanib and the induction of adverse events. We also examined the tissue expressions of several of the identified genes. The present findings are expected to be useful for the development of predictors of treatment response or adverse events associated with nintedanib.
Materials and methods
Mice and treatment schedule
All mouse experiments were performed according to the rules and regulations of the Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science and Technology, Japan, and were approved by the Committee on the Ethics of Animal Experiments of Nagoya City University. D1CC×D1BC mice (8–12 weeks after birth and no distinction between male and female) were anesthetized with isoflurane and then immunized with 0.01 mg/mouse of bovine type II collagen (Collagen Research Center, Japan) and an equal dose of complete Freund’s adjuvant (Becton, Dickinson and Company, NJ, USA) [10, 11]. The immunization time point was set at week 0, and bovine type II collagen booster injections containing incomplete Freund’s adjuvant (Becton, Dickinson, and Company) were administered at weeks 3, 6, 9, and 12. The mice were then divided into two groups: nintedanib- and vehicle-treated. Nintedanib, supplied by Boehringer Ingelheim (Germany), was dissolved in 0.5% methylcellulose (Wako, Japan) and orally administered at a daily dose of 90 mg/kg from weeks 35 to 43. Blood was collected from the jugular vein for measurement of serum surfactant protein D (SP-D) levels (Yamasa, Japan). For assessment of fibrosis, the right lobe of the lung was used for the histopathological analysis, while the left lobe was used for gene expression analysis by RNA sequencing. Lungs were fixed in 4% paraformaldehyde, and 2-μm-thick paraffin sections were stained with hematoxylin and eosin and Masson’s trichrome. Images showing the area of fibrosis represented in blue by Masson’s trichrome staining were captured using a BZ-X analyzer (Keyence, Japan) and analyzed using ImageJ, Fiji. Data were calculated as blue ratio, with blue-stained area divided by total lung area [13]. All animal procedures, including those on D1CC×D1BC mice for in-house breeding, have been approved by the Laboratory Animal Facility of Nagoya City University.
RNA sequencing and expression profiling
For RNA extraction, samples of around 2–3 mm3 were cut from the periphery of the frozen lungs of 3 vehicle-treated, 5 nintedanib-treated, 1 non-treated mouse, and 4 age-matched D1CC×D1BC mice, and each tissue sample was numbered. Total RNA was isolated by using an RNeasy Plus Mini Kit (Qiagen, Germany), and the integrity and purity of the total RNA were assessed by using an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA) and a Qubit Fluorometer (Thermo Fisher Scientific). A library for RNA sequencing was prepared by using a TruSeq Stranded mRNA Preparation Kit (Illumina, CA, USA). Single reads (151 bp in length) were generated by using a MiSeq sequencer (Illumina). The reads were aligned to the mouse genome (mm10) by using TopHat [14], and computation of expression levels of annotated genes (Ensembl version 84) [15] and identification of differentially expressed genes were performed by using Cuffdiff [16]. All computational work was performed by using the DNA Data Bank of Japan supercomputer system [17].
Database analyses
Functional enrichment analysis was performed within the platform of the Database for Annotation, Visualization and Integrated Discovery (DAVID) by using categories related to biological processes, cellular components, and molecular functions [18, 19]. The default value of 0.1 was used as the significance threshold in the expression analysis systematic explorer protocol. Pathway analyses were also conducted using the Kyoto Encyclopedia of Genes and Genomes and WikiPathways (http://www.wikipathways.org/index.php/WikiPathways). Each pathway was assigned a p-value, and a value of < 0.05 was considered to be statistically significant.
Quantitative reverse transcription and polymerase chain reaction (RT-qPCR)
Total RNA was extracted from the lungs as described above. cDNA was synthesized by using PrimeScript Master Mix (Perfect Real Time, Takara Bio, Japan) and amplified. Gene expression levels were compared by using an intercalator method with TB Green Premix Ex Taq II (Takara Bio) on an Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). A calibration curve was constructed for comparative quantification, and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) expression was used for normalization. Primer sets with the following sequences were purchased from Takara Bio (forward, reverse): regulatory factor X2 (Rfx2), GCCAGCATCACCAGCAGTACA and TCACAGTGCCTGCGATACACC; bone morphogenetic protein receptor type 2 (Bmpr2), CCATCTGAGACCTTGCTATGCTGTA and AATGTCAGCGTTCATAGTGGCATC; and Gapdh, TGTGTCCGTCGTGGATCTGA and TTGCTGTTGAAGTCGCAGGAG. RT-qPCR expression levels were compared by using Dunnett’s multiple comparison test among the age-matched control, vehicle-treated, and nintedanib-treated groups. Statistical analysis was performed using the EZR software (Saitama Medical Center, Jichi Medical School, Japan), and the significance level was set at p < 0.05 [20].
Western blotting
Lung samples were homogenized in RIPA buffer containing 20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% Triton-X100, 0.5% deoxycholate sodium, 0.1% sodium dodecyl sulfate, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM NaF, 1 mM Na3VO4, and protease inhibitor cocktail. The extracts were sonicated for 10 min and centrifuged at 13,000 × g for 15 min. Western blotting analysis was performed using an ECL system [13]. The following primary antibodies were used: mouse anti–BMPR2 (#GTX60415; GeneTex, CA, USA; 1:1000 dilution), rabbit anti-RFX2 (#12622-1-AP; Proteintech, IL, USA; 1:500 dilution), and mouse anti-α Tubulin (SC-8035; Santa Cruz Biotechnology, Tx, USA; 1:1000 dilution). Signals were detected using Immunostar Zeta (Fuji film, Japan) and an Amersham Imager 600 series imager (GE Healthcare, IL, USA). Statistical analyses of protein expression levels were performed using Fiji.
Immunostaining
For multiplex staining of RFX2 in lung tissue, 2-μm-thick paraffin sections of lungs were reacted with the following primary antibodies: rabbit anti–E-cadherin (#3195, Cell Signaling Technology, MA, USA), rabbit anti–SP-C (#HP9050, Hycult Biotech, Netherlands), and rabbit anti-RFX2 (#12622-1-AP, Proteintech). For detection, Histofine Simple Stain Mouse MAX-PO secondary antibody (Nichirei, Japan) was used with an Opal multiplex fluorescent immunohistochemistry system (Akoya Biosciences, MA, USA) that included Opal 520, Opal 570, Opal 650, 1× amplification diluent, and AR6 buffer. For immunohistochemistry of BMPR2, de-paraffinized sections were stained with mouse anti-BMPR2 (#GTX60415, GeneTex), and the substrate solution was reacted with Histofine SAB-PO (M) Kit (Nichirei, Japan). For contrast staining, hematoxylin solution TypeM, (Mutoh Chemical Industry, Japan) was used. Images of stained tissues were recorded with a BZ-X710 fluorescence microscope.
In situ hybridization
In situ hybridization for secretoglobin family 1A member 1 (Scgb1a1) (#420351, ACD Bio, MI, USA), surfactant protein C (Sftpc) (#314101-C2), Bmpr2 (#493061), and Rfx2 (#1073021) transcripts was performed by using an RNAscope Multiplex Fluorescent Reagent Kit v2 (ACDBio).
Results
Effects of nintedanib on pulmonary fibrosis and gene expression
First, we examined the effects of nintedanib on pulmonary fibrosis and gene expression in iRA-ILD mice. Histological examination revealed that nintedanib treatment alleviated destruction of the alveolar architecture (Fig 1A: hematoxylin and eosin staining) and reduced the density of fibrotic regions (Fig 1B: Masson’s trichrome staining), which is consistent with a previous report [12]. Next, using Masson staining blue ratio as an index of the level of fibrosis, we plotted the relationship between Masson stain blue ratio and serum SP-D level for 3 vehicle-treated (VA–VC) and 5 nintedanib-treated (NA–NE) iRA-ILD mice. This plot revealed a cluster of three of the nintedanib-treated mice (NA, NB, and NC) that was located far from the two vehicle-treated mice (VA and VB) (Fig 1C). Subsequent RNA sequencing revealed 16,263 genes (Ensembl version 84) that were expressed at ≥1 FKPM (fragments per kilobase of transcript per million of mapped reads) in 3 or more of the 26 datasets examined (2–4 replicates derived from 5 nintedanib- and 3 vehicle-treated individuals, and 1 non-treated individual) and confirmed the presence of two major clusters: one comprising mice NA, NB, and NC, and one comprising mice VA and VB (Fig 1D). Because mice ND, NE, and VC were not included in these two major clusters, we excluded those datasets from the following differential gene expression analysis.
Fig 1
Effects of nintedanib on gene expression in the lung of induced-rheumatoid arthritis–associated interstitial lung disease model mice.
(A, B) Histology of vehicle- and nintedanib-treated lung. (C) Relationship between surfactant protein D (SP-D) and Masson stain blue ratio as a measure of the progression of pulmonary fibrosis in nintedanib-treated (NA, NB, NC, ND, and NE) and vehicle-treated (VA, VB, and VC) mice. (D) Gene expression profile clustering for the 26 datasets derived from 5 nintedanib-treated, 3 vehicle-treated, and 1 non-treated (HC) mice. Two major clusters were confirmed: one comprising nintedanib-treated mice, NA, NB, and NC, and another comprising vehicle-treated mice, VA and VB. Because mice ND, NE, and VC were not included in these clusters, they were excluded from the following analysis. (E–G) Volcano plots of genes differentially expressed between nintedanib- and vehicle-treated mice. Genes with q-value < 0.05 were considered significantly up- (red dots) or downregulated (blue crosses). (E) Comparison between the two major clusters observed among the nintedanib- and vehicle-treated mice. (F, G) Comparison between the mouse (NC) with the smallest Masson stain blue ratio as an index of progression of pulmonary fibrosis among the nintedanib-treated cluster and each of the vehicle-treated mice (VA and VB). The heatmap and volcano plots were drawn with the regHeatmap and plot programs in R, respectively (R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2014).
Effects of nintedanib on gene expression in the lung of induced-rheumatoid arthritis–associated interstitial lung disease model mice.
(A, B) Histology of vehicle- and nintedanib-treated lung. (C) Relationship between surfactant protein D (SP-D) and Masson stain blue ratio as a measure of the progression of pulmonary fibrosis in nintedanib-treated (NA, NB, NC, ND, and NE) and vehicle-treated (VA, VB, and VC) mice. (D) Gene expression profile clustering for the 26 datasets derived from 5 nintedanib-treated, 3 vehicle-treated, and 1 non-treated (HC) mice. Two major clusters were confirmed: one comprising nintedanib-treated mice, NA, NB, and NC, and another comprising vehicle-treated mice, VA and VB. Because mice ND, NE, and VC were not included in these clusters, they were excluded from the following analysis. (E–G) Volcano plots of genes differentially expressed between nintedanib- and vehicle-treated mice. Genes with q-value < 0.05 were considered significantly up- (red dots) or downregulated (blue crosses). (E) Comparison between the two major clusters observed among the nintedanib- and vehicle-treated mice. (F, G) Comparison between the mouse (NC) with the smallest Masson stain blue ratio as an index of progression of pulmonary fibrosis among the nintedanib-treated cluster and each of the vehicle-treated mice (VA and VB). The heatmap and volcano plots were drawn with the regHeatmap and plot programs in R, respectively (R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2014).A volcano plot was constructed to visualize the differential gene expression between the two clusters of mice. The results revealed significantly different gene expression for 157 genes, 27 of which were upregulated and 130 of which were downregulated (q-value < 0.05 by Cuffdiff) (Fig 1E and Table 1). Volcano plots were also constructed to visualize the differential gene expression between the nintedanib-treated mouse with the smallest Masson stain blue ratio and each of two vehicle-treated mice (NC vs. VB, Fig 1F; and NC vs. VA, Fig 1G). Among the three combinations of mice, 3 common upregulated genes (Rfx2, Hspa1a, and Hspa1b) and 13 common downregulated genes (AC160982.1, Casq2, Fabp3-ps1, Hrc, Igkc, Igj, Myl3, Mb, Myl4, Myh6, Myom2, Tcap, and Tnnt2) were observed (Fig 2A and 2B).
