Molting is a widespread developmental process in which the external extracellular matrix (ECM), the cuticle, is remodeled to allow for organismal growth and environmental adaptation. Studies in the nematode Caenorhabditis elegans have identified a diverse set of molting-associated factors including signaling molecules, intracellular trafficking regulators, ECM components, and ECM-modifying enzymes such as matrix metalloproteases. C. elegans NEKL-2 and NEKL-3, two conserved members of the NEK family of protein kinases, are essential for molting and promote the endocytosis of environmental steroid-hormone precursors by the epidermis. Steroids in turn drive the cyclic induction of many genes required for molting. Here we report a role for the sole C. elegans ADAM-meltrin metalloprotease family member, ADM-2, as a mediator of molting. Loss of adm-2, including mutations that disrupt the metalloprotease domain, led to the strong suppression of molting defects in partial loss-of-function nekl mutants. ADM-2 is expressed in the epidermis, and its trafficking through the endo-lysosomal network was disrupted after NEKL depletion. We identified the epidermally expressed low-density lipoprotein receptor-related protein, LRP-1, as a candidate target of ADM-2 regulation. Whereas loss of ADM-2 activity led to the upregulation of apical epidermal LRP-1, ADM-2 overexpression caused a reduction in LRP-1 levels. Consistent with this, several mammalian ADAMs, including the meltrin ADAM12, have been shown to regulate mammalian LRP1 via proteolysis. In contrast to mammalian homologs, however, the regulation of LRP-1 by ADM-2 does not appear to involve the metalloprotease function of ADM-2, nor is proteolytic processing of LRP-1 strongly affected in adm-2 mutants. Our findings suggest a noncanonical role for an ADAM family member in the regulation of a lipoprotein-like receptor and lead us to propose that endocytic trafficking may be important for both the internalization of factors that promote molting as well as the removal of proteins that can inhibit the process.
Molting is a widespread developmental process in which the external extracellular matrix (ECM), the cuticle, is remodeled to allow for organismal growth and environmental adaptation. Studies in the nematode Caenorhabditis elegans have identified a diverse set of molting-associated factors including signaling molecules, intracellular trafficking regulators, ECM components, and ECM-modifying enzymes such as matrix metalloproteases. C. elegans NEKL-2 and NEKL-3, two conserved members of the NEK family of protein kinases, are essential for molting and promote the endocytosis of environmental steroid-hormone precursors by the epidermis. Steroids in turn drive the cyclic induction of many genes required for molting. Here we report a role for the sole C. elegans ADAM-meltrin metalloprotease family member, ADM-2, as a mediator of molting. Loss of adm-2, including mutations that disrupt the metalloprotease domain, led to the strong suppression of molting defects in partial loss-of-function nekl mutants. ADM-2 is expressed in the epidermis, and its trafficking through the endo-lysosomal network was disrupted after NEKL depletion. We identified the epidermally expressed low-density lipoprotein receptor-related protein, LRP-1, as a candidate target of ADM-2 regulation. Whereas loss of ADM-2 activity led to the upregulation of apical epidermal LRP-1, ADM-2 overexpression caused a reduction in LRP-1 levels. Consistent with this, several mammalian ADAMs, including the meltrin ADAM12, have been shown to regulate mammalian LRP1 via proteolysis. In contrast to mammalian homologs, however, the regulation of LRP-1 by ADM-2 does not appear to involve the metalloprotease function of ADM-2, nor is proteolytic processing of LRP-1 strongly affected in adm-2 mutants. Our findings suggest a noncanonical role for an ADAM family member in the regulation of a lipoprotein-like receptor and lead us to propose that endocytic trafficking may be important for both the internalization of factors that promote molting as well as the removal of proteins that can inhibit the process.
The cuticle of Caenorhabditis elegans is an external extracellular matrix (ECM) required for locomotion, body shape maintenance, and protection from the environment [1,2]. During larval development C. elegans undergoes four molts, a specialized form of apical ECM remodeling, whereby a new cuticle is synthesized under the old cuticle, which is partially degraded and shed [1,2]. C. elegans molting cycles are orchestrated by conserved steroid-hormone receptors, including NHR-23 (an ortholog of human RORC) and NHR-25 (an ortholog of human NR5A1), which collectively control the oscillation of hundreds of mRNAs [2-4]. The production of molting-specific steroid-hormone ligands is thought to be dependent on the uptake of environmental sterols by epidermally expressed LRP-1 (the homolog of human LRP2/megalin), a member of the low-density lipoprotein receptor–related protein family [5,6]. Consistent with this, internalization of LRP-1 by clathrin-mediated endocytosis (CME) is essential for normal molting [2,5-7].We have previously shown that the C. elegans protein kinases NEKL-2 (an ortholog of human NEK8/9) and NEKL-3 (an ortholog of human NEK6/7) promote endocytosis of LRP-1 at the apical epidermal plasma membrane. Correspondingly, loss of either NEKL-2 or NEKL-3 function leads to a reduction or delay in the expression of molting genes, a failure to complete molting, and larval arrest [2,8-12]. NEKL-2 and NEKL-3 (NEKLs) are members of the NIMA-related kinase (NEK) protein family, mammalian orthologs of which have been studied primarily in the context of cell cycle regulation and ciliogenesis [13-28]. C. elegans NEKLs bind to and co-localize with several conserved ankyrin-repeat proteins including, MLT-2 (an ortholog of human ANKS6), MLT-3 (an ortholog of human ANKS3), and MLT-4 (an ortholog of human INVS), referred to here collectively as MLTs, which are essential for the proper localization of NEKLs [9]. Correspondingly, loss of MLT functions leads to molting defects that are identical to those observed with loss of the NEKLs [9]. NEKLs and MLTs form two distinct complexes (NEKL-2–MLT-2–MLT-4 and NEKL-3–MLT-3) and are expressed in a punctate pattern in the large epidermal syncytium known as hyp7, in which they are specifically required [2,8,9].The cellular and physiological mechanisms by which NEKLs–MLTs impact the molting process through intracellular trafficking have yet to be fully explored. Previous work suggests that NEKLs are required for the uptake and processing of membrane cargo, including LRP-1, which in turn promote molting [11, 29]. Using a forward-genetics suppressor approach [30], we previously found that loss of AP2 clathrin-adapter subunits, as well as the AP2 allosteric activator FCHO-1 can suppress molting and trafficking defects in NEKL mutants [11]. These and other studies revealed that NEKLs control endocytosis in part by facilitating the uncoating of sub-apical clathrin-coated vesicles and may affect additional trafficking processes through the regulation of actin via the CDC-42–SID-3 (corresponding to the human CDC42–ACK1/2) pathway [10,11].Here we report suppression of nekl molting defects by loss of the conserved ADM-2 transmembrane metalloprotease. Although proteases have previously been implicated as positive regulators of molting, our data is consistent with ADM-2 exerting a negative influence on the molting process. ADM-2 belongs to the ADAM (a disintegrin and metalloprotease) family of metallopeptidases, which are members of the zinc protease superfamily [31,32]. ADM-2 is the sole member of the meltrin metalloprotease subfamily in C. elegans [33,34], which in humans consists of ADAM9 (Meltrin γ), ADAM12 (Meltrin α), ADAM19 (Meltrin β), and ADAM33 [35,36]. ADAM/meltrin family proteins function as “sheddases”, cleaving target peptides that are positioned at or near the outer leaflet of the plasma membrane [31,32,37-51]. Notably, knockouts of meltrin family members in mammals have generally not provided clear insights into the roles of meltrins in vivo during development, which may in part be due to genetic redundancies [33,52,53]. Here we show that, unlike AP2 and fcho-1 mutants, loss of ADM-2 function did not suppress nekl-associated trafficking defects. Rather, ADM-2 was itself dependent on NEKL–MLTs for its trafficking through the endocytic pathway. Moreover, ADM-2 appears to regulate LRP-1 through a mechanism that is independent of its proteolytic activity. Collectively, our studies suggest that NEKLs may be required for the internalization of both positive and negative regulators of molting.
Results
nekl molting defects are suppressed by reduced function of the ADM-2 metalloprotease
We previously described an approach to identify genetic suppressors of partial loss-of-function mutations in NEKL kinases [30]. Whereas strains homozygous for either nekl-2(fd81) or nekl-3(gk894345) weak loss-of-function alleles are viable, nekl-2(fd81); nekl-3(gk894345) double mutants (hereafter referred to as nekl-2; nekl-3 mutants) are synthetically lethal and exhibit ~98.5% larval arrest due to L2/L3 molting defects [9]. In the absence of a suppressor mutation, propagation of nekl-2; nekl-3 mutants requires the presence of a nekl-2 or nekl-3 transgenic rescuing array (GFP+; Fig 1A and 1E). In contrast, strains homozygous for the suppressor alleles fd130 or fd163 of are ~80% viable and propagate in the absence of a rescuing array (GFP–; Fig 1B, 1C and 1E).
Fig 1
Loss of ADM-2 function suppresses nekl molting defects.
(A) DIC image of nekl-2; nekl-3 double-mutant worms. The adult worm contains a rescuing extrachromosomal array (nekl-3; sur-5::GFP). An arrested larva is marked by the white arrow and enlarged in the inset; the white bracket indicates the constricted region containing a double cuticle. (B, C) DIC images of nekl-2; nekl-3 double-mutant adult worms containing the adm-2(fd130) (B) and adm-2(fd163) (C) mutant alleles. Bar size in A = 100 μm (for A–C); in inset, 20 μm. (D) Schematic diagram of the adm-2 locus. Solid black rectangles indicate exons; introns are demarcated by black lines. Locations of the fd163, fd130, fd208, and fd243–fd247 alleles are indicated by arrows. Large deletion alleles fd298–fd302, fd313, fd316–fd318, fd228–fd230, and fd235–fd237 are indicated by orange and blue lines. (E) Bar plot showing percentage of viable adult-stage nekl-2; nekl-3 worms with the indicated adm-2 alleles (or RNAi); + indicates wild-type adm-2. (F) Bar plot showing reversion of suppression in nekl-2; nekl-3 adm-2(fd130) mutants by fosmids expressing wild-type adm-2 and by an adm-2 cDNA fused to GFP (pDF417). Fosmid #1 and #2 indicate two independent extrachromosomal lines. (G) Bar plot showing failure to suppress molting defects in nekl–mlt hypomorphic mutants by adm-2 null mutants [nekl-2(fd91); adm-2(fd313), nekl-3(sv3); adm-2(fd316), and mlt-4(sv9); adm-2(fd317)]. Error bars in E–G represent 95% confidence intervals. p-Values were determined using Fisher’s exact test; ****p ≤ 0.0001. Raw data for this figure is provided in S1 File.
Loss of ADM-2 function suppresses nekl molting defects.
