| Literature DB >> 35685641 |
Qian Lou1, Tianyi Xin1, Wenjie Xu1, Ranjun Li1, Jingyuan Song1,2,3.
Abstract
Background: There has been global concern about the safety and accuracy of traditional Chinese patent medicines (TCPMs). Panax notoginseng, also known as sanqi, is an important constituent of TCPMs. However, identifying the species contained in TCPMs is challenging due to the presence of multiple ingredients and the use of various preparation processes. Objective: To detect P. notoginseng in TCPMs.Entities:
Keywords: Panax notoginseng; TaqMan probe; identification; quantitative real-time PCR; traditional Chinese patent medicine
Year: 2022 PMID: 35685641 PMCID: PMC9171072 DOI: 10.3389/fphar.2022.828948
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.988
FIGURE 1The samples used in this study. (A) 25 batches of traditional Chinese patent medicines; (B) Four samples of Chinese materia medicas:1) Panax notoginseng; 2) Curcuma aromatica Salisb. cv. Wenyujin; 3) Panax ginseng; 4) Panax quinquefolium; (C) Different dosage forms of traditional Chinese patent medicines: 1) Powder; 2) Capsule; 3) Tablet; 4) Suppository.
The information of traditional Chinese patent medicine samples.
| Dosage form | Batch | Origin | Lot no. | Sample |
|---|---|---|---|---|
| Powder | Sanqi Fen | Beijing | 20190102 | 3 |
| Sheng Sanqi San | Guangxi | 200506 | 3 | |
| Capsule | Xiaoshuan Tongluo Jiaonang | Liaoning | 201003 | 3 |
| Sanqi Jiaonang | Yunnan | 1906040 | 3 | |
| Yunnan | 2008022 | 3 | ||
| Hangzhou | 200601 | 3 | ||
| Tablet | Sanqi Pian | Beijing | 20120395 | 3 |
| Sanqi Shangyao Pian | Jilin | 20200820 | 3 | |
| Fufang Danshen Pian | Guangzhou | F20A011 | 3 | |
| Guangzhou | C21A004 | 3 | ||
| Guangzhou | F18A026 | 3 | ||
| Beijing | 20120923 | 3 | ||
| Beijing | 20120476 | 3 | ||
| Beijing | 20120862 | 3 | ||
| Shanghai | 2010114 | 3 | ||
| Guangzhou | 3200802 | 3 | ||
| Xiaoshuan Tongluo Pian | Beijing | 20121172 | 3 | |
| Beijing | 19121180 | 3 | ||
| Heilong Jiang | 171001 | 3 | ||
| Heilong Jiang | 180302 | 3 | ||
| Suppository | Shexiang Zhichuang Shuan | Hubei | 210519 | 3 |
| Hubei | 200603 | 3 | ||
| Hubei | 2004003 | 3 | ||
| Hubei | 2006005 | 3 | ||
| Hubei | 200110 | 3 | ||
| Total | 75 |
The sequences of primers and probe used in this study.
| Sequence (5′-3′) | References | |
|---|---|---|
| ITS2 2F | ATGCGATACTTGGTGTGAAT |
|
| ITS2 3R | GACGCTTCTCCAGACTACAAT |
|
| SQ 3F | ATTAGGCCGAGGGCACGTCT | This study |
| SQ 3R | GCATTTGGGCCAACCGCG | This study |
| Probe | ATCATTCCCTCGCGGGAGTCGATGC | This study |
FIGURE 2The specificity and sensitivity of the TaqMan probe based quantitative real-time PCR assay. (A) The specificity of the qPCR assay. Blue: Three samples of Panax notoginseng; Wathet: Three samples of Curcuma aromatica Salisb. cv. Wenyujin; Red: Three samples of Panax ginseng; Green: Three samples of Panax quinquefolium; Yellow: Blank control. (B) The sensitivity of the TaqMan probe based quantitative real-time PCR assay. Line①–⑧: DNA concentrations were 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001 ng/μl, respectively; Line ⑨: Negative control.
FIGURE 3Detection of Panax notoginseng in traditional Chinese patent medicines. (A) Three samples of Sanqi Fen (whathet), three samples of Sheng Sanqi San (blue), nine samples of Sanqi Jiaonang (red) and three samples of Xiaoshuan Tongluo Jiaonang (green); (B) Three samples of Sanqi Pian (Rosered), three samples of Sanqi Shangyao Pian (green) and 12 samples of Xiaoshuan Tongluo Pian (blue); (C) 21 samples of Fufang Danshen Pian (blue); (D) 15 samples of Shexiang Zhichuang Shuan (blue); Yellow lines in all the pictures represent negative control.