Table 1
Genes with significantly different expression in the nintedanib-treated cluster (NA, NB, and NC) compared with that in the vehicle-treated cluster (VA and VB).
A, Upregulated genes
Gene
VA, VB FPKM
NA, NB, NC FPKM
Log2(fold change)
q-value
CXCR7
19.3151
33.6332
0.800158
0.00772067
CXCR2
18.2111
33.9321
0.897829
0.00772067
EGR1
70.688
133.5
0.917303
0.00772067
LYVE1
63.8211
128.547
1.0102
0.00772067
ZBTB16
1.43302
2.95718
1.04516
0.00772067
IL1B
31.2319
65.5559
1.06971
0.00772067
RFX2
11.8997
25.6924
1.11041
0.00772067
HSPA1B
2.45952
5.58818
1.184
0.00772067
WFDC17
115.445
267.074
1.21004
0.00772067
GPR182
10.9326
26.776
1.29231
0.00772067
OLFM2
6.69372
17.313
1.37098
0.00772067
SLURP1
31.4862
82.9056
1.39675
0.00772067
CEBPD
45.0448
79.6934
0.823101
0.0143384
BMPR2
16.2579
27.6254
0.764857
0.0200737
GM12715
24.529
41.93
0.773497
0.0200737
MSLN
35.8908
65.1855
0.860937
0.0200737
LRRN4
8.08446
14.8763
0.879788
0.0200737
CD33
3.90997
8.31561
1.08867
0.0200737
GM6091
0
9.50101
infinity
0.0200737
UPK3B
55.6659
94.6203
0.765355
0.0245176
HSPA1A
2.12857
4.4776
1.07284
0.0245176
THBS1
18.9632
31.0342
0.710657
0.0329979
BNC1
1.44643
3.0144
1.05937
0.0329979
DOC2B
0.354321
0.937176
1.40326
0.042824
HAS1
1.03694
2.93801
1.50251
0.046029
GM11966
0
60.9628
infinity
0.046029
GM9836
0
1.13249
infinity
0.046029
B, Downregulated genes
BPIFA1
1245.85
3.26086
−8.57766
0.00772067
SCGB3A1
2932.79
17.298
−7.40553
0.00772067
CFD
91.4231
1.22822
−6.21792
0.00772067
CAR3
55.3028
0.891895
−5.95434
0.00772067
BPIFB1
84.6211
1.60889
−5.71688
0.00772067
HRC
1.50571
0.0755911
−4.31608
0.00772067
ATP6V1B1
3.31325
0.172118
−4.26677
0.00772067
SLN
138.152
8.84086
−3.96593
0.00772067
FABP4
74.8584
4.97829
−3.91044
0.00772067
LTF
27.6337
1.86417
−3.88982
0.00772067
DHRS7C
5.73937
0.415391
−3.78835
0.00772067
EEF1A2
7.31426
0.539155
−3.76194
0.00772067
MB
104.893
8.10969
−3.69313
0.00772067
IGKV5-39
100.39
7.95728
−3.65719
0.00772067
IGKV1-88
123.208
10.6068
−3.53803
0.00772067
CKM
16.6249
1.44354
−3.52567
0.00772067
HFE2
4.33859
0.381436
−3.50771
0.00772067
MYOM2
3.70856
0.356718
−3.378
0.00772067
TNNT2
15.1432
1.5366
−3.30086
0.00772067
SCN4B
1.21398
0.126167
−3.26634
0.00772067
MYPN
0.674664
0.0726609
−3.21492
0.00772067
CASQ2
14.6393
1.57942
−3.21238
0.00772067
SULT1D1
38.6526
4.20636
−3.19992
0.00772067
TNNI3
80.0224
8.80993
−3.1832
0.00772067
KCNJ3
0.867501
0.096145
−3.17358
0.00772067
PGAM2
14.2136
1.58361
−3.16598
0.00772067
MYLK4
2.39294
0.272587
−3.134
0.00772067
MYL3
42.6881
4.8646
−3.13344
0.00772067
LMOD2
3.11109
0.354867
−3.13207
0.00772067
TCAP
31.6657
3.62429
−3.12715
0.00772067
TBX20
1.10388
0.127134
−3.11816
0.00772067
MYOZ2
21.7692
2.52089
−3.11029
0.00772067
HAMP2
14.9551
1.74189
−3.10191
0.00772067
MAPK10
2.19094
0.263876
−3.05362
0.00772067
KCNJ5
2.48496
0.300424
−3.04815
0.00772067
MYL4
271.307
32.8382
−3.04648
0.00772067
MYBPHL
25.5662
3.12984
−3.03008
0.00772067
OBSCN
2.30883
0.283226
−3.02713
0.00772067
CSRP3
43.5866
5.47211
−2.99372
0.00772067
MYBPC3
3.13885
0.394985
−2.99036
0.00772067
IGKV8-21
64.8776
8.33437
−2.96058
0.00772067
MYL7
178.84
23.3513
−2.93709
0.00772067
MYH6
29.0568
3.83181
−2.92278
0.00772067
CIDEA
4.79633
0.637523
−2.91138
0.00772067
TRIM72
1.87988
0.250196
−2.90951
0.00772067
SRL
10.1022
1.38155
−2.87031
0.00772067
SLC17A7
1.55908
0.213957
−2.8653
0.00772067
LDB3
11.904
1.66065
−2.84162
0.00772067
APOBEC2
3.67632
0.536149
−2.77756
0.00772067
ACTN2
6.56642
0.978013
−2.74718
0.00772067
H19
11.7258
1.75799
−2.73769
0.00772067
FNDC5
4.28137
0.736442
−2.53943
0.00772067
IGJ
164.271
29.7197
−2.46658
0.00772067
AC160982.1
606.034
114.295
−2.40663
0.00772067
AC155333.4
49.2416
9.4281
−2.38484
0.00772067
TMC5
1.31172
0.252444
−2.37743
0.00772067
AC122260.1
160.319
31.3856
−2.35277
0.00772067
HPCAL4
3.76695
0.775159
−2.28083
0.00772067
FABP3-PS1
94.2604
19.6168
−2.26456
0.00772067
CMYA5
0.918198
0.193743
−2.24466
0.00772067
MUC5B
2.94309
0.645161
−2.1896
0.00772067
GRIP2
1.11467
0.247066
−2.17365
0.00772067
THRSP
10.3025
2.30766
−2.15849
0.00772067
ITGB1BP2
6.13918
1.3837
−2.14951
0.00772067
COX7A1
53.1048
12.5873
−2.07687
0.00772067
AC140374.1
138.69
33.0677
−2.06837
0.00772067
OIT1
3.62555
0.912052
−1.99101
0.00772067
RYR2
1.4109
0.358858
−1.97513
0.00772067
COX8B
38.9729
10.6796
−1.86761
0.00772067
SCARA5
2.39048
0.709311
−1.75281
0.00772067
MYLK3
2.88567
0.856285
−1.75275
0.00772067
IGKC
5168.26
1560.37
−1.72779
0.00772067
HSPB7
14.261
4.35892
−1.71003
0.00772067
CYP2E1
18.1495
5.5502
−1.70932
0.00772067
ANKRD1
33.0626
10.5035
−1.65433
0.00772067
RBM24
2.02133
0.694055
−1.54218
0.00772067
FSD2
1.96342
0.683569
−1.52221
0.00772067
LYPD2
142.763
51.703
−1.46531
0.00772067
CHRM2
3.70048
1.43571
−1.36595
0.00772067
IGHG2B
22.6271
8.9014
−1.34595
0.00772067
LUM
13.8944
5.54847
−1.32434
0.00772067
ACTC1
133.066
54.2248
−1.29512
0.00772067
CIDEC
15.2732
6.66569
−1.19618
0.00772067
RETNLA
198.488
90.59
−1.13163
0.00772067
PDK4
10.3249
4.71416
−1.13105
0.00772067
COX6A2
51.8812
24.7128
−1.06995
0.00772067
ATP2A2
95.2461
45.7116
−1.0591
0.00772067
IGHM
385.226
191.572
−1.00782
0.00772067
FABP1
37.7763
18.7869
−1.00776
0.00772067
IFI27L2A
1250.84
648.296
−0.948171
0.00772067
2010107E04RIK
556.286
318.941
−0.802537
0.00772067
KRT5
0.541073
0
-infinity
0.00772067
RETN
9.39548
0.462495
−4.34446
0.0143384
KBTBD10
1.85295
0.269106
−2.78358
0.0143384
2310042D19RIK
1.10467
0.181547
−2.6052
0.0143384
GM1078
2.02305
0.403901
−2.32446
0.0143384
IGLV1
98.2544
27.6526
−1.82911
0.0143384
SLC26A10
5.68793
1.92171
−1.56552
0.0143384
ASB2
6.83883
3.17949
−1.10496
0.0143384
CD300LG
5.39903
2.51853
−1.10012
0.0200737
CNN1
35.3961
18.9262
−0.903201
0.0200737
A2M
3.08174
0.0583869
−5.72196
0.0245176
TXLNB
1.59361
0.241102
−2.72458
0.0245176
BVES
1.90096
0.316698
−2.58554
0.0245176
CORIN
1.02572
0.25851
−1.98835
0.0245176
NRAP
1.23726
0.341576
−1.85687
0.0245176
AC174597.1
75.1934
25.2305
−1.57543
0.0245176
PPP1R1B
3.56163
1.49967
−1.2479
0.0245176
ADCYAP1R1
3.67297
1.6976
−1.11345
0.0245176
NEK2
3.46607
1.61758
−1.09947
0.0245176
TNNI3K
1.24423
0.124461
−3.32149
0.0293047
AC153855.1
42.1131
10.7539
−1.9694
0.0293047
AGR2
5.72943
1.51661
−1.91754
0.0293047
SLC25A34
0.607796
0.173024
−1.81261
0.0293047
BC048546
2.58243
1.1177
−1.2082
0.0293047
ENO3
23.9436
12.5342
−0.93377
0.0293047
SYNPO2L
0.877739
0.20124
−2.12488
0.0329979
PRDM8
1.13032
0.326858
−1.78999
0.0329979
ADH7
4.02313
1.56129
−1.36558
0.0329979
NTRK2
5.1035
2.47072
−1.04656
0.0329979
PIGR
15.7217
9.36853
−0.746866
0.0329979
AC113287.1
159.375
100.305
−0.668039
0.0329979
IGKV12-38
1.09571
0
-infinity
0.0329979
GDPD2
9.96178
4.43505
−1.16745
0.0377225
ART3
42.6334
19.5891
−1.12193
0.0377225
FLNC
1.98444
1.07624
−0.882733
0.0377225
SLC2A4
7.45498
2.18924
−1.76777
0.046029
CD34
79.9189
47.9767
−0.736204
0.046029
MT-RNR1
847.951
512.502
−0.726424
0.046029
ITIH4
22.3465
13.8304
−0.692204
0.046029
FPKM, fragments per kilobase of transcript per million of mapped reads.
Fig 2
Venn diagrams showing overlap of genes up- (A) and downregulated (B) by nintedanib treatment between three combinations of nintedanib- (NA, NB, and NC) and vehicle-treated mice (VA and VB). Yellow, comparison between the 3 nintedanib-treated and 2 vehicle-treated mice comprising the two major clusters observed in the gene expression analysis. Green and red, comparison between the nintedanib-treated mouse with the smallest Masson stain blue ratio as an index of progression of pulmonary fibrosis and each of the vehicle-treated mice. Among the combinations, 3 common upregulated genes and 13 common downregulated genes were observed.