(A) DIC image of nekl-2; nekl-3 double-mutant worms. The adult worm contains a rescuing extrachromosomal array (nekl-3; sur-5::GFP). An arrested larva is marked by the white arrow and enlarged in the inset; the white bracket indicates the constricted region containing a double cuticle. (B, C) DIC images of nekl-2; nekl-3 double-mutant adult worms containing the adm-2(fd130) (B) and adm-2(fd163) (C) mutant alleles. Bar size in A = 100 μm (for A–C); in inset, 20 μm. (D) Schematic diagram of the adm-2 locus. Solid black rectangles indicate exons; introns are demarcated by black lines. Locations of the fd163, fd130, fd208, and fd243–fd247 alleles are indicated by arrows. Large deletion alleles fd298–fd302, fd313, fd316–fd318, fd228–fd230, and fd235–fd237 are indicated by orange and blue lines. (E) Bar plot showing percentage of viable adult-stage nekl-2; nekl-3 worms with the indicated adm-2 alleles (or RNAi); + indicates wild-type adm-2. (F) Bar plot showing reversion of suppression in nekl-2; nekl-3 adm-2(fd130) mutants by fosmids expressing wild-type adm-2 and by an adm-2 cDNA fused to GFP (pDF417). Fosmid #1 and #2 indicate two independent extrachromosomal lines. (G) Bar plot showing failure to suppress molting defects in nekl–mlt hypomorphic mutants by adm-2 null mutants [nekl-2(fd91); adm-2(fd313), nekl-3(sv3); adm-2(fd316), and mlt-4(sv9); adm-2(fd317)]. Error bars in E–G represent 95% confidence intervals. p-Values were determined using Fisher’s exact test; ****p ≤ 0.0001. Raw data for this figure is provided in S1 File.Using our protocols for whole-genome sequencing and bioinformatical analysis [30], we identified the causal mutation corresponding to fd130 to be a G-to-A transition in exon 10 of adm-2/C04A11.4 (Fig 1D). fd130 converts codon 494 (TGG; W) into a premature translational termination signal (TGA; stop codon), resulting in the predicted truncation of the 952-amino-acid protein. Correspondingly, the independently isolated allele fd163 is a G-to-A transition in the conserved 5’ splice donor sequence in the first intron of adm-2 (GT to AT) (Fig 1D). The resulting intron-retaining mutation is predicted to result in a stop codon immediately following R66. Using CRISPR/Cas9 methods we isolated several additional adm-2 alleles including fd208, a 1-bp deletion that causes a frameshift after Y479, along with fd229, a deletion that spans exons 4–10 and results in frame shifts after S123 (Fig 1D). Like fd130 and fd163, these alleles led to similarly robust suppression of molting defects in the nekl-2; nekl-3 background and are predicted to result in strong or complete loss of ADM-2 function (Fig 1E).Several additional pieces of evidence indicate that it is loss of ADM-2 function that leads to suppression of nekl-2; nekl-3 molting defects. (1) adm-2 mutations that suppress these molting defects (e.g., fd130 and fd163) are fully recessive (see Materials and Methods). (2) Extrachromosomal expression of a fosmid clone containing wild-type genomic ADM-2 sequences strongly reversed suppression in nekl-2; nekl-3 adm-2 mutants as did a plasmid (pDF417) encoding an ADM-2::GFP fusion under the control of the adm-2 promoter (Fig 1F). (3) RNAi of adm-2 led to significant suppression of molting defects in nekl-2; nekl-3 mutants (Fig 1E). We note that loss of adm-2 in wild-type backgrounds, including a strong loss-of-function deletion allele, fd300, did not appear to impair development, health, or fecundity, indicating that adm-2 is a non-essential gene (S1A Fig). Consistent with this, no phenotypes have been previously ascribed to adm-2 mutations.ADM-2 is a member of the ADAM (a disintegrin and metalloprotease) family of metallopeptidases, with its closest human homologs belonging to the meltrin subfamily (ADAM9/12/19/33) [33,35,36]. Meltrins are notable for having functional proteases that contain a histidine-coordinated zinc-binding site (HExxHxxGxxH), which is also found in ADM-2 (S2 Fig) [54,55]. To determine if the putative metalloprotease activity of ADM-2 is important for its influence on molting, we CRISPR-engineered an ADM-2 variant in which the three conserved histidine residues within the predicted Zn-binding domain were altered [Zn-MTP: H312–H322 (HELGHTFGMDH > DALAYTFRMDY)]. Notably, this change led to the strong suppression of molting defects in nekl-2; nekl-3 mutants, indicating that the ADM-2 metalloproteinase activity can impact the molting process (Fig 1E). Like other meltrins, ADM-2 also contains an N-terminal cysteine switch, cysteine loop, and disintegrin domain, a transmembrane domain, and several predicted SH3-binding sites in its cytoplasmic C terminus (S2 Fig; also see below) [32,56]. Although linked to a range of human diseases, individual loss-of-function mutations in mouse meltrins have generally not produced robust developmental defects, and no phenotypes have been associated with either of the two Drosophila meltrin family members [33,52,53].We note that WormBase annotates two adm-2 isoforms that are identical through exon 18 (corresponding to aa A915) but differ at the 5’ ends of their 19th (terminal) exons; adm-2a and adm-2b are predicted to encode 952 and 929 aa proteins, respectively. The noncanonical 18th intron acceptor site of adm-2b (5-‘GCAAAAG-3’) occurs 7 bp upstream of the corresponding acceptor site of adm-2a (5’-ATTTCAG-3’) and terminates translation 76 bp upstream of the stop codon of adm-2a. The peptide regions corresponding to exon 19 of adm-2a (37 aa) and adm-2b (14 aa) do not contain any known domains nor were homologies detected with other proteins.To determine if other C. elegans ADAM and ADAM-TS family members may also contribute to molting control, we tested ten other family members for their ability to suppress nekl-2; nekl-3 molting defects (S1B and S1C Fig). We failed to detect suppression after inhibition of each gene using RNAi (dsRNA) injection methods, which were effective in promoting suppression when targeting adm-2. Thus, the suppression of nekl-associated molting defects by adm-2 appears unique among the C. elegans ADAM family members.
ADM-2 is expressed in multiple tissues including the epidermis
To gain insight into how ADM-2 may affect molting in nekl mutants, we examined endogenously tagged adm-2::mScarlet and adm-2::GFP strains, in which the fluorescent marker was fused to the C terminus of the ADM-2a cytoplasmic domain. Both CRISPR-tagged versions showed a punctate pattern within hyp7, a large epidermal syncytium that encompasses most of the central body region of the worm, including localization to small puncta near the apical membrane (Fig 2A–2E’). Notably, both NEKLs and MLTs are specifically expressed and required in the hyp7 syncytium [8,9]. We also detected some differences between the localization patterns of ADM-2::mScarlet and ADM-2::GFP. In particular, ADM-2::mScarlet was observed in larger vesicular and tubular-like structures throughout the epidermis, whereas these structures were mostly absent in ADM-2::GFP worms (Fig 2A–2D; also see below).
Fig 2
Expression of endogenously tagged ADM-2.
(A–D and A’) Representative confocal images of ADM-2 expression in the C. elegans hyp7 region. ADM-2::mScarlet (A, B) and ADM-2::GFP (C, D) expression at apical (A, C) and medial (B, D) planes. A’ is the inset from panel A. Bar in B = 5 μm (for A–D); in inset A’ = 5 μm. (E–G and E’–G’) Representative DIC (E–G) and confocal (E’–G’) images of ADM-2 expression. ADM-2::mScarlet in the hyp7 hypodermis; seam cells; sensory neurons; and ALM, DNC, and VNC neurons (E, E’) and in spermatheca (G, G’). ADM-2::GFP expression in the distal germline, oocytes, and spermatheca (F, F’). Bar in E’ = 50 μm (for E, E’); in G’ = 10 μm (for G, G’); in F’ = 50 μm (for F, F’).
Expression of endogenously tagged ADM-2.
(A–D and A’) Representative confocal images of ADM-2 expression in the C. elegans hyp7 region. ADM-2::mScarlet (A, B) and ADM-2::GFP (C, D) expression at apical (A, C) and medial (B, D) planes. A’ is the inset from panel A. Bar in B = 5 μm (for A–D); in inset A’ = 5 μm. (E–G and E’–G’) Representative DIC (E–G) and confocal (E’–G’) images of ADM-2 expression. ADM-2::mScarlet in the hyp7 hypodermis; seam cells; sensory neurons; and ALM, DNC, and VNC neurons (E, E’) and in spermatheca (G, G’). ADM-2::GFP expression in the distal germline, oocytes, and spermatheca (F, F’). Bar in E’ = 50 μm (for E, E’); in G’ = 10 μm (for G, G’); in F’ = 50 μm (for F, F’).ADM-2 was also detectable in seam cells, a lateral epidermal syncytium that borders hyp7 along the length of the animal (Fig 2E and 2E’); in the anterior epidermis (S3A and A’); and in a variety of head, tail, and centrally located neurons (Figs 2E and 2E’; S3B–S3C and S3B’–S3C’). In addition, ADM-2 was observed in proximal oogenic cells of the hermaphrodite germline, with levels increasing in maturing oocytes, where it was localized to the cytoplasm and plasma membrane (Fig 2F and 2F’). Likewise, ADM-2 is expressed in fertilized oocytes (Fig 2F and 2F’) and throughout embryogenesis (S3D–S3F and S3D’–S3F’ Fig). In contrast, ADM-2 was not detected in mature sperm cells but was expressed in myoepithelial cells of the hermaphrodite spermatheca (Fig 2G and 2G’). We also note that a functional P::ADM-2::GFP multicopy reporter (Fig 1F) displayed strongest expression in neurons where it accumulated at or near the plasma membrane (S3G Fig). Although these findings are consistent with ADM-2 acting in the major epidermis to affect molting, it is possible that ADM-2 could also affect molting through a nonautonomous mechanism. In addition, our findings suggest that ADM-2 likely functions in other tissues to affect processes other than molting.
ADM-2 is trafficked through endo-lysosomal compartments and is sensitive to NEKL activities
To determine the identity of ADM-2 puncta, vesicles, and tubular-like structures in the epidermis, we performed colocalization experiments first using a CRISPR-tagged clathrin heavy chain marker, GFP::CHC-1 [11]. Although statistically insignificant, occasional colocalization between ADM-2::mScarlet and apical clathrin was detected (Figs 3A–3C’ and S4A). We note that endogenous plasma membrane–localized ADM-2::GFP and ADM-2::mScarlet both presented with extremely faint signals within hyp7 (Fig 2A and 2C, respectively), making detection and colocalization of this population difficult to assay relative to other compartments; this suggests that ADM-2 may be rapidly turned over at the plasma membrane, either by CME or through a CME-independent mechanism. We note that mammalian ADAMs, including the meltrin family, are internalized via CME [57-60]. In addition, we observed little or no colocalization between ADM-2::mScarlet and medial GFP::CHC-1 clathrin-containing structures (S4C–S4E’ Fig), which may represent clathrin-coated vesicles emanating from the trans Golgi or endosomes.
Fig 3
ADM-2 localization to endocytic compartments is affected by NEKLs.
(A–L) Co-localization analysis of ADM-2::mScarlet with GFP::CHC-1 (A–C), Phyp7::HGRS-1::GFP (D–F), and LysoTracker Green (G–L) within apical (A–C) and sub-apical or medial (D–L) planes of hyp7. A’–F’ are insets of A–F confocal images. White arrowheads in C’ and F’ indicate colocalized puncta. For LysoTracker studies (G–L), representative confocal images during intermolt (G–I) and molting (J–L) stages are shown. (M–P) Apical hyp7 ADM-2::mScarlet localization in auxin-treated wild-type (M), nekl-2::AID (N), and nekl-3::AID (O) 2-day-old adults with average mean intensity calculations (P). Group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ****p ≤ 0.0001, **p ≤ 0.01. Bar in M = 5 μm (for A–F and M–O); in F’ = 5 μm (for insets A’–F’); in L = 5 μm (for G–L). Raw data for this figure is provided in S1 File.