Venn diagrams showing overlap of genes up- (A) and downregulated (B) by nintedanib treatment between three combinations of nintedanib- (NA, NB, and NC) and vehicle-treated mice (VA and VB). Yellow, comparison between the 3 nintedanib-treated and 2 vehicle-treated mice comprising the two major clusters observed in the gene expression analysis. Green and red, comparison between the nintedanib-treated mouse with the smallest Masson stain blue ratio as an index of progression of pulmonary fibrosis and each of the vehicle-treated mice. Among the combinations, 3 common upregulated genes and 13 common downregulated genes were observed.FPKM, fragments per kilobase of transcript per million of mapped reads.
Functional enrichment analysis and pathway analysis with DAVID
A functional enrichment analysis of 136 protein-coding genes from among the 157 up- or downregulated genes identified in the nintedanib-treated lungs was conducted within DAVID (Fig 3). The most significantly enriched terms were “system process” (47 genes) in the category “biological process”, “contractile fiber part” (26 genes) in the category “cellular component”, and “protein binding” (81 genes) in the category “molecular function”. Pathway analysis using the Kyoto Encyclopedia of Genes and Genomes revealed that “cardiac muscle contraction” was the most significantly enriched pathway (10 genes) (Table 2). In another pathway analysis tool, WikiPathways, “calcium regulation in the cardiac cell” had the highest number of six genes (Table 2). This marked representation of cardiac functions suggested an unknown effect of nintedanib on the cardiovascular system. We therefore examined the expression of Bmpr2, which is reported to be associated with pulmonary hypertension [21] and is included among the 27 genes that were found to be significantly upregulated in the lung of nintedanib-treated iRA-ILD mice (Table 1A).
Fig 3
Results of a functional enrichment analysis of genes differentially expressed between nintedanib- and vehicle-treated mice conducted within the Database for Annotation, Visualization, and Integrated Discovery (DAVID).
Functional enrichment was examined within the categories of (A) biological process, (B) cellular component, and (C) molecular function; p-values less than 0.05 were considered significant, and the number of genes annotated in each functional category is given.
Table 2
Results of pathway analyses using Kyoto Encyclopedia of Genes and Genomes pathway or WikiPathways.
Kyoto Encyclopedia of Genes and Genomes Pathway
Term
No. of genes
p-value
Cardiac muscle contraction
10
1.63E-09
Adrenergic signaling in cardiomyocytes
8
4.21E-05
Hypertrophic cardiomyopathy (HCM)
6
1.79E-04
Dilated cardiomyopathy
6
2.26E-04
Focal adhesion
7
0.002564022
Non-alcoholic fatty liver disease (NAFLD)
6
0.003989727
Legionellosis
4
0.006596853
cAMP signaling pathway
6
0.010270069
Oxytocin signaling pathway
5
0.018236826
MAPK signaling pathway
6
0.026558059
Estrogen signaling pathway
4
0.028271323
Circadian entrainment
4
0.028271323
Alzheimer’s disease
5
0.031162944
Retrograde endocannabinoid signaling
4
0.032112484
Calcium signaling pathway
5
0.032863034
WikiPathways
Glycolysis
4
1.29E-05
Calcium regulation in the cardiac cell
6
3.14E-05
Adipogenesis genes
5
2.29E-04
Fatty acid omega oxidation
2
3.46E-04
MAPK signaling pathway
5
6.50E-04
Glycolysis and gluconeogenesis
3
0.00108568
Iron homeostasis
2
0.001472475
Apoptosis modulation by HSP70
2
0.002449189
Fatty acid beta oxidation (streamlined)
2
0.007647089
IL-1 signaling pathway
2
0.011212501
Heart development
2
0.016011843
Non-odorant GPCRs
4
0.024312584
SIDS susceptibility pathways
2
0.026115967
Complement and coagulation cascades
2
0.026115967
Lung fibrosis
2
0.026915045
Insulin signaling
3
0.027511103
Hfe effect on hepcidin production
1
0.028360134
Alzheimer’s disease
2
0.038162217
Ethanol metabolism resulting in production of ROS by CYP2E1
1
0.040268466
Nicotine activity on dopaminergic neurons
1
0.040268466
PPAR signaling pathway
2
0.043857694
Results of a functional enrichment analysis of genes differentially expressed between nintedanib- and vehicle-treated mice conducted within the Database for Annotation, Visualization, and Integrated Discovery (DAVID).
Functional enrichment was examined within the categories of (A) biological process, (B) cellular component, and (C) molecular function; p-values less than 0.05 were considered significant, and the number of genes annotated in each functional category is given.
Distribution of Rfx2 and Bmpr2 expression
Next, we examined the gene and protein expression of Rfx2, one of three common upregulated genes among the three combinations of nintedanib- and vehicle-treated mice based on progression of pulmonary fibrosis (Rfx2, Hspa1a, and Hspa1b; Fig 2A), and Bmpr2. RT-qPCR and western blotting analyses showed that the expression of Rfx2 was significantly downregulated in the vehicle-treated lung compared with that in the age-matched D1CC×D1BB lung and that this downregulation tended to be ameliorated by nintedanib treatment (Fig 4A–4C). To verify the location of cells with Rfx2 expression, in situ hybridization was performed with Sftpc and Scgb1a1 transcripts, which were used as an RNA-expression marker for type II alveolar cells and for airway secreting cells, respectively. In situ hybridization revealed that Rfx2 was highly expressed in cells adjacent to Scgb1a1-positive cells localized in a basal cell–like position, and expression was observed in some type I and type II alveolar epithelial cells (Fig 4D). Subsequent immunostaining of lung tissue revealed that RFX2 was localized mainly in the bronchial epithelium, with some localization in the alveolar epithelium (Fig 4E). RT-qPCR and western blotting analyses also showed that Bmpr2 expression tended to be downregulated in the vehicle-treated lung compared with that in the age-matched D1CC×D1BB lung, and that this downregulation also tended to be ameliorated by nintedanib treatment (Fig 5A–5C). Bmpr2 was expressed mainly in type I alveolar epithelial cells, but some expression was also observed in type II alveolar epithelial and vascular endothelial cells, as shown by in situ hybridization (Fig 5D), and bronchial epithelium and alveolar cells, as shown by immunohistochemistry (Fig 5E).
Fig 4
Rfx2 expression in lung.
(A–C) Rfx2 expression in vehicle-treated, nintedanib-treated, and age-matched lung tissue. (A) Quantitative reverse transcription polymerase chain reaction analysis showed that Rfx2 expression was significantly downregulated in vehicle-treated mouse lung (n = 3) compared with that in age-matched D1CC×D1BB mouse lung (n = 3), and that this downregulation tended to be attenuated by nintedanib treatment (n = 3). The vehicle- and nintedanib-treated mouse lungs were obtained from the mice used in the analysis shown in Fig 1C. (B, C) Western blot analysis confirmed the findings shown in (A): age-matched D1CC×D1BB mouse lung, n = 4; vehicle-treated mouse lung, n = 4; nintedanib-treated mouse lung, n = 4 Relative signal intensity was determined using α Tubulin as the loading control. Data are presented as mean ± standard error. *, p < 0.05 by Dunnett’s test. (D) RNA in situ hybridization for Rfx2 revealed that Rfx2 was expressed strongly and weakly in cells adjacent to Scgb1a1-positive cells and in some type I and type II alveolar epithelial cells, respectively. Sftpc and Scgb1a1 transcripts were used as an RNA-expression marker for type II alveolar cells and airway secreting cells, respectively. Scale bars = 20 μm. (E) Immunohistochemical staining revealed that RFX2 (red) was localized mainly in bronchial epithelium and somewhat in alveolar epithelium. The expressions of E-cadherin (green) and SP-C (white) were used as a marker for epithelial cells, and epithelial cells and type II alveolar epithelial cells, respectively. Scale bars = 20 μm.
Fig 5
Bmpr2 expression in the lung.
(A–C) Bmpr2 expression in vehicle-treated, nintedanib-treated, and age-matched lung tissue. (A) Quantitative reverse transcription polymerase chain reaction analysis showed that Bmpr2 expression tended to be downregulated in vehicle-treated mouse lung (n = 3) compared with that in age-matched D1CC×D1BB mouse lung (n = 3) and that this downregulation tended to be attenuated by nintedanib treatment (n = 3). The vehicle- and nintedanib-treated mouse lungs were obtained from the mice used in the analysis shown in Fig 1C. (B, C) Western blot analysis confirmed the findings shown in (A): matched D1CC×D1BB mouse lung, n = 4; vehicle-treated mouse lung, n = 4; nintedanib-treated mouse lung, n = 4 Relative signal intensity was determined using α Tubulin as the loading control. Data are presented as mean ± standard error. (D) RNA in situ hybridization for Bmpr2 expression in the peripheral lung. Bmpr2 was expressed mainly in type I alveolar epithelial cells adjacent to type II alveolar epithelial cells with Sftpc expression. Scale bars = 20 μm; V, blood vessels. (E) Immunohistochemical staining revealed that BMPR2 localized to some bronchial epithelial cells and alveolar epithelial cells. Scale bars = 20 μm.
Rfx2 expression in lung.
(A–C) Rfx2 expression in vehicle-treated, nintedanib-treated, and age-matched lung tissue. (A) Quantitative reverse transcription polymerase chain reaction analysis showed that Rfx2 expression was significantly downregulated in vehicle-treated mouse lung (n = 3) compared with that in age-matched D1CC×D1BB mouse lung (n = 3), and that this downregulation tended to be attenuated by nintedanib treatment (n = 3). The vehicle- and nintedanib-treated mouse lungs were obtained from the mice used in the analysis shown in Fig 1C. (B, C) Western blot analysis confirmed the findings shown in (A): age-matched D1CC×D1BB mouse lung, n = 4; vehicle-treated mouse lung, n = 4; nintedanib-treated mouse lung, n = 4 Relative signal intensity was determined using α Tubulin as the loading control. Data are presented as mean ± standard error. *, p < 0.05 by Dunnett’s test. (D) RNA in situ hybridization for Rfx2 revealed that Rfx2 was expressed strongly and weakly in cells adjacent to Scgb1a1-positive cells and in some type I and type II alveolar epithelial cells, respectively. Sftpc and Scgb1a1 transcripts were used as an RNA-expression marker for type II alveolar cells and airway secreting cells, respectively. Scale bars = 20 μm. (E) Immunohistochemical staining revealed that RFX2 (red) was localized mainly in bronchial epithelium and somewhat in alveolar epithelium. The expressions of E-cadherin (green) and SP-C (white) were used as a marker for epithelial cells, and epithelial cells and type II alveolar epithelial cells, respectively. Scale bars = 20 μm.
Bmpr2 expression in the lung.
(A–C) Bmpr2 expression in vehicle-treated, nintedanib-treated, and age-matched lung tissue. (A) Quantitative reverse transcription polymerase chain reaction analysis showed that Bmpr2 expression tended to be downregulated in vehicle-treated mouse lung (n = 3) compared with that in age-matched D1CC×D1BB mouse lung (n = 3) and that this downregulation tended to be attenuated by nintedanib treatment (n = 3). The vehicle- and nintedanib-treated mouse lungs were obtained from the mice used in the analysis shown in Fig 1C. (B, C) Western blot analysis confirmed the findings shown in (A): matched D1CC×D1BB mouse lung, n = 4; vehicle-treated mouse lung, n = 4; nintedanib-treated mouse lung, n = 4 Relative signal intensity was determined using α Tubulin as the loading control. Data are presented as mean ± standard error. (D) RNA in situ hybridization for Bmpr2 expression in the peripheral lung. Bmpr2 was expressed mainly in type I alveolar epithelial cells adjacent to type II alveolar epithelial cells with Sftpc expression. Scale bars = 20 μm; V, blood vessels. (E) Immunohistochemical staining revealed that BMPR2 localized to some bronchial epithelial cells and alveolar epithelial cells. Scale bars = 20 μm.
Discussion
Using RNA sequencing, we examined the expression of genes in the lungs of nintedanib-treated iRA-ILD mice and identified 27 upregulated and 130 downregulated genes. Using functional enrichment and pathway analyses, we identified the functions and pathways enriched for these differentially expressed genes. Transcripts of two upregulated genes of interest, Rfx2 and Bmpr2, were found to be localized mainly in the bronchial epithelium and in peripheral type I alveolar cells, respectively. The RNA and protein expression levels of these genes were downregulated in iRA-ILD mouse lung compared with those in age-matched D1CC×D1BC mouse lung, and this downregulation tended to be ameliorated by nintedanib treatment.Nintedanib is an inhibitor of multiple tyrosine kinases (i.e., PDGFR, VEGFR, and FGFR) and its effects on lung and lung fibroblasts have been validated by other groups by comparing the expressions of mesenchymal markers, cytokines, and chemokines, and by assessing changes in the expression levels of genes related to PDGFR, VEGFR, and FGFR [22]. Therefore, at the start of the present study we anticipated that we would observe changes in the expression of downstream genes associated mainly with PDGFR, VEGFR, and FGFR. However, functional enrichment and pathway analysis showed that fibrosis-related genes such as Col1a1, Fn1, and Acta2 were not enriched in the terms "signaling pathway" and "focal adhesion," which are closely related to these tyrosine kinases, indicating that nintedanib also affects the expression of genes involved in other pathways not directly associated with these tyrosine kinases. The duration of nintedanib treatment in the present study may have blurred the direct effect on the target pathway by alternative compensation or acquisition of tolerance to inhibitors. Although comprehensive gene expression analyses have been performed in fibrotic lesions and normal regions in lungs and in lung cell lines, at the present no reports exist discussing a comprehensive analysis of gene expression in nintedanib-treated lungs [23-25].Although several of the downregulated genes detected in the present study are associated with the myocardial architecture, these genes are not reported to be directly involved in the pathogenesis of pulmonary fibrosis. Although the INPULSIS trial showed a low risk of adverse cardiovascular events, it has been noted that the risk of myocardial infarction tends to increase with subsequent accumulation of nintedanib-treated patients [26, 27]. On the other hand, reports of improvements in myocardial fibrosis with nintedanib are of clinical interest [28]. The results of a recent transcriptome analysis of the mouse pulmonary myocardium with respect to atrial fibrillation have much in common with the genes downregulated in the present study [29], and the effect of nintedanib on intrapulmonary blood vessels is noteworthy. A previous study reported the effect of nintedanib on pulmonary artery smooth muscle in a rat model of pulmonary arterial hypertension [30]. Although the mechanism of how nintedanib influence genes related to cardiovascular system is not clear at the present time, the results of the present functional enrichment and pathway analyses may help direct future studies. In addition, nintedanib has recently been reported to have antifibrotic activity in organs other than the lungs, including in mouse models of liver fibrosis and muscular dystrophy [31, 32]; examinations for nintedanib effect in other organs are warranted.In the present study, fewer upregulated genes than downregulated genes were detected, and among the 3 combinations of nintedanib- and vehicle-treated mice based on the progression of pulmonary fibrosis, only three common upregulated genes were identified (Rfx2, Hspa1a, and Hspa1b; Fig 2A). HSPA1A and HSPA1B are members of the heat shock protein 70 family, and are closely related to one another. Several studies have reported that heat shock proteins play roles in the pathogenesis of interstitial lung disease, including in a bleomycin-induced mouse model of pulmonary fibrosis, in which induction of HSP70 expression inhibited fibrosis in the lung, and administration of anti-HSP70 antibodies reduced lung function and increased mortality [33-35]. In addition, extracellular matrix proteins are reported to be increased in primary lung fibroblasts lacking HSP70 [36]. In the present study, although we examined the changes in the expression levels of Hspa1a and Hspa1b in nintedanib-treated fibroblasts by means of RT-qPCR, we did not observe any changes in the expression levels of these genes at least under the present conditions.RFX2 is a DNA-binding protein and a member of the RFX family, which is a protein family that is involved in the cell cycle, immunoregulation, and expression of motile cilia, particularly in spermatogenesis [37-39]. In the airway epithelium of the lung, RFX2 is suggested to coordinate with the transcription factor grainyhead-like 2 to induce differentiation of ciliated cells from progenitor basal cells during epithelial regeneration [40]. Our present immunohistochemical staining results show that RFX2 is expressed mainly in the bronchial epithelium (Fig 5A) and our RNA in situ hybridization results show that Rfx2 is expressed in cells located adjacent to Scgb1a1-positive cells (Fig 5B), indicating that Rfx2-positive cells are localized in a basal cell–like position; therefore, nintedanib may affect airway epithelium or secretory cells via Rfx2 expression in basal cells. In addition, a recent study using single-cell RNA sequencing in pulmonary fibrosis identified pathological keratin (KRT)5−/KRT17+ epithelial cells producing extracellular matrix and expressing the canonical basal cell transcriptional factor tumor protein p63 [41]. The Rfx2 expression–positive cells detected in the present study were located near these cells in areas of basal cells, although Krt5 showed low mRNA expression before and after nintedanib treatment. Rfx2 is anticipated to be involved in the repair of pulmonary epithelium during nintedanib treatment; however, it remains unclear how RFX2 functions in the lungs. Although we found no change in the expression of RFX family genes other than Rfx2, the regulatory genes Rfx1–3 have been analyzed by using RNA-seq and ChIP-seq in mouse ependymal cells [42]. In addition, RFX2 is reported to be involved in the regulation of the promoter of fibroblast growth factor-1B, a major transcript within the human brain and retina, by forming a complex with RFX3 in human glioblastoma cells, suggesting that RFX2 alone is insufficient for its regulation [43]. Thus, it remains unknown how nintedanib promotes Rfx2 RNA expression. To answer the question, it will be worthwhile to investigate the relationship between Rfx2 and non-coding RNAs such as microRNAs. In the present study, the expression of Mucin5b (Muc5b) was found to be significantly suppressed by nintedanib. A variant promoter of this gene, rs35705950, is reported to be a risk factor for pulmonary fibrosis; furthermore, in pulmonary fibrosis, Muc5b has been shown to be expressed not only in the conducting airways but also in epithelial cells lining honeycomb cysts, and its expression level in the mouse bronchoalveolar epithelium is associated with impaired mucociliary clearance and the extent and persistence of bleomycin-induced pulmonary fibrosis [44, 45]. Taken together, the present findings indicate that nintedanib may affect the ciliary phenotypic expression and differentiation of abnormal cell populations in the peripheral airway, which may underlie its activity to slow the progression of pulmonary fibrosis.Recently, Calabrese et al. identified 23 upregulated genes in aggregates of fibroblasts lined by epithelial cells, which they called epithelial cell/fibroblastic foci sandwich, in lungs with idiopathic pulmonary fibrosis compared to those in lungs with primary spontaneous pneumothorax by RNA sequencing analysis [46]. Intriguingly, five downregulated genes (Scgb3a1, Bpifb1, Pigr, Muc5B, and Krt5) by nintedanib treatment in the present study were included in the 14 upregulated genes with log fold-change ≥ 2 in the 23 upregulated genes. Scgb3a1, Pigr, Bpifb1, and Muc5B are related to secretory and mucin proteins, and immune defenses [46]. Scgb3a1 is expressed in secretory cells in idiopathic pulmonary fibrosis [47]. The BPIFB1 protein was reported to be upregulated in the small airway epithelium in cystic fibrosis compared to that in the control [48]. PIGR mediates immunoglobulin A for immune exclusion of inhaled pathogens in the bronchial mucosa [49]. We previously reported Krt5 expression in hyperplastic bronchiolar cells in a mouse model of bleomycin-induced interstitial pneumonia [13]. Muc5B is reported to be expressed in the small airways and epithelial cells lining honeycomb cysts [44, 45]. These findings imply that these genes could be involved in the development of pulmonary fibrosis and the effect of nintedanib in specific lesions between the peripheral airways and alveoli despite the differences in diseases, species, and sample preparation between the present study and Calabrese’s study. Further investigations are needed to clarify the functions of these genes.BMPR2 is a transmembrane and serine/threonine kinase receptor for bone morphogenetic proteins, which have functions in cell differentiation, proliferation, and bone formation [50]. Bone morphogenetic proteins are thought to affect the vascular endothelium and smooth muscle, interfering with transforming growth factor beta signaling; therefore, mutation in BMPR2 is a cause of pulmonary hypertension [21]. In addition, a previous study reported that BMPR2 expression is reduced in patients with idiopathic pulmonary fibrosis or in those with pulmonary hypertension [51]. Because we hypothesized that this blood vessel–related gene is acted upon by nintedanib via its anti-VEGFR activity, we focused on Bmpr2 among the genes upregulated by nintedanib treatment. Although Bmpr2 expression in the epithelium has been reported previously, we confirmed the presence of Bmpr2 expression in iRA-ILD mouse lung. How nintedanib upregulates Bmpr2 during the development of lung fibrosis remains to be investigated; however, we speculate that nintedanib may alleviate lung fibrosis through BMPR2 enhancement.In the present study, Rfx2 and Bmpr2 were expressed in peripheral airway epithelium and alveolar cells, as determined by in situ hybridization and immunohistochemistry. Although it is difficult to detect cells with significant gene alteration by using current tissue-based RNA sequencing approaches, we speculate that the responsible cell population may be cells with expression of these genes. Detection of the expression of these genes is difficult in mesenchymal cells such as fibroblasts, especially in nintedanib-treated mice where the development of fibrotic lesions is attenuated by nintedanib treatment. Single-cell sequencing is expected to a useful approach for identifying the cell lineages responsible for the detected alteration of gene expression, and it is expected that it will be specific populations within the small airways or alveolar epithelium that show these changes. Single-cell sequencing has the advantage of being able to be used also for mesenchymal cell analysis, and a previous report has shown that nintedanib treatment in bleomycin-treated mice reduced a bleomycin-induced shift to the extracellular matrix-enriched cluster in fibroblasts [7], although no specific genes of activated cells were detected in pulmonary fibrosis lesions. We used fibroblasts derived from D1CC×D1BC mouse lung to evaluate the effect of nintedanib in fibroblasts; however, fibroblasts cultured after collection from lung tissue may contain several lineages, making it difficult to determine whether the established cells are the actual cells affected by nintedanib.We acknowledge the following limitations of the present study. First, for the expression analysis, total RNA was extracted from peripheral lung tissue that included not only the alveolar epithelium, stromal tissue, pulmonary blood vessels, and peripheral airways, but also mesenchymal and hematopoietic cells such as macrophages, lymphocytes, and neutrophils. Therefore, we were unable to evaluate the differences in gene expression profiles between discrete pulmonary tissues. We did attempt to determine the specific locations of Rfx2 and Bmpr2 expression by using in situ hybridization; however, we could not quantitatively measure the changes in expression because of poor visual discrimination of the signals in specific cell types, structural differences attributed to nintedanib treatment, positioning heterogeneity in various types of hybridized cells. Localized sampling by microdissection or single-cell sequencing may overcome this limitation. In addition, although our methodology allows measurement of gene expression profiles in the periphery of nintedanib-treated lung with pulmonary fibrosis, a consistent means of distinguishing cell types will be needed to determine differential gene expression in the peripheral airway or alveoli. Second, it is difficult to conclude whether the observed up- and downregulation of genes is beneficial or detrimental to pulmonary fibrosis. Also, it remains unknown whether the observed changes in gene expression are directly involved in the antifibrotic activity of nintedanib or whether they reflect changes in response to improved pulmonary fibrosis or are the result of responses related to adverse events associated with nintedanib treatment. Additional studies based on our analysis results may lead to unexpected disadvantageous effects. Because the cellular environment of interstitial lung diseases is controlled by a complex network of interactions among mRNAs, microRNAs, long non-coding RNAs, proteins, and genomic DNA, the iRA-ILD mouse is a valuable mouse model for investigating the expression of genes in the lung environment under antifibrotic treatment.