ADM-2 localization to endocytic compartments is affected by NEKLs.
(A–L) Co-localization analysis of ADM-2::mScarlet with GFP::CHC-1 (A–C), Phyp7::HGRS-1::GFP (D–F), and LysoTracker Green (G–L) within apical (A–C) and sub-apical or medial (D–L) planes of hyp7. A’–F’ are insets of A–F confocal images. White arrowheads in C’ and F’ indicate colocalized puncta. For LysoTracker studies (G–L), representative confocal images during intermolt (G–I) and molting (J–L) stages are shown. (M–P) Apical hyp7 ADM-2::mScarlet localization in auxin-treated wild-type (M), nekl-2::AID (N), and nekl-3::AID (O) 2-day-old adults with average mean intensity calculations (P). Group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ****p ≤ 0.0001, **p ≤ 0.01. Bar in M = 5 μm (for A–F and M–O); in F’ = 5 μm (for insets A’–F’); in L = 5 μm (for G–L). Raw data for this figure is provided in S1 File.In contrast, ADM-2::mScarlet exhibited partial colocalization with the endosomal marker Phyp7::hgrs-1::GFP in both the sub-apical and medial planes (Figs 3D–3F’, S4A, S4B, S4F–S4H and S4F’–S4H’). HGRS-1/HRS localizes to early endosomes and multivesicular bodies and is a component of the ESCRT-0 complex, which, together with ESCRT-I–III, promotes cargo sorting and lysosomal targeting [61-64]. Consistent with this, medial ADM-2::mScarlet showed strong co-localization within the lysosomal marker LysoTracker Green during intermolts (Fig 3G–3I), when lysosomes appear roughly spherical, and during molting periods (Fig 3J–3L), when lysosomes acquire a tubular morphology [65]. Thus, following rapid uptake into endosomes, ADM-2 is likely degraded by lysosomes, although some portion may be recycled back to the plasma membrane. Degradation of ADM-2 by lysosomes is further supported by the relative absence of medial ADM-2::GFP accumulation (Fig 2D), as GFP is acid sensitive and fluorescence is rapidly quenched within maturing endosomes and lysosomes [65,66].Given our previous observations showing that NEKL–MLT proteins are required for normal trafficking within hyp7 [8,10,11], we tested if depletion of NEKLs caused changes in the abundance and subcellular localization of ADM-2. Notably, we observed total levels of ADM-2::mScarlet to increase slightly in auxin-treated nekl-2::AID adults, with more robust changes occurring in auxin-treated nekl-3::AID animals (Fig 3M–3P). Consistent with this, partial knockdown of MLT-3 in adults by RNAi led to modest increases in the levels of ADM-2::mScarlet and GFP::CHC-1 (S5A and S5B Fig). In worms that had undergone NEKL::AID depletion, ADM-2::mScarlet increased slightly in total levels and accumulated in large internal endocytic or lysosome-like structures (Fig 3M–3P). Collectively, these findings indicate that NEKL activities impact ADM-2 trafficking within hyp7.
Suppression by ADM-2 occurs via a mechanism that is distinct from previous nekl suppressors
Loss of AP2 clathrin-adapter subunits and loss of the AP2 activator FCHO-1 individually suppress strong and/or null mutations in NEKLs and MLTs through their effects on CME [11]. We therefore tested if an adm-2 null mutation could also suppress strong loss-of-function alleles of nekls and mlts. Notably, loss of adm-2 was unable to restore viability to nekl-2(fd91), nekl-3(sv3), or mlt-4(sv9) strong loss-of-function alleles, which typically arrest as partially constricted L2/L3 larvae (Fig 1G). In contrast, knockdown of the sigma subunit of the AP2 complex led to ~60–85% viability in these genetic backgrounds [11]. These results suggest that the mechanisms underlying the suppression of molting defects by adm-2 and CME-associated trafficking factors may be distinct.To directly test if loss of ADM-2 can suppress CME defects in nekls, we examined the localization of GFP-tagged LRP-1/megalin, an apical transmembrane cargo that is trafficked via CME and is required for molting [2,5-7]. Using the auxin-inducible degron (AID) system to remove NEKL-3 activity in 1-day-old adult worms [11], we observed a dramatic accumulation of LRP-1::GFP at or near the apical membrane (Fig 4A and 4D), consistent with our previous findings [11]. As anticipated, loss of FCHO-1 partially corrected LRP-1::GFP mislocalization defects in NEKL-3::AID-depleted worms (Fig 4B and 4D), consistent with the ability of fcho-1 mutations to suppress nekl-associated clathrin localization and mobility defects [11]. In contrast, loss of adm-2 failed to correct LRP-1::GFP defects in NEKL-3::AID-depleted adults and surprisingly showed slightly enhanced apical LRP-1::GFP accumulation relative to adm-2 NEKL-3::AID-depleted worms (Fig 4C and 4D; also see below). Collectively, these results indicate that loss of adm-2 function does not suppress nekl molting defects by correcting CME deficits and is therefore likely to act through a distinct mechanism.
Fig 4
Loss of adm-2 function does not correct the nekl trafficking defects.
(A–C) Representative confocal images of 2-day-old adult worms expressing LRP-1::GFP in the apical hyp7 region of the epidermis. LRP-1 expression in the nekl-3::AID (A), nekl-3::AID; fcho-1(ox477) (B), and nekl-3::AID; adm-2(fd318) (C) mutant backgrounds in the absence (–) and presence (+) of auxin treatment. Bar in A = 5 μm (for A–C). (D) Dot plot showing the percentage of GFP-positive pixels within the apical plane of the worm epidermis for individuals of the specified genotypes and auxin treatment groups. Group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ****p ≤ 0.0001, *p ≤ 0.05. Raw data for this figure is provided in S1 File.
Loss of adm-2 function does not correct the nekl trafficking defects.
(A–C) Representative confocal images of 2-day-old adult worms expressing LRP-1::GFP in the apical hyp7 region of the epidermis. LRP-1 expression in the nekl-3::AID (A), nekl-3::AID; fcho-1(ox477) (B), and nekl-3::AID; adm-2(fd318) (C) mutant backgrounds in the absence (–) and presence (+) of auxin treatment. Bar in A = 5 μm (for A–C). (D) Dot plot showing the percentage of GFP-positive pixels within the apical plane of the worm epidermis for individuals of the specified genotypes and auxin treatment groups. Group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ****p ≤ 0.0001, *p ≤ 0.05. Raw data for this figure is provided in S1 File.We recently reported that molting defects–but not trafficking defects–in nekl-2; nekl-3 strains could be suppressed by induction of the C. elegans dauer pathway [29]. Similar to adm-2, suppression by the dauer pathway is effective in nekl-2; nekl-3 double mutants but not in stronger loss-of-function nekl alleles. We therefore tested if nekl-2; nekl-3 suppression by adm-2 could be reversed by a reduction in dauer-pathway function. Our findings, however, indicate that adm-2 suppression is not dependent on the dauer pathway, indicating that adm-2 suppresses nekl-2; nekl-3 mutants by a novel mechanism (S6 Fig).
ADM-2 is a negative regulator of LRP-1
Our observation that LRP-1::GFP was further upregulated in NEKL-3::AID-depleted worms containing mutant adm-2 (Fig 4D) suggested that ADM-2 may negatively regulate LRP-1. Notably, two mammalian homologs of LRP-1 (LRP1/LRP2) are regulated by matrix metalloproteinases and ADAM family members, including the meltrin ADAM12 [67-77]. We therefore hypothesized that ADM-2 may function as a sheddase for LRP-1. To test this possibility, we examined levels of LRP-1::GFP and LRP-1::mScarlet in adm-2 null mutants and observed apical levels of LRP-1::GFP and LRP-1::mScarlet to be ~1.6-fold higher in adm-2 mutants relative to wild type (Fig 5A–5F). We also observed a modest but statistically significant upregulation of LRP-1::GFP in adm-2 mutant L4 larvae (S7A Fig). In contrast, loss of adm-2 did not alter the levels of a clathrin heavy chain reporter at the apical membrane (S8A–S8D Fig), indicating that ADM-2 does not generally affect CME.
Fig 5
ADM-2 activity affects LRP-1 levels.
Representative confocal images of 1-day-old adult wild-type (A, D) and adm-2(fd300) (B, E) worms expressing LRP-1::GFP (A, B) and LRP-1::mScarlet (D, E) in the hyp7 region of the hypodermis. Bar in A = 5 μm (for A, B). Bar in D = 10 μm (for D, E). Dot plot showing LRP-1::GFP (C) and LRP-1::mScarlet (F) mean intensity (a.u.) within the apical plane of the worm hypodermis for each individual worm of the specified genotype. Representative confocal images of 1-day-old adult worms expressing LRP-1::GFP in the hyp7 region of the hypodermis. (G, H) LRP-1 expression in worms containing the P::adm-2 transgene. Worms are shown in the absence of heat shock (G) and after heat shock (H). Bar in I = 10 μm (for I–L). (I) Dot plot showing LRP-1::GFP mean intensity (a.u.) within the apical plane of the worm hypodermis for each individual worm of the specified genotype and heat shock conditions. In C, F and I, group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ****p ≤ 0.0001; ***p ≤ 0.001; ns, p ≥ 0.05. (J–L) Co-localization analysis of LRP-1::GFP with ADM-2::mScarlet within apical plane of hyp7. (M) Dot plot showing quantification of Mander’s overlap coefficient for the overlap of LRP-1::GFP with ADM-2::mScarlet proteins within the apical plane. Means along with 95% confidence intervals (error bars) are indicated. Raw data for this figure is provided in S1 File.
ADM-2 activity affects LRP-1 levels.
Representative confocal images of 1-day-old adult wild-type (A, D) and adm-2(fd300) (B, E) worms expressing LRP-1::GFP (A, B) and LRP-1::mScarlet (D, E) in the hyp7 region of the hypodermis. Bar in A = 5 μm (for A, B). Bar in D = 10 μm (for D, E). Dot plot showing LRP-1::GFP (C) and LRP-1::mScarlet (F) mean intensity (a.u.) within the apical plane of the worm hypodermis for each individual worm of the specified genotype. Representative confocal images of 1-day-old adult worms expressing LRP-1::GFP in the hyp7 region of the hypodermis. (G, H) LRP-1 expression in worms containing the P::adm-2 transgene. Worms are shown in the absence of heat shock (G) and after heat shock (H). Bar in I = 10 μm (for I–L). (I) Dot plot showing LRP-1::GFP mean intensity (a.u.) within the apical plane of the worm hypodermis for each individual worm of the specified genotype and heat shock conditions. In C, F and I, group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ****p ≤ 0.0001; ***p ≤ 0.001; ns, p ≥ 0.05. (J–L) Co-localization analysis of LRP-1::GFP with ADM-2::mScarlet within apical plane of hyp7. (M) Dot plot showing quantification of Mander’s overlap coefficient for the overlap of LRP-1::GFP with ADM-2::mScarlet proteins within the apical plane. Means along with 95% confidence intervals (error bars) are indicated. Raw data for this figure is provided in S1 File.To further examine the relationship between ADM-2 and LRP-1 we tested the effects of heat-shock induced ADM-2 overexpression on LRP-1::GFP levels. One-day-old adult worms carrying the P::adm-2 transgene and LRP-1::GFP were heat shocked and then allowed to recover for ~2 hr prior to assaying LRP-1::GFP. Whereas heat shock did not substantially alter LRP-1::GFP levels in the absence of the P::adm-2 transgene, levels of LRP-1::GFP were ~1.6-fold lower when worms containing the P::adm-2 transgene were heat shocked relative to non-heat-shocked controls (Fig 5G–5I). Upregulation of ADM-2 in our system was supported by our observation that heat shock strongly induced GFP expression in a P::adm-2::GFP control strain (S7D–S7E Fig). Overall, our reciprocal findings are consistent with ADM-2 functioning as a negative regulator of LRP-1 and suggest that suppression of molting defects by loss of ADM-2 may occur in part through the upregulation or de-repression of cargo including LRP-1. Consistent with this possibility, we detected partial co-localization of LRP-1::GFP and ADM-2::mScarlet within hyp7 (Fig 5J–5M).