Conclusions
Here, we used the iRA-ILD mouse model to examine the effects of nintedanib in the fibrotic lung. The present analyses revealed 157 genes that were up- or downregulated in the lung tissue of iRA-ILD mice by nintedanib treatment. Subsequent functional enrichment analysis revealed that the identified genes were associated with extracellular components, including the myocardial architecture. Of the upregulated genes, we focused on Rfx2 and Bmpr2. Rfx2 was highly expressed in cells adjacent to Scgb1a1-positive cells localized in a basal cell–like position, indicating that nintedanib treatment has some effect on the peripheral airway epithelium. Bmpr2 may be involved in the development of pulmonary fibrosis in the alveolar region. As it is difficult to collect human lung tissue for comprehensive gene expression analysis in clinical practice, this mouse model will be valuable for tracking fibrosis and treatment responsiveness over a relatively long period of medication. Our findings are expected to contribute to the development of improved strategies for the use of nintedanib for the treatment of devastating interstitial lung diseases.(TIF)Click here for additional data file.(TIF)Click here for additional data file.9 Feb 2022
PONE-D-22-01668
Nintedanib induces gene expression changes in the lung of induced-rheumatoid arthritis–associated interstitial lung disease mice
PLOS ONE
Dear Dr. Uematsu,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
Our reviewers found some interests in this manuscript, but also pointed out a number of criticisms that require improvement and amendment. I ask the authors to fully respond to all comments made by reviewers in the revised manuscript. This includes additional experiments.
Please submit your revised manuscript by Mar 26 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Masataka Kuwana, MD, PhDAcademic EditorPLOS ONEJournal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. As part of your revision, please complete and submit a copy of the Full ARRIVE 2.0 Guidelines checklist, a document that aims to improve experimental reporting and reproducibility of animal studies for purposes of post-publication data analysis and reproducibility: https://arriveguidelines.org/sites/arrive/files/Author%20Checklist%20-%20Full.pdf (PDF). Please include your completed checklist as a Supporting Information file. Note that if your paper is accepted for publication, this checklist will be published as part of your article.3. Thank you for stating the following in the Competing Interest section:"KU, SK, and HO received research support from Boehringer Ingelheim Pharma GmbH & Co. KG. All other authors have nothing to disclose."We note that you received funding from a commercial source: Boehringer Ingelheim Pharma GmbH & Co. KG. Please provide an amended Competing Interests Statement that explicitly states this commercial funder, along with any other relevant declarations relating to employment, consultancy, patents, products in development, marketed products, etc.Within this Competing Interests Statement, please confirm that this does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests). If there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared.Please include your amended Competing Interests Statement within your cover letter. We will change the online submission form on your behalf.4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: NoReviewer #2: YesReviewer #3: Partly********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: YesReviewer #3: Yes********** 3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: YesReviewer #2: YesReviewer #3: Yes********** 4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: YesReviewer #2: YesReviewer #3: Yes********** 5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The authors examined the alteration of gene expression in murine lung fibrosis by the treatment with nintedanib. A number of criticisms are raised for this study.1) The authors need to show histological images of the lung, H&E and Masson trichrome stains. Also, they need to show if the treatment with nintedanib affected the interstitial lung disease.2) In figure 1, they selected 2 vehicle-treated samples from total 3, and 3 nintedanib-treated samples from total 5. The authors should describe if it is rational. Why the other samples showed different gene expression even with nintedanib treatment? Lung histology was also different?3) In figure 5, Rfx2 and Bmpr2 are expressed in type II alveolar cells or endothelial cells. However, in figure 4 they analyzed the expression of fibroblast in vitro. They need to show if the genes express in fibroblast in the lung tissue. Also, they need to show if the gene and protein expressions was increased in lung tissue by the treatment with nintedanib.Reviewer #2: In this manuscript by Mikami et al. investigated the expression of genes in the lungs of nintedanib-treated mouse model of RA-ILD by next-generation RNA sequencing. The authors identified upregulated and downregulated genes, and the functions and pathways enriched for the differentially expressed genes in nintedanib-treated lungs. Although the statistical analysis of the data is of overall good quality, there are several concerns regarding this study that the authors need to clarify.The use of various control is lacking in the current study. How is the expression of Rfx2 and Bmr2 in the lungs of control D1CC×D1BC mice compared to iRA-ILD mice? In addition, the inclusion of control (normal lung of D1CC×D1BC mice) would be helpful for the experiment in Fig. 5.The main conclusions are based on about 2-fold changes in mRNA expression with a small number of samples. Figure 4A is lacking control and any quantification as to whether the expression of RFX2 and BMPR2 changes with nintedanib. Also, the protein levels of RFX2 and BMPR2 in fibroblast should be quantified by Western blot in Fig. 4B.All the images should be more carefully assessed to demonstrate some degree of quantitative localization to RFX2 and BMPR2. In Fig. 5, the reviewer cannot see any difference in expression and distribution of the genes between vehicle and nintedanib group. In addition, the immunohistochemical staining for Bmpr2 is lacking in Fig. 5.Reviewer #3: Comments to the authors:In this study, the authors evaluated the effects of nintedanib on gene expression in the lung of iRA-ILD model mice and revealed Rfx2, Bmpr2 were upregulated by nintedanib. The authors mentioned that the purpose of this study was to identify predictors of nintedanib treatment response or adverse events associated with nintedanib, but current data only showed the changes of the genes by nintedanib without underlying mechanisms. Specific comments are listed below:Major commentsFirst of all, all the figures including this article are unclear, and I cannot evaluate the data correctly. The authors should reupload more clear images that meet submission guidelines.In this article, the authors performed whole lung RNA-seq, but there are many cell types in the entire lung, and it is quite difficult to point out the cell specificity of the identified genes. Therefore, to reveal predictors of nintedanib treatment response, to determine the cells affected by nintedanib are essential, and cell-type-specific gene expression analysis or single-cell RNA sequence is necessary to evaluate the mechanism of nintedanibSince one scRNA-sequencing study using a bleomycin-induced lung fibrosis model has already been published in 2019 (Peyser et al., Am J Respir Cell Mol Biol. 2019), the authors should mention this in the discussion.The authors found increased Rfx2, Bmpr2 expressions in the lung of iRA-ILD model mice treated with nintedanib compared with vehicle controls but did not show any functional significance of this finding. More detailed in vitro experiments will be needed to figure out the mechanisms.Minor points1) In isolation and culture of lung fibroblast method, lung fibroblasts were cultured with DMEM(1% FBS) for 24h as control, DMEM (1% FBS) with PDGF-BB 10ng/ml for 24h as PDGF-BB condition, and DMEM (1% FBS) containing PDGF-BB 10ng/ml for 24h and add 1 uM nintedanib for 24h as PDGF→nintedanib condition. In 3 conditions, the total culture hours seem different, which might influence their findings due to cell viability.2) The authors described the Rfx2 and Bmpr2 genes with significant differences in RNA-sequencing data, but they didn’t show the RT-qPCR data using the same samples or same model samples to confirm the RNA-sequencing data. These secured data or additional experiments using the same mice model to verify the Rfx2, Bmpr2 gene expression should be added.3)The authors used fibroblasts derived from non-fibrotic mice lungs with PDGF-BB stimulation to reveal Rfx2, Bmpr2 gene expression, even if their enrichment analysis and pathway analysis didn’t tell “signal pathway” or “focal adhesion” associated PDGF. The authors should explain the particular reason for using PDGF-BB.In addition, both Rfx2, Bmpr2 gene expressions didn’t alter by PDGF-BB stimulation, suggesting these two gene expressions may not be regulated by the PDGF signaling pathway.4) In figure 4A, the authors should show isotype control data in addition to 3 different conditions, control, PDGF-BB, and PDGF-BB→nintedanib, similar to in figure 4B, to see the changes by nintedanib treatment.5) In figure 5C, the authors revealed Bmpr2 was expressed mainly in type I alveolar epithelial cells, but some expression was also observed in type II alveolar epithelial and vascular endothelial cells by in situ hybridization. They also showed Bmpr2 expression in lung fibroblast in figure 4A, indicating nintedanib may affect multiple types of cells. Detailed functional analyses are necessary to r********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: NoReviewer #2: NoReviewer #3: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.26 Mar 2022Responses to Reviewer 1The authors examined the alteration of gene expression in murine lung fibrosis by the treatment with nintedanib. A number of criticisms are raised for this study.1) The authors need to show histological images of the lung, H&E and Masson trichrome stains. Also, they need to show if the treatment with nintedanib affected the interstitial lung disease.(Response) Our coauthors Y. Miura, H. Ohkubo, and S. Kanazawa have previously reported the effects of nintedanib on pulmonary fibrosis in the same mouse model as that used in the present study (ref. 12 in the revised manuscript). We have also conducted an additional histological examination of vehicle-treated and nintedanib-treated lungs using hematoxylin and eosin and Masson’s trichrome staining (new Fig 1A, B) and found less disruption of the pulmonary architecture and less Masson staining in the nintedanib-treated lung than in the vehicle-treated lung. The methods and data from this examination have been added to the revised manuscript as follows:• Materials and methods, page 5, lines 107–109We have added “Lungs were fixed in 4% paraformaldehyde, and 2-μm-thick paraffin sections were stained with hematoxylin and eosin and Masson’s trichrome.”• Results, page 9, lines 230–232We have added “Histological examination revealed that nintedanib treatment alleviated destruction of the alveolar structure (Fig 1A: hematoxylin and eosin staining) and reduced the density of fibrotic regions (Fig 1B: Masson’s trichrome staining), which is consistent with a previous report [12].”• Figure 1 legendWe have added “(A, B) Histology of vehicle- and nintedanib-treated lung.”2) In figure 1, they selected 2 vehicle-treated samples from total 3, and 3 nintedanib-treated samples from total 5. The authors should describe if it is rational. Why the other samples showed different gene expression even with nintedanib treatment? Lung histology was also different?(Response) We examined pulmonary fibrosis progression by using a plot of Masson staining blue ratio vs. serum SP-D (new Fig 1C) and found clear variation within the two groups of vehicle- and nintedanib-treated mice. Among the three vehicle-treated lungs, one (VC) showed different pulmonary fibrosis progression compared with the other two (VA and VB). Similarly, among the five nintedanib-treated lungs, three (NA, NB, and NC) showed different pulmonary fibrosis progression compared with the other two (NE and ND). The implications here are that: VA and VB had more progressive fibrosis in the lung compared with VC; NA, NB, and NC had more alleviation in interstitial lung disease by nintedanib treatment compared with ND and NE, and by extension that VC was more resistant to the development of severe interstitial lung disease than VA and VB; and ND and NE were less sensitive to nintedanib treatment than were NA, NB, and NC. Therefore, we excluded VC, ND, and NE from the later analyses.Subsequent gene expression analysis by RNA sequencing using mRNA derived from the three vehicle-treated lungs and five nintedanib-treated lungs also revealed the presence of two major clusters: one comprising the vehicle-treated lungs VA and VB, and one comprising the nintedanib-treated lungs NA, NB, and NC, which supports the findings described above.We have made the following changes in the revised manuscript:• Results, pages 9–10, lines 220–225“Masson staining blue ratio was used an index of the level of fibrosis. Plotting the relationship between Masson stain blue ratio and serum SP-D level revealed a cluster of three of the nintedanib-treated mice (NA, NB, and NC), which was located far from two of the vehicle-treated mice (VA and VB) (Fig 1A).” has been changed to “Next, using Masson staining blue ratio as an index of the level of fibrosis, we plotted the relationship between Masson stain blue ratio and serum SP-D level for 3 vehicle-treated (VA–VC) and 5 nintedanib-treated (NA–NE) iRA-ILD mice. This plot revealed a cluster of three of the nintedanib-treated mice (NA, NB, and NC) that was located far from the two vehicle-treated mice (VA and VB) (Fig 1C).”3) In figure 5, Rfx2 and Bmpr2 are expressed in type II alveolar cells or endothelial cells. However, in figure 4 they analyzed the expression of fibroblast in vitro. They need to show if the genes express in fibroblast in the lung tissue. Also, they need to show if the gene and protein expressions was increased in lung tissue by the treatment with nintedanib.(Response) The expressions of Rfx2 and Bmpr2 were detected in peripheral bronchial epithelium and alveolar cells by means of immunohistochemical staining and RNA in situ hybridization. However, it was difficult to evaluate these expressions in lung tissue fibroblasts, partly because of attenuation of fibrosis in nintedanib-treated lung tissue with enhanced expression of Rfx2 and Bmpr2 in the tissue-based RNA sequencing. Instead, RT-qPCR and western blotting analyses revealed that the expression of both genes tended to be downregulated in iRA-ILD mouse lung compared with that in age-matched D1CC×D1BB mouse lung and that this downregulation tended to be ameliorated by nintedanib treatment. We believe that these data provide further evidence that nintedanib treatment alters Rfx2 and Bmpr2 gene expression. We currently attribute the differential expressions of the two genes to the alteration of gene expression in peripheral bronchial epithelium or alveolar cells rather than in fibroblasts. It is difficult to evaluate involvement of fibroblasts in expression changes of both genes. We think that fibroblasts isolated from lung tissue contain various lineages; therefore, sorting by receptors such as PDGFR may be needed to examine this issue further.We have made the following changes in the revised manuscript:• Figures 4 and 5We have added Rfx2 and Bmpr2 expression data for vehicle-treated, nintedanib-treated, and age-matched mouse lung, as determined by means of RT-qPCR and western blot analysis.• Materials and methods, pages 7–8, lines 170–180We have added our western blot procedures.• Results, page 21, lines 304–307We have added the text “RT-qPCR and western blotting analyses showed that the expression of Rfx2 was significantly downregulated in the iRA-ILD lung compared with that in the age-matched D1CC×D1BB lung, and that this downregulation tended to be ameliorated by nintedanib treatment (Fig 4A–C).”• Results, pages 21–22, lines 316–319We have added the text “RT-qPCR and western blotting analyses also showed that Bmpr2 expression tended to be downregulated in the vehicle-treated lung compared with that in the age-matched D1CC×D1BB lung, and that this downregulation also tended to be ameliorated by nintedanib treatment (Fig 5A–C).”Responses to Reviewer 2In this manuscript by Mikami et al. investigated the expression of genes in the lungs of nintedanib-treated mouse model of RA-ILD by next-generation RNA sequencing. The authors identified upregulated and downregulated genes, and the functions and pathways enriched for the differentially expressed genes in nintedanib-treated lungs. Although the statistical analysis of the data is of overall good quality, there are several concerns regarding this study that the authors need to clarify.The use of various control is lacking in the current study. How is the expression of Rfx2 and Bmr2 in the lungs of control D1CC×D1BC mice compared to iRA-ILD mice? In addition, the inclusion of control (normal lung of D1CC×D1BC mice) would be helpful for the experiment in Fig. 5.(Response) As requested, we have repeated the experiments in D1CC×D1BC mice. RT-qPCR and western blot analysis showed higher expressions of Rfx2 and Bmpr2 in D1CC×D1BC lung compared with those in iRA-ILD lung.We have made the following changes in the revised manuscript:• Figures 4 and 5We have added Rfx2 and Bmpr2 expression data for vehicle-treated, nintedanib-treated, and age-matched mouse lung, as determined by means of RT-qPCR and western blot analysis. Immunohistochemical staining and in situ hybridization data have also been added.• Materials and methods, pages 6, lines 130–131We have added the phrase “and 4 age-matched D1CC×D1BC mice,”.• Materials and methods, pages 7, lines 165–166We have added the words “the age-matched”.• Materials and methods, pages 7–8, lines 170–180We have added our western blot procedures.The main conclusions are based on about 2-fold changes in mRNA expression with a small number of samples. Figure 4A is lacking control and any quantification as to whether the expression of RFX2 and BMPR2 changes with nintedanib. Also, the protein levels of RFX2 and BMPR2 in fibroblast should be quantified by Western blot in Fig. 4B.(Response) As requested, we evaluated Rfx2 and Bmpr2 expressions in age-matched D1CC×D1BC mouse lung by RT-qPCR and western blot analysis and compared the data with those obtained from iRA-ILD mouse lung. Rfx2 and Bmpr2 expression were both downregulated in iRA-ILD lung compared to that in age-matched D1CC×D1BC lung, and nintedanib treatment tended to ameliorate these downregulations. Immunohistochemical staining and RNA in situ hybridization analyses revealed that Rfx2 and Bmpr2 were expressed in peripheral bronchial epithelium and alveolar cells. However, it was difficult to examine the expression of Rfx2 and Bmpr2 in lung tissue fibroblasts partly due to the attenuation of fibrosis in nintedanib-treated lung with enhanced expression of Rfx2 and Bmpr2 in the tissue-based sequencing. We currently attribute the differential gene expression to the alteration of gene expression in peripheral bronchial epithelium or alveolar cells rather than in fibroblasts. We think that because fibroblasts isolated from lung tissue contain various lineages, sorting by receptors such as PDGFR will be needed to examine this issue further. We are currently conducting a comprehensive analysis of gene expression changes induced by nintedanib treatment, and we have identified several additional genes of interest other than Rfx2 and Bmpr2. Therefore, because the present examination of fibroblasts needs further quantification, we have removed those experiments from the revised manuscript, and we intend to report our findings for our other genes of interest together with the changes of Rfx2 and Bmpr2 expression in fibroblasts in a future report.We have made the following changes in the revised manuscript:• Figures 4 and 5We have added Rfx2 and Bmpr2 expression data for vehicle-treated, nintedanib-treated, and age-matched mouse lung, as determined by means of RT-qPCR and western blot analysis.• Abstract, page 2, lines 34–36; Materials and methods, page 5, lines 115–126 and page 8, 183–193; Results, page 21, lines 307–309 and page 26, lines, 440–441We have deleted text discussing fibroblasts.• Discussion, line 469The phrase “the upregulation of” has been deleted.• Discussion, line 470The phrase “in fibroblasts following nintedanib treatment” has been deleted.• Conclusion, lines 518–519The phrase “which were found to be expressed in lung fibroblasts” has been deleted.All the images should be more carefully assessed to demonstrate some degree of quantitative localization to RFX2 and BMPR2. In Fig. 5, the reviewer cannot see any difference in expression and distribution of the genes between vehicle and nintedanib group. In addition, the immunohistochemical staining for Bmpr2 is lacking in Fig. 5.(Response) As requested, we have added images of immunohistochemical staining of BMPR2 expression as new Figure 5(E). We also evaluated Rfx2 and Bmpr2 expression in age-matched D1CC×D1BC mouse lung by means of immunohistochemistry and in situ hybridization and found no differences in distribution among vehicle-, nintedanib-treated, and age-matched D1CC×D1BC mouse lung.Responses to Reviewer 3In this study, the authors evaluated the effects of nintedanib on gene expression in the lung of iRA-ILD model mice and revealed Rfx2, Bmpr2 were upregulated by nintedanib. The authors mentioned that the purpose of this study was to identify predictors of nintedanib treatment response or adverse events associated with nintedanib, but current data only showed the changes of the genes by nintedanib without underlying mechanisms. Specific comments are listed below:Major commentsFirst of all, all the figures including this article are unclear, and I cannot evaluate the data correctly. The authors should reupload more clear images that meet submission guidelines.(Response) We have prepared the figures in line with the PLOS ONE submission guidelines and confirmed the quality of the figures through PACE, which PLOS ONE recommends for assessment of figure quality. We will consult the editorial office if the issue persists.In this article, the authors performed whole lung RNA-seq, but there are many cell types in the entire lung, and it is quite difficult to point out the cell specificity of the identified genes. Therefore, to reveal predictors of nintedanib treatment response, to determine the cells affected by nintedanib are essential, and cell-type-specific gene expression analysis or single-cell RNA sequence is necessary to evaluate the mechanism of nintedanibSince one scRNA-sequencing study using a bleomycin-induced lung fibrosis model has already been published in 2019 (Peyser et al., Am J Respir Cell Mol Biol. 2019), the authors should mention this in the discussion.(Response) As the reviewer notes, it is difficult to determine the cell specificity of the identified genes. However, the aim of the present study was to obtain information about a potential predictor of nintedanib response by using lung tissue from a model mouse. We intend to continue this line of research by examining cell specificity after identifying which genes expressions are altered.At present, we have evaluated Rfx2 and Bmpr2 expression by means of RNA in situ hybridization and immunohistochemistry and these examinations showed that these genes are expressed in peripheral airway epithelium and alveolar cells. Looking forward, single-cell sequencing may be a useful method for identifying alterations of gene expression in specific cells in lung lesions. As noted by the reviewer, Peyser et al. have utilized this approach to elucidate the function of fibroblasts in a bleomycin-induced pulmonary fibrosis model. In their study, treatment with nintedanib for 11 days in bleomycin-treated mice reduced bleomycin-induced shift to the ECM-enriched cluster in fibroblasts, and these nintedanib-treated fibroblasts tended to have reduced expressions of Col1a1, Col3a1, and Fn1. They also showed that no specific genes were activated in the cells in pulmonary fibrosis lesions.In our study, we used iRA-ILD model mice and we adopted a longer period of nintedanib treatment (8 weeks) than that used by Peyser et al. After we identified two genes of interest, Rfx2 and Bmpr2, we confirmed downregulation of both gene expressions in iRA-ILD mouse lung compared with that in D1CC×D1BC mouse lung without ILD induction, and the tendency of these downregulations to be ameliorated by nintedanib treatment, by means of RT-qPCR and western blot analysis; however, at present, we cannot determine which specific cells contributed to this differential gene expression. Although tissue-based RNA sequencing, as used in the present study, may mask differences of gene expression in specific or small populations of cells, we currently attribute the differential expressions of Rfx2 and Bmpr2 to the alteration of gene expression in hybridized cell populations by immunohistochemistry or RNA in situ hybridization of Rfx2 and Bmpr2. However, the immunohistochemical staining and RNA in situ hybridization analyses did not clearly show Rfx2 or Bmpr2 expression in fibroblasts in the lung tissues, even though immunostaining and RT-qPCR analyses showed Rfx2 or Bmpr2 expression in cultured lung fibroblasts. Fibroblasts contain several lineages; therefore, our fibroblast data needs to be confirmed under various conditions.We have made the following changes in the revised manuscript:• Introduction, pages 3–4, lines 70–74“Peyser et al. used single-cell sequencing and a bleomycin-induced pulmonary fibrosis model to characterize molecular response to fibrotic injury [7]. In that study, treatment of nintedanib reduced the bleomycin-induced cluster shift of fibroblasts to the extracellular matrix-enriched cluster and no specific upregulation of gene expression was observed in pulmonary fibrosis lesion cells.”