Negative regulation of LRP-1 by ADM-2 does not require ADM-2 proteolytic activity
To further test the possibility that ADM-2 may function as a sheddase for LRP-1 we examined endogenously tagged LRP-1::mScarlet by western blot using an anti-RFP antibody in wild type and adm-2 mutants. Interestingly, we observed that ~90% of LRP-1::mScarlet is apparently processed by proteolytic cleavage in wild-type worms (Fig 6A). Namely, the majority of LRP-1::mScarlet is present as an ~71 kD peptide whereas only a small proportion (~10%) is represented by the expected full-length product (~550 kD). We believe it unlikely that this result is due to an artifact of our methodology as we never detected additional (proteolytic) breakdown products of LRP-1::mScarlet and the efficient transfer of peptide markers ranging from ~30–460 kD was consistently observed. These observations suggest that LRP-1 is cleaved by a peptidase at approximate amino-acid position 4,350 of the 4,753 aa peptide, leaving only several hundred N-terminal amino acids of the ectodomain, the TM domain, and the short (157 aa) C-terminal domain.
Fig 6
Regulation of molting by multiple ADM-2 domains.
(A) Western blot showing RFP antibody recognizing the mScarlet tag in the endogenously expressed LRP-1::mScarlet protein. This blot shows the (From left) high molecular weight ladder, total protein lysates from Wild Type (N2), LRP-1::mScarlet and LRP-1::mScarlet; adm-2(fd300) strains. Full length (FL) protein and the cleaved cytoplasmic peptide (Clv.) shown in red arrows. Corresponding control blot recognizing β-actin is shown below. (B, C) Dot plots showing the LRP-1::GFP mean intensity (a.u.) within the apical plane of the worm hypodermis for each individual worm in; (B) Wild Type and adm-2 metalloprotease mutant background; (C) worms containing the P::adm-2(metalloprotease mutant) transgene in the absence of heat shock and after heat shock. In B and C, group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ***p ≤ 0.001; ns, p ≥ 0.05. (D) Bar plot showing the ratio of LRP-1::GFP mean intensity in the absence of heat shock and after heat shock in the worms containing no transgene, P::Empty Vector, P::adm-2 and P::adm-2(metalloprotease mutant) transgenes respectively. Error bars represent 95% confidence intervals. p-Values were obtained by comparing means in the absence of heat shock and after heat shock using an unpaired t-test: ****p ≤ 0.0001; ***p ≤ 0.001; ns, p ≥ 0.05. (E) Schematic representation of predicted protein domains within ADM-2. PRO, prodomain; MTP, metalloprotease domain; DIS, disintegrin domain; CYS-R, cysteine repeat region; TM, transmembrane domain; NLS, predicted nuclear localization signal; DM, disintegrin motif; CysL, cysteine loop; SH3 binding (1–3) Src homology 3 binding domains. (F) Percentage of viable (non-molting-defective) nekl-2; nekl-3 adults in the indicated CRISPR-derived adm-2 mutant backgrounds. Error bars represent 95% confidence intervals. p-Values were determined using Fisher’s exact test: ****p ≤ 0.0001; ns, not significant. Raw data for this figure is provided in S1 File.
Regulation of molting by multiple ADM-2 domains.
(A) Western blot showing RFP antibody recognizing the mScarlet tag in the endogenously expressed LRP-1::mScarlet protein. This blot shows the (From left) high molecular weight ladder, total protein lysates from Wild Type (N2), LRP-1::mScarlet and LRP-1::mScarlet; adm-2(fd300) strains. Full length (FL) protein and the cleaved cytoplasmic peptide (Clv.) shown in red arrows. Corresponding control blot recognizing β-actin is shown below. (B, C) Dot plots showing the LRP-1::GFP mean intensity (a.u.) within the apical plane of the worm hypodermis for each individual worm in; (B) Wild Type and adm-2 metalloprotease mutant background; (C) worms containing the P::adm-2(metalloprotease mutant) transgene in the absence of heat shock and after heat shock. In B and C, group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: ***p ≤ 0.001; ns, p ≥ 0.05. (D) Bar plot showing the ratio of LRP-1::GFP mean intensity in the absence of heat shock and after heat shock in the worms containing no transgene, P::Empty Vector, P::adm-2 and P::adm-2(metalloprotease mutant) transgenes respectively. Error bars represent 95% confidence intervals. p-Values were obtained by comparing means in the absence of heat shock and after heat shock using an unpaired t-test: ****p ≤ 0.0001; ***p ≤ 0.001; ns, p ≥ 0.05. (E) Schematic representation of predicted protein domains within ADM-2. PRO, prodomain; MTP, metalloprotease domain; DIS, disintegrin domain; CYS-R, cysteine repeat region; TM, transmembrane domain; NLS, predicted nuclear localization signal; DM, disintegrin motif; CysL, cysteine loop; SH3 binding (1–3) Src homology 3 binding domains. (F) Percentage of viable (non-molting-defective) nekl-2; nekl-3 adults in the indicated CRISPR-derived adm-2 mutant backgrounds. Error bars represent 95% confidence intervals. p-Values were determined using Fisher’s exact test: ****p ≤ 0.0001; ns, not significant. Raw data for this figure is provided in S1 File.Somewhat unexpectedly, we observed an identical banding pattern of LRP-1::mScarlet in adm-2 null mutants (Fig 6A). Namely, the percentage of presumptive full-length LRP-1::mScarlet in wild type was 9.9% (95% CI, 5.0–14.9%; n = 8) versus ~11.6% (95% CI, 5.7–17.4%; n = 8) in adm-2 mutants, suggesting that ADM-2 does not regulate LRP-1 through proteolysis. To further test this possibility we compared LRP-1::GFP levels in wild-type and CRISPR-generated adm-2 Zn-MTP mutant worms (Fig 6B). Notably, loss of ADM-2 metalloproteinase function did not alter total levels of LRP-1::GFP in the apical region of hyp7, consistent with ADM-2 regulating LRP-1 through a non-proteolytic mechanism. As an additional test, we examined LRP-1::GFP levels in worms following heat-shock induction of a metalloproteinase-defective variant of ADM-2 (PHS::ADM-2–MTP; Fig 6C). Notably, we found that overexpression of ADM-2–MTP decreased levels of LRP-1::GFP to a similar extent as wild-type ADM-2 (PHS::ADM-2), in contrast to worms containing either no array (–) or an array containing an empty-vector heat-shock plasmid (PHS::EV) (Figs 5I; 6C, 6D and S7B, S7C). We also note that although western blotting suggested a ~1.7-fold increase in total levels of LRP-1::mScarlet in adm-2 mutants relative to wild type, this difference was only of marginal statistical significance (Wilcoxon Signed Rank Test, p = 0.096; n = 8). Taken together, our findings indicate that ADM-2 can act as a negative regulator of LRP-1, although it appears to do so through a mechanism that is independent of its metalloproteinase function.
Multiple domains likely contribute to the effect of ADM-2 on molting
Our above results suggest that while the metalloproteinase domain of ADM-2 plays a role in its regulation of the molting process, other domains may also make important contributions. To further examine this we tested CRISPR variants designed to disrupt additional domains of ADM-2. Among the N-terminal variants, we observed strong suppression of nekl-2; nekl-3 molting defects by mutations predicted to disrupt a cysteine loop within the disintegrin domain (CysL; Figs 6E–6F and S9A–S9C). In addition, weak but above-background suppression was observed with mutations affecting a predicted Furin-cleavage site (Furin-1) and within a conserved disintegrin motif (DM; Figs 6E–6F and S9A–S9C). We also tested the importance of the ADM-2 C-terminal domain (R696–K952) using CRISPR-generated lines. An in-frame deletion of most of the C terminus (CT) of ADM-2 led to strong suppression of nekl-2; nekl-3 molting defects, whereas perturbation of individual SH3-binding domains led to suppressive effects ranging from strong (SH3-1), to moderate (SH3-3), to absent (SH3-2; Figs 6E–6F and S9A–S9C). Lastly, several tested variants affecting a region just C-terminal to the transmembrane (TM) also led to the suppression of nekl-2; nekl-3 molting defects (Figs 6E–6F and S9AC). This region contains a predicted nuclear localization signal (NLS) that overlaps with a Furin-cleavage motif (Furin-2) and could conceivably be involved in the processing and nuclear translocation of ADM-2. Although the nuclear translocation of ADAM cytosolic domains has been reported [34, 78], we failed to detect nuclear ADM-2 in our expression studies.While these mutational studies are consistent with the model that non-proteinase functions of ADM-2 may contribute to the suppression of nekl-2; nekl-3 molting defects, several caveats should be noted. Most notable is that the domain-targeted variants may unintentionally influence the structure and function of other domains. In addition, mutations that affect the subcellular localization or stability of ADM-2 may also suppress molting defects (also see Discussion). Nevertheless, our cumulative findings suggest that functions independent of metalloproteinase activity may contribute to the suppression of nekl defects by adm-2 loss of function.