• Introduction, page 4, lines 74–75“However, this approach is yet to be used to examine the gene expression alterations in nintedanib-treated lung.” has been changed to “A tissue-based sequencing approach has yet to be used to examine the gene expression alterations in nintedanib-treated lung.”• Discussion, pages27–28, lines 473–489“In the present study, Rfx2 and Bmpr2 were expressed in peripheral airway epithelium and alveolar cells, as determined by in situ hybridization and immunohistochemistry. Although it is difficult to detect cells with significant gene alteration by using current tissue-based RNA sequencing approaches, we speculate that the responsible cell population may be cells with expression of these genes. Detection of the expression of these genes is difficult in mesenchymal cells such as fibroblasts, especially in nintedanib-treated mice where the development of fibrotic lesions is attenuated by nintedanib treatment. Single-cell sequencing is expected to a useful approach for identifying the cell lineages responsible for the detected alteration of gene expression, and it is expected that it will be specific populations within the small airways or alveolar epithelium that show these changes. Single-cell sequencing has the advantage of being able to be used also for mesenchymal cell analysis, and a previous report has shown that nintedanib treatment in bleomycin-treated mice reduced a bleomycin-induced shift to the extracellular matrix-enriched cluster in fibroblasts [7], although no specific genes of activated cells were detected in pulmonary fibrosis lesions. We used fibroblasts derived from D1CC×D1BC mouse lung to evaluate the effect of nintedanib in fibroblasts; however, fibroblasts cultured after collection from lung tissue may contain several lineages, making it difficult to determine whether the established cells are the actual cells affected by nintedanib.”The authors found increased Rfx2, Bmpr2 expressions in the lung of iRA-ILD model mice treated with nintedanib compared with vehicle controls but did not show any functional significance of this finding. More detailed in vitro experiments will be needed to figure out the mechanisms.(Response) Our iRA-ILD mouse model develops ILD slowly which is less acute compared to bleomycin-induced ILD. In our model, we found altered expression of Rfx2 and Bmpr2 during a comparatively longer treatment of nintedanib. In the airway epithelium, RFX2 coordinates with the transcription factor grainhead-like 2 to induce differentiation of ciliate cells from progenitor basal cells during epithelial regeneration (Gao X, et al. J Cell Biol, 2015;211:669-682). Immunohistochemical staining showed that RFX2 was expressed mainly in bronchial epithelium, and RNA in situ hybridization showed that Rfx2 is expressed in cells located adjacent to Scgb1a1-positive cells, which are proposed to be club cells. From these findings, we speculate that Rfx2 is related to repair of the small airways and lung epithelium in response to disruption of the lung architecture; however, more data on RFX2 expression data under various pathological conditions are needed to confirm this role.Bmpr2 mutation is reported to be associated with pulmonary hypertension, and it has been reported that BMPR2 expression is reduced in patients with idiopathic pulmonary fibrosis or pulmonary hypertension (Chen NY, et al. Am J Physiol Lung Cell Mol Physiol. 2016;311:L238-254). How BMPR2 is related to alleviation of pulmonary fibrosis remains to be fully investigated. However, we confirmed BMPR2 expression in fibroblasts and lung epithelium and we expect BMPR2 to exert its function in these cells and tissues.Minor points1) In isolation and culture of lung fibroblast method, lung fibroblasts were cultured with DMEM(1% FBS) for 24h as control, DMEM (1% FBS) with PDGF-BB 10ng/ml for 24h as PDGF-BB condition, and DMEM (1% FBS) containing PDGF-BB 10ng/ml for 24h and add 1 uM nintedanib for 24h as PDGF→nintedanib condition. In 3 conditions, the total culture hours seem different, which might influence their findings due to cell viability.(Response) Originally, we used four culture conditions and evaluated Rfx2 and Bmpr2 expressions in fibroblasts by RT-qPCR. The four conditions were as follows:1) culture in DMEM (0.1% FBS) for 24 h,2) culture in DMEM (0.1% FBS) containing PDGF-BB for 24 h,3) culture in DMEM (0.1% FBS) containing PDGF-BB for 24 h followed by culture in DMEM (0.1% FBS) with 1 μM nintedanib for 24 h (i.e., PDGF-BB → with nintedanib)4) culture in DMEM (0.1% FBS) containing PDGF-BB for 24 h followed by culture in DMEM (0.1% FBS) without 1 μM nintedanib which was dissolved in tepid water, for 24 h (i.e., PDGF-BB → without nintedanib)Cell viability was not affected by the addition of 1 μM of nintedanib. Fibroblasts cultured under the (PDGF-BB → with nintedanib) condition showed significantly higher expressions of Rfx2 and Bmpr2 compared with those in fibroblasts cultured under the (PDGF-BB → without nintedanib) condition. Fibroblasts cultured under the (PDGF-BB → without nintedanib) condition showed the same expressions of Rfx2 and Bmpr2 as fibroblasts cultured in DMEM (0.1% FBS) containing PDGF-BB for 24 h. These data are presented in the figure below.2) The authors described the Rfx2 and Bmpr2 genes with significant differences in RNA-sequencing data, but they didn’t show the RT-qPCR data using the same samples or same model samples to confirm the RNA-sequencing data. These secured data or additional experiments using the same mice model to verify the Rfx2, Bmpr2 gene expression should be added.(Response) Additional RT-qPCR and western blot analyses showed that expression of both genes tended to be downregulated in iRA-ILD lung compared with that in age-matched D1CC×D1BB lung, and that this downregulation tended to be ameliorated by nintedanib treatment.We have made the following changes in the revised manuscript:• Figures 4 and 5We have added Rfx2 and Bmpr2 expression data for vehicle-treated, nintedanib-treated, and age-matched mouse lung, as determined by means of RT-qPCR and western blot analysis.• Materials and methods, pages 7–8, lines 170–180We have added our western blotting procedures.• Results, page 21, lines 304–307We have added the text “RT-qPCR and western blotting analyses showed that the expression of Rfx2 was significantly downregulated in the vehicle-treated lung compared with that in the age-matched D1CC×D1BB lung and that this downregulation tended to be ameliorated by nintedanib treatment (Fig 4A–C).”3)The authors used fibroblasts derived from non-fibrotic mice lungs with PDGF-BB stimulation to reveal Rfx2, Bmpr2 gene expression, even if their enrichment analysis and pathway analysis didn’t tell “signal pathway” or “focal adhesion” associated PDGF. The authors should explain the particular reason for using PDGF-BB.(Response) We used PDGF-BB because it binds to PDGF receptor � � , � � , and � � on mesenchymal cells, activates fibroblasts, and is reported to be involved in pathogenesis of fibrotic diseases (Bonner JC. Regulation of PDGF and its receptors in fibrotic diseases. Cytokine Growth Factor Rev. 2004;15:255-273; Hoyle GW, et al. Emphysematous lesions, inflammation, and fibrosis in the lungs of transgenic mice overexpressing platelet-derived growth factor. Am J Pathol. 1999;154:1763-1775; Karakiulakis G, et al. Cell type-specific effect of hypoxia and platelet-derived growth factor-BB on extracellular matrix turnover and its consequences for lung remodeling. J Biol Chem. 2007;282:908-915).In addition, both Rfx2, Bmpr2 gene expressions didn’t alter by PDGF-BB stimulation, suggesting these two gene expressions may not be regulated by the PDGF signaling pathway.(Response) RT-qPCR and western blot analyses showed that Rfx2 and Bmpr2 expressions were reduced in iRA-ILD lung compared with those in D1CC×D1BC lung. ILD develops slowly in iRA-ILD mice, and PDGF-BB is suspected to function mildly compared with that in acutely progressive ILD. Rfx2 and Bmpr2 expressions were downregulated during slow ILD development in our model mice; therefore, we think that neither gene may be regulated by acute stimulation of PDGF-BB. PDGF-BB activates various genes via PDGF–PDGFR signaling, and nintedanib, an inhibitor of PDGFR, FGFR, and VEGFR, is expected to inhibit fibroblast activation through several signaling pathways. Therefore, Rfx2 and Bmpr2 expression in fibroblasts may be affected indirectly through one or more of these pathways.4) In figure 4A, the authors should show isotype control data in addition to 3 different conditions, control, PDGF-BB, and PDGF-BB→nintedanib, similar to in figure 4B, to see the changes by nintedanib treatment.(Response) Nintedanib is a small-molecule tyrosine kinase inhibitor that dissolves in tepid water; therefore, we used water as the control.5) In figure 5C, the authors revealed Bmpr2 was expressed mainly in type I alveolar epithelial cells, but some expression was also observed in type II alveolar epithelial and vascular endothelial cells by in situ hybridization. They also showed Bmpr2 expression in lung fibroblast in figure 4A, indicating nintedanib may affect multiple types of cells. Detailed functional analyses are necessary to r(Response) In our study, we found that Bmpr2 is expressed in type I and II alveolar epithelial cells, vascular endothelial cells, and fibroblasts. The IPF Cell Atlas (http://www.ipfcellatlas.com/), a collection of several single-cell RNA sequencing datasets related to IPF in multi-institutional collaboration published by the Kaminski Lab, also shows BMPR2 expression in these cells, as well as some expression in ciliated, club, and basal cells. BMPR2 mutation is reported to be associated with pulmonary hypertension, and it is reported that BMPR2 expression is reduced in patients with idiopathic pulmonary fibrosis or pulmonary hypertension (Chen NY, et al. Am J Physiol Lung Cell Mol Physiol. 2016;311:L238-254). We think that BMPR2 may function in alveolar epithelium and other vessels for the repair of the pulmonary architecture during ILD progression; however, we agree with the reviewer that further investigations of the function of BMPR2 are needed.Error correction:• Figure 2 B“NC vs, VA” has been changed to “NC vs. VA”.Submitted filename: Response to Reviewers Mikami S et al.docxClick here for additional data file.18 Apr 2022
PONE-D-22-01668R1
Nintedanib induces gene expression changes in the lung of induced-rheumatoid arthritis–associated interstitial lung disease mice
PLOS ONE
Dear Dr. Uematsu,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.The manuscript has been improved by revisions, but one of the reviewers pointed out some major concerns that have not been adequately answered. These points are important and require further improvement.Please submit your revised manuscript by Jun 02 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.We look forward to receiving your revised manuscript.Kind regards,Masataka Kuwana, MD, PhDAcademic EditorPLOS ONEJournal Requirements:Additional Editor Comments (if provided):[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to Questions