Discussion
In this study we identified a functional role for the sole C. elegans meltrin family member, ADM-2, in the molting process. Whereas the absence ADM-2 did not overtly impact the molting cycle, its loss of function, identified through a non-biased genetic screen, strongly suppressed molting defects in nekl-2; nekl-3 mutants. Previous studies have implicated proteases as positive regulators of molting including NAS-36, NAS-37, CPZ-1, and SURO-1 [79-84]. Extracellular proteases have been suggested to be important for the detachment and degradation of the old cuticle and may also play a dynamic role in ECM remodeling during new cuticle synthesis [2]. In contrast, our data implicate ADM-2 as a negative regulator of the molting process. Interestingly, roles for protease inhibitors in molting have also been reported, as loss of the Kunitz domain–containing protease inhibitors MLT-11 and BLI-5 lead to molting defects [80,85,86]. Protease inhibitors have been suggested to be important for temporally or spatially restricting the activity of extracellular proteases during the molting cycle. Consistent with this, epidermally expressed proteases and protease inhibitors are highly enriched among genes that are transcriptionally regulated with the molting cycle, indicating a tight control of proteolytic activity [87,88].Although we previously reported the suppression of nekl molting defects by mutations affecting genes closely connected to CME, our data do not support a role for ADM-2 in the regulation of intracellular trafficking per se. Rather, our findings are consistent with ADM-2 being a cargo of CME, including during its passage through endosomes and its turnover in lysosomes. Moreover, we observed increased levels of ADM-2 after NEKL::AID knockdown along with the retention of ADM-2 in intracellular compartments of the epidermis. Collectively these findings suggest that loss of NEKL functions may lead to increased or aberrant ADM-2 activity, which may contribute to molting defects in these mutants.Notably, we identified a positive regulator of molting, LRP-1, as a target of ADM-2 regulation. Epidermal LRP-1 levels were increased in adm-2 null mutants and reduced when ADM-2 was overexpressed, indicating that ADM-2 negatively regulates LRP-1. In addition, a subset of LRP-1 endosomal puncta colocalize with ADM-2, suggesting that this regulatory interaction may occur within the trafficking pathway. Increased LRP-1 in adm-2 mutants could contribute to the suppression of nekl-2; nekl-3 molting defects by increasing the uptake of steroid hormone precursors, a process that we have shown to be defective in nekl mutants [11,29]. Nevertheless, our data also indicate that ADM-2 is unlikely to regulate LRP-1 through its sheddase activity, as was previously demonstrated for human ADAM and LRP-1 homologs [67-77]. Rather, our findings suggest a non-canonical mechanism for the regulation of a low-density lipoprotein-like receptor by an ADAM family member. How this regulation may occur, along with understanding how specific domains of ADM-2 may contribute to molting control and other developmental processes, remains to be determined.Consistent with the above, our CRISPR-based structure-function analysis of ADM-2 suggests that several different domains and functions may contribute to the suppression of nekl-2; nekl-3 by adm-2. As mentioned previously, however, these findings could be due in part to “off-target” effects of our variants on other domains within ADM-2. As one example, modeling of the CysL variant using the AlphaFold database [89,90] and the Robetta protein structure prediction service [91,92] suggests that in addition to impacting the disintegrin domain, this variant could also affect the coordination of Zn binding by histidine residues within the MTP domain (S9D Fig). Likewise, it is possible that suppressing mutations within the MTP domain impact other N-terminal activities. In contrast, other variants, including the C-terminal SH3-1, are not predicted to affect MTP domain structure (S9E Fig) but could potentially affect the subcellular localization, stability, or other activities of ADM-2. In fact, a role for the C-terminus in mediating ADAM function would not be unexpected given that this domain is proposed to be important for the regulation of cell signaling and may contain motifs involved in the ‘inside-out’ regulation of ADAM metalloprotease activities [31,32,34,93].Our cumulative findings, together with published data from other groups, point to a working model in which epidermal intracellular trafficking may play two roles in the molting process. On the one hand, endocytosis may be required for the internalization of factors that promote molting, such as recycled cuticle components [65,94] and cholesterol via LRP-1 [5,6], a function consistent with our observation that loss of nekls leads to defects in the transcription of hormonally regulated molting genes [29]. In addition, endocytosis may also promote the uptake and degradation of cargo that might otherwise exert an inhibitory effect on molting, a function that we propose for ADM-2. In fact, cargo in both categories may have functional interactions, such as the observed negative regulation of LRP-1 by ADM-2. In this model, loss of ADM-2 would lead to the de-repression of LRP-1, along with other potential effectors of molting, thereby compensating for a partial loss of NEKL trafficking functions. When NEKL functions are more severely reduced, however, loss of ADM-2 would be unable to offset the resulting deficiencies, such as strong defects in molting gene expression, consistent with our observation that adm-2 mutations do not suppress strong loss-of-function alleles in nekls. In summary, our findings expand the roles for NEKLs and intracellular trafficking in the molting process and implicate an ADAM family member as a negative regulator of the molting process.
Materials and methods
Strains
C. elegans strains were maintained according to standard protocols [95] and were propagated at 22°C, unless stated otherwise. Strains used in this study are listed in S1 Table.
Transgenic rescue
Fosmids containing rescuing sequences for adm-2/C04A11.4 (WRM0620dD12, WRM0632aG02, and WRM0610cA04, 2–6 ng/μl each + sur-5::RFP [pTG96], 50–100 ng/μl) were injected into strain WY1342. Stable strains (WY1386 and WY1388) containing rescuing arrays for both nekl-3 (fdEx286; GFP+) and adm-2 (fdEx315 or fdEx356; RFP+) were scored to determine the percentage of viable RFP+ progeny.
Determination of dominant versus recessive alleles
To distinguish between dominant and recessive alleles, we first crossed suppressed nekl-2(fd81); nekl-3(gk894345) fd130 hermaphrodites to WY1145 [nekl-2(fd81); nekl-3(gk894345); fdEx286 (nekl-3
+ sur-5::GFP)] males and scored for suppression of GFP−cross-progeny males. For fd130 and fd162, 50/96 and 30/52 viable cross-progeny adult males were GFP–, respectively, indicating that these mutations are either dominant or on LG X. We next crossed nekl-2(fd81); nekl-3(gk894345) fd130 hermaphrodites to WY1232 [nekl-2(fd81); nekl-3(gk894345); fdEx186 (nekl-3 + sur-5::GFP); fdEx197 (sur-5::RFP)] males and scored for suppression of GFP−RFP+ cross-progeny hermaphrodites. In the case of cross-progeny fd130/+ adult hermaphrodites, 62/62 were either GFP+ RFP−or GFP+ RFP+; no GFP−RFP+ adults were observed. Similarly, 182/185 fd162/+ adult hermaphrodites were either GFP+ RFP−or GFP+ RFP+, and only 3/185 were GFP−RFP+. Given the ~98.5% penetrance of nekl-2(fd81); nekl-3(gk894345) larval lethality [30], our results indicate that fd130 and fd162 are fully recessive but are on LG X.
RNAi
Primers containing the binding motif for T7 RNA polymerase (5’-TAATACGACTCACTATAGGGAGA-3’) and corresponding to adm-2 (5’-GACCACAACAATGATACGGTCGAA-3’; 5’-CCTGGACACAATGCAGCATTTTGA-3’), unc-71 (5’-TGTCGTCGACGGTTCCGAAGA-3’; 5’-GCATCAGACAGACCAGGCATAG-3’), adm-4 (5’-ATGCATTCAATACACGTGTGA-3’; 5’-CTTCCTCTCCCAGATATATCGT-3’), sup-17 (5’-AGTGTCAACCTGGTCTTCCTG-3’; 5’-CTGTGCCCATTGTGTTAGAGTTTC-3’), mig-17 (5’-CTCAGCTACACAAGGAATGGC-3’; 5’-TTCGCACACGTTCTACAACA-3’), tag-275 (5’-TGTTCTCGCGTCATTCGTTGC-3’; 5’-ACTCGGTTTATTGGAACATTTGGC-3’), F27D9.7 (5’-CAACATTCTGTGCGATGCGGT-3’; 5’-TTAAATGGGCGCGACAGATCC-3’), adt-1 (5’-GTCAGTGCACTCACTGGACAT-3’; 5’-GGTTAGGCATGGCCTGAATCT-3’), adt-2 (5’-GAAGACGAAACCGAAGTCTGC-3’; 5’-TTACCTCCCCATGCAGCATTT-3’), adt-3 (5’-CAGGTATGTAACGGTGACTCCA-3’; 5’-CATTACACATGGTCCGGTTTC-3’), and gon-1 (5’- TGGATCACTGAAGATGTGTCT-3’; 5’- GCACTCCAATCAGTATTTCTC-3’) were used to generate dsRNA using standard methods [96]. After injection at 0.8–1.0 μg/μl into WY1145 hermaphrodites, F1 progeny were scored for adult viability. For RNAi feeding experiments, the relevant bacterial strains were obtained from Geneservice and IPTG (8 mM) was added to growth plates [97]. Worm strains were grown on lin-35(RNAi) plates for two generations to increase RNAi susceptibility [98]. Second-generation fourth larval stage (L4) worms growing on lin-35(RNAi) plates were transferred to experimental plates and were imaged after 48 hours. RNAi feeding experiments were performed at 20°C.
ADM-2 CRISPR mutant alleles
Design of repair sequences containing introduced restriction sites was facilitated using CRISPRcruncher [99]. For details on primers sequences see S2 File.
Strong loss-of-function alleles
Alleles fd228–fd230 and fd235–fd237 were generated using guide dual sequences SB1 and SB2, PCR amplification primers SB3 and SB4, and the sequencing primer SB6. In fd228–fd230 and fd235–fd237, an ~3.2-kb region spanning adm-2a exons 3–9 is deleted. fd228 is an indel predicted to encode sequences through T122 of ADM-2a, followed by eight divergent amino acids and a stop codon. fd229 is an indel predicted to encode sequences through S123 of ADM-2a, followed by a stop codon. fd230 is an indel predicted to encode sequences through T122 of ADM-2a, followed by a stop codon. fd235 is an indel predicted to encode sequences through T122 of ADM-2a, followed by 23 new amino acids and a stop codon. fd236 is an indel predicted to encode sequences through F118 of ADM-2a, followed by six new amino acids and a stop codon. fd237 is an indel predicted to encode sequences through T122 of ADM-2a, followed by a single new amino acid and a stop codon. Alleles fd298–302 were generated using guide sequences SB46 and SB47, PCR amplification primers SB48–SB51, and the sequencing primer SB52. In fd298–fd302, fd313, fd316, and fd317 an ~7.4-kb region spanning adm-2a exons 1–19 is deleted. fd298 is an indel that encodes sequences through T2 of ADM-2a followed by four new amino acids and a stop codon. fd299 is a deletion that encodes sequences through M1 of ADM-2A, followed by three new amino acids and a stop codon. fd300 is an indel that encodes sequences through D3 of ADM-2a, followed by 27 new amino acids and a stop codon. fd301 and fd302 are identical indels that encode sequences through D3 of ADM-2a, followed by 12 new amino acids and a stop codon. fd313 encodes sequences through T2 of ADM-2a, followed by 40 new amino acids and a stop codon. fd316 deletes the normal start codon; an alternative ATG is predicted to encode 24 new amino acids followed by a stop codon. fd317 encodes sequences through D3 of ADM-2a, followed by 16 new amino acids and a stop codon. fd318 encodes sequences through D3 of ADM-2a, followed by 8 new amino acids and a stop codon.
Alleles fd243–fd247, fd391 were generated using the guide sequence SB27, the repair template Rep2, PCR amplification primers SB28 and SB29, and sequencing primers SB31 and SB32. fd243–fd247, fd391 change the predicted ADM-2a Zn-metalloprotease active site spanning H312–H322 (HELGHTFGMDH) to DALAYTFRMDY (altered aa are in bold). The Zn-metalloprotease consensus motif is HEXXHXUGUXH, where U is an amino acid containing a bulky hydrophobic residue. The edited locus contains an introduced BstBI site.
adm-2 disintegrin motif mutation
Allele fd322 was generated using guide sequence DF1, the repair template Rep9, PCR amplification primers DF2 and DF3, and sequencing primers DF4 and DF5. fd322 changes the predicted ADM-2a disintegrin motif (DM) spanning E388–G396 (EPGEECDCG) to EPGEVLADP. The edited locus contains introduced NheI and BamHI sites.
adm-2 cysteine loop mutation
Alleles fd324–fd325 were generated using guide sequence DF6, the repair template Rep10, PCR amplification primers DF2 and DF3, and sequencing primers DF4 and DF5. fd324–fd325 change the predicted ADM-2a cysteine loop (CysL) spanning C438–P459 (CRAAIGICDLDEYCNGETNDCP) to CRAAIGICDLQQNGDHETNDCP. The edited locus contains an introduced PstI site.
adm-2 furin 1 mutation
Alleles fd288-fd290 were generated using guide sequence SB17, the repair template Rep6, PCR amplification primers SB18 and SB19, and sequencing primers SB20 and SB21. fd288-fd290 change the predicted ADM-2a furin-1 cleavage site spanning R149–R152 (RKKR) to VKKV. The edited locus contains an introduced BamHI site.
adm-2 SH3-binding domain 1 mutation
Alleles fd248–fd251 were generated using the guide sequence SB32, the repair template Rep3, PCR amplification primers SB16 and SB34, and sequencing primer SB35. fd248–fd251 alter the predicted ADM-2a SH3-1 domain spanning V722–P731 (VPVRKAPPPP) to EGVLAAGAVG. The edited locus contains an introduced XhoI site.
adm-2 SH3-binding domain 2 mutation
Alleles fd252–fd256 were generated using the guide SB36, the repair template Rep4, PCR amplification primers SB37 and SB38, and sequencing primers SB39 and SB40. fd252–fd256 alter the predicted ADM-2a SH3-binding domain 2 domain spanning P839–V853 (PNVQPPPVPRPSDDV) to GNVQGAGVGAGSLLE. The edited locus contains an introduced XhoI site.
adm-2 SH3-binding domain 3 mutation
Alleles fd257–fd259 were generated using the guide sequence SB41, the repair template Rep5, PCR amplification primers SB37 and SB38, and sequencing primers SB39 and SB40. fd257–fd259 alter the predicted ADM-2a SH3-binding domain 3 spanning K874–K884 (KTLPLPPPLPK) to ITLELGAGLGL. The edited locus contains an introduced XhoI site.
adm-2 C-terminal (cytoplasmic domain) deletion
Alleles fd231–fd234 were generated using the guide sequences SB12 and SB13, the repair template Rep1, PCR amplification primers SB14 and SB15, and sequencing primer SB16. fd231–fd234 remove sequences from H718 to M942 of ADM-2a and introduce a XhoI site.
adm-2 furin-2 mutation
Alleles fd292 and fd293 were generated using the guide sequence SB22, the repair template (Rep7), PCR amplification primers SB23 and SB24, and sequencing primers SB25 and SB26. fd292 and fd293 alter the predicted ADM-2a N-terminal furin cleavage site spanning R696–R699 (RVKR to VVKL). The edited locus contains a new AflII site.
adm-2 furin-2/NLS mutation
Alleles fd310–fd312 were generated using the guide sequence SB22, the repair Rep8, PCR amplification primers SB53 and SB54, and sequencing primers SB55 and SB56. fd310–fd312 alter the predicted ADM-2a monopartite nuclear localization signal (NLS) spanning Y694–V704 (YYRVKRKRNLV to VVLVGAIANLV) as well as the adjacent predicted bipartite NLS spanning R696–D716 (RVKRKRNLVSEWWSVVKKKFD to VVLVGAIANLVYEWWSVVKKKFD). The edited locus contains a new AccI site.
adm-2 NLS mutation
Allele fd326 were generated using the guide sequence SB22, the repair Rep11, PCR amplification primers SB53 and SB54, and sequencing primers SB55 and SB56. fd326 alter the predicted ADM-2a monopartite nuclear localization signal (NLS) spanning Y694–S705 (YYRVKRKRNLVS > YYRVKREDPGDP). The edited locus contains a new XmaI site.
Detailed sequence information on all adm-2 alleles can be found in S1 File and S3 File
ADM-2 expression plasmids and strains
adm-2::GFP and adm-2::mScarlet endogenously tagged strains were made using CRISPR/Cas9 technology in collaboration with SunyBiotech Corporation (China). Expression vectors were generated by amplifying the adm-2 promoter region from fosmid WRM0620dD12 using primers SB57 and SB58. After digestion with SphI and SalI, the ~2.1-kb PCR product was inserted into pPD95.75 to create pDF403–pDF405. adm-2 cDNA was amplified from plasmid pDONR201 (Horizon Inc.) using primers SB59 and SB60. Digestion and ligation of the ~2.8-kb PCR product and pDF403 with XmaI and KpnI generated pDF417–pDF420, which were confirmed by sequencing. pDF417 (~100 ng/μl) was injected into N2 worms with sur-5::RFP (~50 ng/μl) to obtain lines carrying extrachromosomal arrays (fdEx353, fdEx354). CRISPR-tagged adm-2::mScarlet and adm-2::GFP strains contain codon optimized fluorescent-reporter insertions just preceding the adm-2a stop codon (SUNY biotech). In addition, sequences upstream of the stop codon contain the indicated (bold) silent mutations (LG X 13695343–13695387).TCTGAAGATGCAGCTGCAACCGAAGAAAAAGTAGATGTTCGCTCC (wild type)TCAGAAGATGCAGCTGCAACCGAAGAAAAAGTAGATGTTCGCTCG (CRISPR tagged)
adm-2 and adm-2::GFP heat shock strains
An ~4.6-kb adm-2::GFP::unc-54 3’UTR cDNA product was obtained by digesting pDF420 with XbaI and ApaI enzymes. Digestion of heat shock vectors pPD49.78 and pPD49.83 was performed using NheI and ApaI to obtain an ~3-kb vector backbone. Ligation of the adm-2 cDNA with vector backbones pPD49.83 and pPD49.78 generated pDF429–pDF431 and pDF432–pDF434, respectively. Likewise, an ~2.8-kb adm-2::GFP product was obtained by digesting pDF420 with XbaI and KpnI enzymes. Digestion of heat shock vectors pPD49.78 and pPD49.83 was performed using NheI and KpnI to obtain an ~3-kb vector backbone. Ligation of adm-2::GFP with vector backbones pPD49.83 and pPD49.78 generated pDF423–pDF425 and pDF426–pDF428, respectively. pDF430 and pDF433 (50 ng/μl each) were injected into N2 with pRF4 [rol-6(gf)] (~50 ng/μl) to obtain lines carrying extrachromosomal arrays (N2: fdEx373–375). Likewise, pDF424 and pDF425 (50 ng/μl each) were injected into N2 with pRF4 [rol-6(gf)] (~50 ng/μl) to obtain lines carrying extrachromosomal arrays (fdEx381, fdEx382).
Heat shock methods
For Figs 5G–5I and 6C and S7B–S7D 1-day-old adult worms grown at 20°C were heat shocked at 34°C for 4 hours and were shifted to 20°C for 2–3 hours before imaging.
Protein domain identification and alignment tools
The following sites were used to identify domains within ADM-2 and human ADAM homologs:http://nls-mapper.iab.keio.ac.jp/cgi-bin/NLS_Mapper_form.cgihttps://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgihttps://www.ebi.ac.uk/interpro/https://prosite.expasy.org/https://psort.hgc.jp/form2.htmlhttp://www.cbs.dtu.dk/services/TMHMM/http://www.cbs.dtu.dk/services/SignalP/http://phobius.sbc.su.se/http://tcoffee.crg.cat/apps/tcoffee/do:regularhttps://embnet.vital-it.ch/software/BOX_form.html
Image acquisition
Fluorescence images in the following figure panels—Figs 4A–4C; 5A, 5B; S3G and S8—were acquired using an Olympus IX81 inverted microscope with a Yokogawa spinning-disc confocal head (CSU-X1). Excitation wavelengths were controlled using an acousto-optical tunable filter (ILE4; Spectral Applied Research). MetaMorph 7.7 software (MetaMorph Inc.) was used for image acquisition. z-Stack images were acquired using a 100×, 1.40 N.A. oil objective. The rest were acquired using an Olympus IX83 inverted microscope with a Yokogawa spinning-disc confocal head (CSU-W1). z-Stack images were acquired using a 100×, 1.35 N.A. silicone oil objective. cellSense3.1 software (Olympus corporation) was used for image acquisition. DIC images in the panels Figs 1A–1C and S7D were acquired using a Nikon Eclipse epiflourescence microscope and the cellSense3.1 software (Olympus corporation).
Image analysis
Mean intensity (measured in arbitary units, a.u.), percent of fluorescence-positive pixels above threshold, and the colocalization analysis were performed using Fiji software (NIH; available at https://imagej.net/Fiji/Downloads). For a given z-plane of interest, rolling ball background subtraction was performed (radius = 50 pixels), and the polygon selection tool was used to choose the region of hyp7 in which the mean intensity was quantified (Figs 5, 6, S5, S7 and S8). The percentage of fluorescence-positive pixels for the region of interest (Figs 4 and S8) was determined after thresholding, and the “Huang” thresholding algorithm was used for strain comparisons. For colocalization, rolling ball background subtraction was performed (radius = 25 pixels), followed by use of the mean filter (radius = 2 pixels) to minimize noise. Finally, the same thresholding algorithm was used for one particular channel to obtain binary images to be used as masks (GFP::CHC-1 and HGRS-1::GFP—“Otsu”; ADM-2:mScarlet—“Isodata”; LRP-1::GFP–“Li”). This binary mask was combined using the “AND” boolean operation to the original image and the combined image was used for the colocalization analysis. Data from Fig 4A–4C (Olympus IX81) and Figs 5G–5I, 6B, 6C and S7 (Olympus IX83) were obtained on different confocal microscopes and thus differ in their mean intensity values.
Auxin treatment
Auxin (indole-3-acetic acid) was purchased from Alfa Aesar. A 100× stock auxin solution (0.4 M) was made by dissolving 0.7 g of auxin in 10 ml of 100% ethanol. A mixture of 25 μl of stock auxin solution and 225 μl of distilled water was added to plates containing 1-day-old adult worms.
Protein 3D structure analysis
PDB file (Identifier: AF-G5EDW5-F) containing the three-dimensional structure details of C. elegans ADM-2 was obtained from the AlphaFold database (https://alphafold.ebi.ac.uk/) [89, 90]. Using the AlphaFold structure as template, homology modeling was performed by the online Robetta structure prediction server (https://robetta.bakerlab.org/) to obtain the predicted the three-dimensional structures of the respective ADM-2 mutants [91, 92]. For modeling CM (Comparative modeling) option was used and the number of models to sample was selected as 1. Other options remained unchanged. The homology modeled three-dimensional structures were rendered, and was superimposed onto the AlphaFold structure of ADM-2 using the PyMOL 2 software (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC.).