Comments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #2: All comments have been addressedReviewer #3: (No Response)********** 2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2: YesReviewer #3: No********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2: YesReviewer #3: Yes********** 4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #2: YesReviewer #3: No********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #2: YesReviewer #3: Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: The authors have made substantial efforts and included new data to answer questions and comments made by the reviewer.Reviewer #3: Comments to the authors:In this study, the authors evaluated the effects of nintedanib on gene expression in the lung of iRA-ILD model mice and revealed that Rfx2 and Bmpr2 were upregulated by nintedanib. But the authors could not confirm the RNA-seq data by RT-qPCR and western blotting using lung tissue.Major commentsThe authors revealed the effects of nintedanib on gene expression in the lung of iRA-ILD model mice and focused on two specific genes, Rfx2 and Bmpr2. They tried to confirm their RNA-seq data by RT-qPCR and western blotting using lung tissue, but there were no statistically significant changes by nintedanib. The authors mentioned nintedanib tended to alleviate the downregulation of Rfx2 and Bmpr2 gene expression or protein expression, but they did not show the p values. It is unclear how many lung tissues the authors used for the confirmation experiments but increasing the number of samples may make a significant difference.RNA-seq results in a small number of cases often cannot be replicable. The author is also necessary to focus on other genes that popped up in RNA-seq data.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: NoReviewer #3: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.31 May 2022Responses to Reviewer 3In this study, the authors evaluated the effects of nintedanib on gene expression in the lung of iRA-ILD model mice and revealed that Rfx2 and Bmpr2 were upregulated by nintedanib. But the authors could not confirm the RNA-seq data by RT-qPCR and western blotting using lung tissue.Major commentsThe authors revealed the effects of nintedanib on gene expression in the lung of iRA-ILD model mice and focused on two specific genes, Rfx2 and Bmpr2. They tried to confirm their RNA-seq data by RT-qPCR and western blotting using lung tissue, but there were no statistically significant changes by nintedanib. The authors mentioned nintedanib tended to alleviate the downregulation of Rfx2 and Bmpr2 gene expression or protein expression, but they did not show the p values. It is unclear how many lung tissues the authors used for the confirmation experiments but increasing the number of samples may make a significant difference.(Response) We thank the reviewer for these insightful suggestions. We added p-values in Figures 4A and C, and Figures 5A and C. We have described the number of samples in the legends of Figures 4 and 5.RNA-seq results in a small number of cases often cannot be replicable. The author is also necessary to focus on other genes that popped up in RNA-seq data.(Response) We found 157 up- and downregulated genes by nintedanib treatment. We now evaluate expression of the several genes in fibroblasts. At the start of the study, we anticipated previously reported or downstream genes of the PDGFR, VEGFR, and FGFR signaling pathways; however, expression of these genes was not affected by nintedanib. In this study, we focused on a gene upregulated by nintedanib treatment, Rfx2, and showed that RFX2 was expressed mainly in the bronchial epithelium. In addition, a gene downregulated by nintedanib treatment, Muc5b, is shown to be expressed in the bronchioles and epithelial cells lining honeycomb cysts [references 44 and 45 in the manuscript]. We speculate that expression changes of these genes by nintedanib treatment may be associated with the differentiation of abnormal cell populations in the peripheral airways for alleviation of pulmonary fibrosis. Recently, Calabrese et al. reported RNA sequencing analysis of aggregates of fibroblasts lined by epithelial cells, which they called “epithelial cell (EC)/fibroblastic foci (FF) sandwich”, in lungs of patients with idiopathic pulmonary fibrosis and primary spontaneous pneumothorax as a control [reference 46]. They extracted EC/FF sandwiches using laser capture microdissection and performed RNA sequencing. They identified 23 upregulated genes in these lesions in idiopathic pulmonary fibrosis compared to those in lungs with primary spontaneous pneumothorax. Furthermore, they selected 14 upregulated genes with log fold-change ≥ 2 out of the 23 upregulated genes. Interestingly, five genes (Scgb3a1, Bpifb1, Pigr, Muc5B, and Krt5) of these 14 upregulated genes coincided with the downregulated genes by nintedanib treatment in the present study. Despite the differences in diseases, species, and sample preparation, these matches are intriguing and suggest that these genes could function in specific areas leading to the development of pulmonary fibrosis. Scgb3a1, Pigr, Bpifb1, and Muc5B are related to secretory and mucin proteins, and immune defenses [reference 46]. Scgb3a1 is shown to be expressed in secretory cells in idiopathic pulmonary fibrosis [reference 47]. The BPIFB1 protein was reported to be upregulated in the small airway epithelium in cystic fibrosis compared to that in the control [reference 48]. PIGR mediates immunoglobulin A for the immune exclusion of inhaled pathogens in bronchial mucosa [reference 49] We previously reported Krt5 expression in hyperplastic bronchiolar cells in a mouse model of bleomycin-induced interstitial pneumonia [reference 13]. Muc5b is expressed in the small airways and epithelial cells lining honeycomb cysts [references 44, 45]. We speculate that these findings suggest that these genes could be involved in the pathogenesis of pulmonary fibrosis or alleviation of pulmonary fibrosis by nintedanib treatment in specific lesions between the small airways and alveoli. Recent gene expression analyses in these lesions are noteworthy for unraveling the mechanism of the development of pulmonary fibrosis, and data accumulation is expected. Further investigations are needed to clarify the function of these five genes.We have made the following changes in the revised manuscript:� Discussion, page 22, line 337-340“However, functional enrichment and pathway analysis showed that fibrosis-related genes such as Col1a1, Fn1, and Acta2 were not enriched in the terms "signaling pathway" and "focal adhesion," which are closely related to these tyrosine kinases,”.� Discussion, page 25-26, line 410-439“Recently, Calabrese et al. identified 23 upregulated genes in aggregates of fibroblasts lined by epithelial cells, which they called epithelial cell/fibroblastic foci sandwich, in lungs with idiopathic pulmonary fibrosis compared to those in lungs with primary spontaneous pneumothorax by RNA sequencing analysis [46]. Intriguingly, five downregulated genes (Scgb3a1, Bpifb1, Pigr, Muc5B, and Krt5) by nintedanib treatment in the present study were included in the 14 upregulated genes with log fold-change ≥ 2 in the 23 upregulated genes. Scgb3a1, Pigr, Bpifb1, and Muc5B are related to secretory and mucin proteins, and immune defenses [46]. Scgb3a1 is expressed in secretory cells in idiopathic pulmonary fibrosis [47]. The BPIFB1 protein was reported to be upregulated in the small airway epithelium in cystic fibrosis compared to that in the control [48]. PIGR mediates immunoglobulin A for immune exclusion of inhaled pathogens in the bronchial mucosa [49]. We previously reported Krt5 expression in hyperplastic bronchiolar cells in a mouse model of bleomycin-induced interstitial pneumonia [13]. Muc5B is reported to be expressed in the small airways and epithelial cells lining honeycomb cysts [44, 45]. These findings imply that these genes could be involved in the development of pulmonary fibrosis and the effect of nintedanib in specific lesions between the peripheral airways and alveoli despite the differences in diseases, species, and sample preparation between the present study and Calabrese’s study. Further investigations are needed to clarify the functions of these genes.”� ReferencesWe added references 46-49.� To unify the term in the text,Page 25, line 400“Mucin5b” was changed to “Mucin5B (Muc5b)”.Page 25, line 403“Mucin5b” was changed to “Muc5b”.� To correct an error,Page 26, line436“iRA-ILS” was changed to “iRA-ILD”.� As requested by the journal office,Materials and methods, Page 4-5, line 95-99We added “All mouse experiments were performed according to the rules and regulations of the Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science and Technology, Japan, and were approved by the Committee on the Ethics of Animal Experiments of Nagoya City University.”Submitted filename: Response to Reviewers.docxClick here for additional data file.3 Jun 2022Nintedanib induces gene expression changes in the lung of induced-rheumatoid arthritis–associated interstitial lung disease micePONE-D-22-01668R2Dear Dr. Uematsu,We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.Kind regards,Masataka Kuwana, MD, PhDAcademic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:9 Jun 2022PONE-D-22-01668R2Nintedanib induces gene expression changes in the lung of induced-rheumatoid arthritis–associated interstitial lung disease miceDear Dr. Uematsu:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.If we can help with anything else, please email us at plosone@plos.org.Thank you for submitting your work to PLOS ONE and supporting open access.Kind regards,PLOS ONE Editorial Office Staffon behalf ofProf. Masataka KuwanaAcademic EditorPLOS ONE
Authors: Irina G Luzina; Mariah V Salcedo; Mónica L Rojas-Peña; Anne E Wyman; Jeffrey R Galvin; Ashutosh Sachdeva; Andrew Clerman; June Kim; Teri J Franks; Edward J Britt; Jeffrey D Hasday; Si M Pham; Allen P Burke; Nevins W Todd; Sergei P Atamas Journal: Cell Immunol Date: 2018-01-03 Impact factor: 4.868
Authors: Nina Rol; Michiel A de Raaf; Xiaoqing Q Sun; Vincent P Kuiper; Denielli da Silva Gonçalves Bos; Chris Happé; Kondababu Kurakula; Chris Dickhoff; Raphael Thuillet; Ly Tu; Christophe Guignabert; Ingrid Schalij; Kirsten Lodder; Xiaoke Pan; Franziska E Herrmann; Geerten P van Nieuw Amerongen; Pieter Koolwijk; Anton Vonk-Noordegraaf; Frances S de Man; Lutz Wollin; Marie-José Goumans; Robert Szulcek; Harm J Bogaard Journal: Cardiovasc Res Date: 2019-02-01 Impact factor: 10.787
Authors: Pierre-Antoine Juge; Joyce S Lee; Esther Ebstein; Hiroshi Furukawa; Evgenia Dobrinskikh; Steven Gazal; Caroline Kannengiesser; Sébastien Ottaviani; Shomi Oka; Shigeto Tohma; Naoyuki Tsuchiya; Jorge Rojas-Serrano; Montserrat I González-Pérez; Mayra Mejía; Ivette Buendía-Roldán; Ramcés Falfán-Valencia; Enrique Ambrocio-Ortiz; Effrosyni Manali; Spyros A Papiris; Theofanis Karageorgas; Dimitrios Boumpas; Katarina Antoniou; Coline H M van Moorsel; Joanne van der Vis; Yaël A de Man; Jan C Grutters; Yaping Wang; Raphaël Borie; Lidwine Wemeau-Stervinou; Benoît Wallaert; René-Marc Flipo; Hilario Nunes; Dominique Valeyre; Nathalie Saidenberg-Kermanac'h; Marie-Christophe Boissier; Sylvain Marchand-Adam; Aline Frazier; Pascal Richette; Yannick Allanore; Jean Sibilia; Claire Dromer; Christophe Richez; Thierry Schaeverbeke; Huguette Lioté; Gabriel Thabut; Nadia Nathan; Serge Amselem; Martin Soubrier; Vincent Cottin; Annick Clément; Kevin Deane; Avram D Walts; Tasha Fingerlin; Aryeh Fischer; Jay H Ryu; Eric L Matteson; Timothy B Niewold; Deborah Assayag; Andrew Gross; Paul Wolters; Marvin I Schwarz; Michael Holers; Joshua J Solomon; Tracy Doyle; Ivan O Rosas; Cornelis Blauwendraat; Mike A Nalls; Marie-Pierre Debray; Catherine Boileau; Bruno Crestani; David A Schwartz; Philippe Dieudé Journal: N Engl J Med Date: 2018-10-20 Impact factor: 91.245
Authors: Lutz Wollin; Jörg H W Distler; Elizabeth F Redente; David W H Riches; Susanne Stowasser; Rozsa Schlenker-Herceg; Toby M Maher; Martin Kolb Journal: Eur Respir J Date: 2019-09-19 Impact factor: 16.671
Authors: Ganesh Raghu; Martine Remy-Jardin; Jeffrey L Myers; Luca Richeldi; Christopher J Ryerson; David J Lederer; Juergen Behr; Vincent Cottin; Sonye K Danoff; Ferran Morell; Kevin R Flaherty; Athol Wells; Fernando J Martinez; Arata Azuma; Thomas J Bice; Demosthenes Bouros; Kevin K Brown; Harold R Collard; Abhijit Duggal; Liam Galvin; Yoshikazu Inoue; R Gisli Jenkins; Takeshi Johkoh; Ella A Kazerooni; Masanori Kitaichi; Shandra L Knight; George Mansour; Andrew G Nicholson; Sudhakar N J Pipavath; Ivette Buendía-Roldán; Moisés Selman; William D Travis; Simon Walsh; Kevin C Wilson Journal: Am J Respir Crit Care Med Date: 2018-09-01 Impact factor: 21.405
Authors: Arun C Habermann; Austin J Gutierrez; Linh T Bui; Stephanie L Yahn; Nichelle I Winters; Carla L Calvi; Lance Peter; Mei-I Chung; Chase J Taylor; Christopher Jetter; Latha Raju; Jamie Roberson; Guixiao Ding; Lori Wood; Jennifer M S Sucre; Bradley W Richmond; Ana P Serezani; Wyatt J McDonnell; Simon B Mallal; Matthew J Bacchetta; James E Loyd; Ciara M Shaver; Lorraine B Ware; Ross Bremner; Rajat Walia; Timothy S Blackwell; Nicholas E Banovich; Jonathan A Kropski Journal: Sci Adv Date: 2020-07-08 Impact factor: 14.136