Western blot analysis
200 L4 worms of each strain was picked into 50 μl of urea lysis buffer (7M urea, 1M thiourea, 2% CHAPS, 30mM Tris pH 8.0). 0.5 μl of protease inhibitor cocktail (Thermo Scientific: 1861280) was added and homogenized using a hand-held homogenizer. After homogenization, samples were spun at 8000 rpm (4°C) for 5 mins. Supernatant was carefully transferred into a fresh tube. 40 μl of the sample and 8 μl of 6% Laemmli SDS reducing buffer (Alfar Aesar: J61337) was mixed and loaded into each well. HiMark Pre-stained protein standard (Thermo Fisher: LC5699) was used to monitor protein size. The samples were separated by 4–15% gradient Mini-PROTEAN TGX gel (Biorad). After transfer, the PVDF membrane was blocked with Biorad EveryBlot Blocking buffer for 5 mins. Next, the membrane was probed with mouse monoclonal RFP antibody [6G6] (chromotek, 1:1000 dilution) followed by HRP-conjugated Goat anti-mouse HRP-conjugated antibody (abcam: ab97255, 1:1000 dilution). Signals were detected using Supersignal West Pico chemiluminescent substrate (Thermo Scientific). The blot was stripped and probed with rabbit monoclonal beta-Actin (13E5) HRP-conjugated antibody (cell signaling, 1:1000 dilution). The signals were quantified using the Image lab software (Version 6.1.0).
Statistical analyses
Statistical analyses were carried out using Prism software (GraphPad) following established standards [100].
Loss of other ADAM and ADAM-TS family members does not suppress nekl defects.
(A) Dot plot showing average brood sizes for 10 individual wild-type and adm-2(fd300) mutant worms. (B) Bar plot showing the failure of most C. elegans ADAM family members to suppress molting defects in nekl-2; nekl-3 mutants. (C) Table showing ADM-2 C. elegans orthologs and their corresponding human homologs. Error bars in A, B represent 95% confidence intervals. p-Values were determined using an unpaired t-test (A) (ns, p ≥ 0.05) or Fisher’s exact test (B): ****p ≤ 0.0001. Raw data for this figure is provided in S1 File.(TIFF)Click here for additional data file.
Alignment of C. elegans ADM-2 with human ADAMs.
Peptide alignment of C. elegans ADM-2 with human meltrin family members (ADAM9/12/19/33). Predicted domains of ADM-2 are color coded. NLS, nuclear localization domain.(PDF)Click here for additional data file.
Additional images of ADM-2 expression.
(A–F and A’–F’) Representative DIC (A–F) and confocal (A’–F’) images of ADM-2 expression showing the anterior hypodermis (A, A’), nerve ring (B, B’), tail neurons (C, C’), and various stages of embryonic development (D–F’). Bar in A’ = 10 μm (for A, A’); in B’ = 10 μm (for B, B’); in C’ = 10 μm (for C, C’); in F’ = 10 μm (for D–F’). (G) Representative confocal image of an L2 larva expressing multi-copy P::ADM-2::GFP in the plasma membrane of head neurons. Bar in G = 25 μm.(TIFF)Click here for additional data file.
Additional colocalization of ADM-2 with trafficking markers.
(A, B) Dot plots showing quantification of Mander’s overlap coefficient for the overlap of ADM-2::mScarlet with GFP::CHC-1 and Phyp7::HGRS-1::GFP proteins within the apical (A) and medial (B) planes. Mean values and 95% confidence intervals (error bars) are indicated. p-Values were calculated using an unpaired test: ****p ≤ 0.0001. (C–H) Representative confocal images of GFP::CHC-1 (C), Phyp7::HGRS-1::GFP (F), and ADM-2::mScarlet (D, G) within the hyp7 medial plane. C’–H’ are insets of C–H confocal images. Bar in E = 10 μm (for C–H); in E’ = 5 μm (for insets C’–H’). (E’,H’) White arrows show ADM-2 large vesicular structures that do not colocalize with GFP::CHC-1 and Phyp7HGRS-1::GFP puncta, which are lysosomes. Cyan arrows indicate vesicles containing ADM-2 that colocalize with GFP::CHC-1 and Phyp7::HGRS-1::GFP. Raw data for this figure is provided in S1 File.(TIFF)Click here for additional data file.
ADM-2 and clathrin levels are increased upon weak loss of mlt-3.
(A,B) Dot plot showing the mean intensity (a.u.) of GFP::CHC-1 (A) and ADM-2::mScarlet (B) expression in the presence of Control RNAi (i.e., empty vector) and mlt-3 RNAi. Group means along with 95% confidence intervals (error bars) are indicated. p-Values were obtained by comparing means using an unpaired t-test: **p ≤ 0.01, *p ≤ 0.05. Adult worms were imaged for this experiment. Raw data for this figure is provided in S1 File.(TIFF)Click here for additional data file.
Loss of dauer pathway function does not reverse adm-2 suppression of nekls.
Bar plot showing suppression in nekl-2; nekl-3 adm-2(fd130) in the presence and absence of daf-5(e1386). Loss of DAF-5 leads to strong defects in the induction of the dauer pathway. p-Values were obtained by comparing means using Fisher’s exact test. ns, p > 0.05. Raw data for this figure is provided in S1 File.(TIFF)Click here for additional data file.
Supplemental analysis of LRP-1 expression levels.
(A) Dot plot showing LRP-1::GFP mean intensity (a.u.) within the apical plane for each individual L4 worms in wild type and adm-2(fd300) backgrounds. (B) Dot plot showing LRP-1::GFP mean intensity (a.u.) within the apical plane for adults containing the P::Empty vector transgene in the absence of heat shock and after heat shock. Group means along with 95% confidence intervals (error bars) are indicated in plots A and B. p-Values were obtained by comparing means using an unpaired t-test: *p ≤ 0.05. (C) p-values obtained from comparisons of LRP-1::GFP mean intensity (a.u.) values in strains with the indicated transgenes after heat shock. ****p ≤ 0.0001; ***p ≤ 0.001, ns, not significant. (D) Florescence and corresponding DIC images of an adult worm carrying P::adm-2::gfp in the absence of heat shock and after heat shock. (E) Florescence and corresponding DIC images of an adult worm without the heat-shock array after heat shock. Scale bar in D = 50 μm (For all images in D). Scale bar in E = 20 μm (For images in E). Raw data for this figure is provided in S1 File.(TIFF)Click here for additional data file.
Clathrin expression is not affected by loss of ADM-2 function.
(A,B) Representative confocal images of GFP::CHC-1 expression in the apical hyp7 region of the hypodermis in wild-type (A) and adm-2(fd300) null mutant (B) day-1 adult worms. Bar in A = 10 μm (for A, B). (C, D) Dot plots showing GFP::CHC-1 mean intensity (a.u.) (C) and the percentage of GFP-positive pixels (D) within the apical plane for individual worms of the specified genotype. In C and D, group means along with 95% confidence intervals (error bars) are indicated. p-values were obtained by comparing means using an unpaired t-test. ns, p > 0.05. Raw data for this figure is provided in S1 File.(TIFF)Click here for additional data file.
Functional CRISPR-based analysis of ADM-2 domains.
(A) Schematic representation of predicted protein domains within ADM-2. (B) Color-coded peptide sequence of ADM-2 corresponding to panel A. For additional details see S2 Fig. (C) Amino acid sequence change details of the ADM-2 variants generated using CRISPR methods. (D, E) Predicted three-dimensional protein structures (for amino acid region 307–328) of wild-type ADM-2 (orange) superimposed on modeled structures for CysL (D; violet), SH3-1(E; green) mutant proteins. Three conserved histidine residues (His312, His316, His322) of the Zn-metalloprotease domain are represented as sticks. A predicted 6.1-Å shift of the ‘tele’ nitrogen atom in the imidazole ring of His322 was predicted in the CysL variant.(TIFF)Click here for additional data file.
List of all the strains used in this study.
(PDF)Click here for additional data file.
Compilation of raw data used in this study.
(XLSX)Click here for additional data file.
List of primers used in this study.
(XLSX)Click here for additional data file.
Detailed sequencing data for adm-2 alleles.
(PDF)Click here for additional data file.27 Jan 2022Dear Dr Fay,Thank you very much for submitting your Research Article entitled 'An unexpected role for the conserved ADAM-family metalloprotease ADM-2 in Caenorhabditis elegans molting' to PLOS Genetics.The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscript. Most comments likely can be addressed by rewriting, however reviewer 2 has made some suggestions for additional experiments that you may want to consider.We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer.In addition we ask that you:1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsPlease review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.[LINK]Please let us know if you have any questions while making these revisions.Yours sincerely,Andrew D. ChisholmAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS GeneticsReviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #1: This is a well written manuscript that describes fascinating work identifying the role of a conserved matrix metalloprotease, ADM-2, in roundworm molting, and provides evidence for a mechanism that includes endocytic trafficking that regulates ADM-2 activity and identify a candidate target, LRP-1, which may endocytose sterols that are used to create molting-specific steroid hormones that trigger molting.While strong, the last piece of this puzzle, confirming their proposed target (LPR-1) is processed by their protease ADM-2, would strengthen support provided by their fluorescence imaging experiments for their model and, if possible, provide a satisfying conclusion. They have animals expressing the tagged target (LRP-1::GFP) in the relevant adm-2 backgrounds, and others (whom they cite) have shown by western that metalloproteases including ADM-2-like ADAM-12 cleaves the LRP-1-related low-density lipoprotein receptor-related protein.Minor points:“LGX” is generally written “LG X”.S1 File: Is having more than one or two significant digits after the decimal (8 or 9 digits?) necessary and informative in the percent viability columns and the S7 Fig Average row?S2 File:The primer list sheet could use a little tidying up. SB3 doesn’t include sequence information, sometimes a forward primer is designated with “F” and sometimes “fwd”, and the capitalization of the sequences is inconsistent (if meaningful, what is the meaning?).In the ADM-2 deletions tab, what is the heading for column C? Column C primers are listed by name (from the first sheet) but the screening and sequencing primers are not all named. Does it make sense to include all primers in the "Primer list" tab and include their use in a different column?Reviewer #2: The authors have been analyzing endocytic vesicle trafficking in molting. In their previous work, they found nekl-2 and nekl-3 protein kinases play important roles in this process. In this manuscript, Joseph et al. identified novel mutations in adm-2 as the suppressors for the molting and larval arrest defects of nekl-2 and nekl-3 double mutants (both are weak alleles). Adm-2 encodes C. elegans ortholog of mammalian ADAM meltrin. ADM-2::GFP was broadly expressed and colocalized with endosomal and lysosomal markers in the hyp7 syncytium. The adm-2 suppressors failed to suppress the endocytic vesicle trafficking defects of nekl-2 and nekl-3 double mutants unlike their previously identified suppressor fcho-1. The authors found that the adm-2 affected the abundance of LRP-1 (sterol receptor) in the apical surface of hyp7; adm-2 loss-of-function increased LRP-1 levels, whereas adm-2 overexpression decreased them. Overall, this is an elegant genetic study analyzing the in vivo function of the ADAM family metalloprotease in animal development. Although all the experiments have been carefully conducted and the manuscript is well written, I think the presented data are still insufficient to support the authors’ model that “loss of adm-2 suppresses molting defects in nekl mutants by eliminating a negative regulator of LRP-1, thereby compensating for defects in the efficiency of LRP-1 and sterol uptake”.Comments:1. Based on their observation that the amount of LRP-1::GFP is upregulated in the adm-2(fd300) and is downregulated in adm-2 overexpression, the authors proposed a model that ADM-2 negatively regulates LRP-1: The extracellular domain of LRP-1 is released by direct or indirect action of the ADM-2 protease. However, I feel that the observed effects are quite weak, and it is unclear whether LRP-1 is actually cleaved and shed from the membrane. Because GFP is fused to the C-terminus (cytoplasmic domain?) of LRP-1, it is conceivable that GFP can be still anchored to the plasma membrane even after ectodomain shedding. If the authors wish to present their model, they should examine the proteolytic cleavage of LRP-1, for example by Western blotting experiments and compare the amounts of cleaved fragments between these two experimental conditions. They also need to examine the colocalization of ADM-2 and LRP-1.2. It is not convincing that the adm-2 mutation promotes sterol uptake because more membrane-bound LRP-1 is available in the mutant background. I think LRP-1 should be endocytosed and transported to the lysosomes for sterol to be released to the cytosol. The authors, however, observed that apical accumulation of LRP-1 in nekl-3::AID failed to be suppressed by adm-2(fd318) (even slightly enhanced).I feel it might be possible that ADM-2 may act independently of LRP-1. Although the authors consider that ADM-2 inhibits molting through its negative regulation of steroid hormone biosynthesis, another possibility is that ADM-2 may inhibit the process downstream of the NHR hormone receptors or a hormone-independent process. I think this possibility should be addressed for example by examining whether the lrp-1 null mutation can fully block the suppressing effect of adm-2 on nekl-2; nekl-3 defects. Also, it will be interesting to see if adm-2 can suppress the molting phenotype of the lrp-1 null mutant. If the authors observe any improvement in molting in adm-2; lrp-1 double mutants, that means that adm-2 can act in an lrp-1-independent pathway.3. The ADM-2::GFP is expressed in various tissues including hypodermis. Although the authors believe that loss of the adm-2 function in hypodermis is responsible for the suppression, it is still unclear. The authors need to experimentally determine the responsible tissues for example by expressing adm-2 using tissue-specific promoters in the adm-2; nekle-2; nekl-3 mutant background or tissue-specific adm-2 RNAi experiments in the nekle-2; nekl-3 mutant background.4. The patterns of expression of ADM-2 and LRP-1 were analyzed using mScarlet or GFP fusions. I think it is important to use functional fusion constructs to determine the protein localization. Please mention whether these constructs are functional or not.5. It is reported that the cytoplasmic domain of human ADAM13 is cleaved and translocated into the nucleus to regulate neural crest cell migration and that the cytoplasmic domain of ADM-2 can be functionally replaced with that of ADAM13. Because mutations either in the catalytic domain or the cytoplasmic domain of ADM-2 can act as suppressors, I am curious if the authors observed the localization of ADM-2::GFP or ::mScarlet in the nucleus.6. Although the authors isolated various alleles in adm-2, detail information for the mutation sites are provided for only part of the alleles. Please provide all the information if possible.7. Fig. 4 M-O. Which focal plane do these photos depict?8. Fig. S1. ADAM family members should be reworded as “ADAM and ADAMTS family members”. Also, in the text.Minor comments:1. Fig. 3C, D. Please indicate a scale bar.2. line 200. ADM-2 can be adm-2.3. line 226 S3D can be S3G.4. line 235-236. ADM-2::GFP is not shown in Fig 4A or 4C.5. line 265. ADM-2::mScarlet is not shown in Fig 5M-P.6. line 316. ) can be missing.7. line 553. Heat shock methods for Fig 6F and G are not mentioned.Reviewer #3: SummaryThis is a thoughtful and well-executed study of the mechanism of genetic suppression of nekl(rf) molting defects by the meltrin-family metalloprotease adm-2, revealing an interesting dynamic between negative and positive regulators of the molting process and clathrin-mediated endocytosis. The structure-function analysis of ADM-2 is impressively thorough. As described in greater detail below, the manuscript would benefit from:1. inclusion of an fcho-1 control into panel 1G for comparison to adm-2 (and if possible, moving this panel to the start of figure 2).2. examination of adm-2-dependent LRP-1:GFP expression during molting (in place of, or to complement, the adult data in Figure 6f-m)3. use of fluorescence-only images (rather than DIC overlay) in Fig 6b,c and inclusion of a non-transgenic control4. Minor text edits for clarity, described below.Details1. Figure 2 Examines whether adm-2 suppression of nekl-2/3 double-rf larval molting defects could be due to restoration of CME. Panel G from figure 1 would work better at the start of figure 2, and benefit from the inclusion of an fcho-1 control for comparison (eg. fcho-1; nekl-2). This would provide clearer physiological support for the LRP-1 localization data of figure 2, which differs in both the stage (adult vs. larvae) and the genetic background (NEKL-3 AID vs. nekl-2/3(rf) from the phenotype (molting defect suppression). A note on the choice of this system for examination of LRP-1 expression (eg., rather than performing nekl-3AID from hatching, examining at the onset of molting defects) would also be helpful to the reader.2. Similarly, the examination of LRP-1:GFP expression in Figure 6 was performed in adults rather than larvae. I suggest adding an experiment examining adm-2-dependent changes in LRP-1 expression during molting, if possible. If LRP-1:GFP is below the limit of detection in larvae, it should be noted, with corresponding interpretations of adm-2 function expressed in more conservative language.3. The heat shock dependence of the hs:ADM-4GFP transgene (Fig 6b,c) would be better illustrated by fluorescence-only images (black background) rather than fluorescence/DIC overlays, and by inclusion of a non-transgenic control.4. Minor edits:a. abstract: “Whereas loss of ADM-2 activity led to the upregulation of LRP-1, ADM-2 overexpression caused a reduction in LRP-1 abundance…” this sentence would benefit from an indication that this refers to the apical surface. eg) “Whereas loss of ADM-2 activity led to increased levels of apical LRP-1, ADM-2 overexpression caused a reduction in apical LRP-1 abundance…”b. lines 45-46: the phrasing makes it sound like adm-2 regulates something that in turn negatively regulates LRP-1. Re-phrase for clarity?c. line 101: remove the word ‘caused’ for clarityd. line 114: move the word ‘specifically’ to just before the word de-repressinge. For added transparency, the number of animals examined in 1E,F,G, 5c, 6a should be indicated.f. line 126: change (Fig 1A and 1E) to just (Fig 1A), as there is no rescuing array in 1E and its description in line 128 is sufficient and appropriate.g. line 136: change ‘The fd163 mutation’ to ‘The resulting intron retention’h. line 160: replace the semi-colons with commasi. line 178: replace the word ‘is’ with ‘may’ since this is based on lack of phenotypes from RNAij. line 233-234: the words ‘rare’ and ‘occasionally’ are redundant with each otherk. lines 237-239: the faintness of ADM-2 expression in hyp7 is postulated to be due to rapid turnover, possibly mediated by CME. This would make more sense to the reader if it were noted that detection at the plasma membrane was difficult to detect 'relative to other compartments'.l. line 320: the words ‘specifically’ and ‘only’ are redundant with each otherm. Figure 6 title could be more informative. Instead of “and LRP-1”, maybe “and apical abundance of LRP-1”?n. The font under the scale bars in panels 6C and E should be increased, or omitted altogether and described only in the figure legend, as is the case for panel D.o. In Figure 6m, the Phsp-16::adm-2+ genotype is shortened to Padm-2+, but hs:adm-2+ or similar might be clearer.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #1: YesReviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: Yes: Tina L. GumiennyReviewer #2: NoReviewer #3: No22 Apr 2022Submitted filename: Joseph_Rebuttal_PLoSGen.pdfClick here for additional data file.11 May 2022Dear Dr Fay,We are pleased to inform you that your manuscript entitled "An unexpected role for the conserved ADAM-family metalloprotease ADM-2 in Caenorhabditis elegans molting" has been editorially accepted for publication in PLOS Genetics. Congratulations!Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made.Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Andrew D. ChisholmAssociate EditorPLOS GeneticsGregory P. CopenhaverEditor-in-ChiefPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments from the reviewers (if applicable):Reviewer's Responses to QuestionsComments to the Authors:Please note here if the review is uploaded as an attachment.Reviewer #2: The authors mostly addressed my concerns. Their new finding in western blot analysis that ADM-2 regulates apical LRP-1 levels independently of its catalytic activity is interesting. Although the mechanism underlying their observation is unclear, it can provide an important clue to understand the action of ADAM proteases in LRP regulation and signal transduction “in vivo”.The authors also found that (RNAi) knockdown of adm-2 did NOT suppress molting defects in an lrp-1 null mutant, which could be interpreted as consistent with ADM-2 acting through LRP-1. (We note that these RNAi conditions were identical to those in which we observed nekl-2; nekl-3 suppression.)Although they do not mention this finding in their manuscript, I think the data would be better to be included to indicate the functional significance of ADM-2 regulation of LRP-1 levels.Line 353: “this” is repeated.Reviewer #3: This revision brings to light an interesting complexity in adm-2 function. While the suppression of the nekl molting defect is dependent on metalloprotease (MTP) activity (as well as other domains), adm-2 regulation of LRP-1 does not appear to involve proteolytic processing, as evidenced by Western blots of WT vs. adm-2 null mutants and by examination of LRP-1 levels in adm-2 MTP-defective mutants as well as in hs:adm-2MTP(–) animals. In addition, based on previous observations implicating dauther pathway function in the regulation of molting, the authors add data examining whether daf-5(lf) impacts the ability of adm-2 to suppress the nekl molting defect and they find that it does not.While the main targets of adm-2 in the suppression of the nekl molting defects are yet to be identified, this analysis provides insight into what promises to be a multifunctional member of the ADAM family. The authors have addressed my concerns with their original submission, and I have no additional changes to request.**********Have all data underlying the figures and results presented in the manuscript been provided?Large-scale datasets should be made available via a public repository as described in the PLOS Genetics
data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Reviewer #2: YesReviewer #3: Yes**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #2: NoReviewer #3: No----------------------------------------------------Data DepositionIf you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-01647R1More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.----------------------------------------------------Press QueriesIf you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.25 May 2022PGENETICS-D-21-01647R1An unexpected role for the conserved ADAM-family metalloprotease ADM-2 in Caenorhabditis elegans moltingDear Dr Fay,We are pleased to inform you that your manuscript entitled "An unexpected role for the conserved ADAM-family metalloprotease ADM-2 in Caenorhabditis elegans molting" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!With kind regards,Livia HorvathPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics
Authors: Srivatsan Raman; Robert Vernon; James Thompson; Michael Tyka; Ruslan Sadreyev; Jimin Pei; David Kim; Elizabeth Kellogg; Frank DiMaio; Oliver Lange; Lisa Kinch; Will Sheffler; Bong-Hyun Kim; Rhiju Das; Nick V Grishin; David Baker Journal: Proteins Date: 2009
Authors: R A Black; C T Rauch; C J Kozlosky; J J Peschon; J L Slack; M F Wolfson; B J Castner; K L Stocking; P Reddy; S Srinivasan; N Nelson; N Boiani; K A Schooley; M Gerhart; R Davis; J N Fitzner; R S Johnson; R J Paxton; C J March; D P Cerretti Journal: Nature Date: 1997-02-20 Impact factor: 49.962
Authors: Dorte Stautz; Anthony Leyme; Michael Vibo Grandal; Reidar Albrechtsen; Bo van Deurs; Ulla Wewer; Marie Kveiborg Journal: Traffic Date: 2012-09-10 Impact factor: 6.215