Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia-Angola Border.

Tick-borne diseases (TBDs), including emerging and re-emerging zoonoses, are of public health importance worldwide; however, TBDs tend to be overlooked, especially in countries with fewer resources, such as Zambia and Angola. Here, we investigated Rickettsia, Anaplasmataceae, and Apicomplexan pathogens in 59 and 96 adult ticks collected from dogs and cattle, respectively, in Shangombo, a town at the Zambia-Angola border. We detected Richkettsia africae and Rickettsia aeschilimannii in 15.6% of Amblyomma variegatum and 41.7% of Hyalomma truncatum ticks, respectively. Ehrlichia minasensis was detected in 18.8% of H. truncatum, and Candidatus Midichloria mitochondrii was determined in Hyalomma marginatum. We also detected Babesia caballi and Theileria velifera in A. variegatum ticks with a 4.4% and 6.7% prevalence, respectively. In addition, Hepatozoon canis was detected in 6.5% of Rhipicephalus lunulatus and 4.3% of Rhipicephalus sanguineus. Coinfection of R. aeshilimannii and E. minasensis were observed in 4.2% of H. truncatum. This is the first report of Ca. M. mitochondrii and E. minasensis, and the second report of B. caballi, in the country. Rickettsia africae and R. aeschlimannii are pathogenic to humans, and E. minasensis, B. caballi, T. velifera, and H. canis are pathogenic to animals. Therefore, individuals, clinicians, veterinarians, and pet owners should be aware of the distribution of these pathogens in the area.

1. Introduction

Ticks are important blood-sucking arthropods in medical and veterinary science, second to mosquitos. They not only cause anemia in their hosts, but also carry and transmit a broad range of viruses, bacteria, and protozoa. Some of these microorganisms cause tick-borne diseases (TBDs), which include emerging and re-emerging infectious diseases [1,2]. To date, TBDs have been considered a focal point for human and animal health worldwide. The identification of novel viral and bacterial TBD-causing agents has increased in recent times [3]. An example of emerging TBD agents is Borrelia fainii, which was first isolated from a febrile patient in Zambia in 2019 [4]. Ornithodoros faini ticks and Rousettus aegyptiacus bats are considered as a vector and natural reservoir of Borrelia fainii, respectively [4]; however, TBDs tend to be overlooked, especially in low-resource countries, because of limitations in diagnostic infrastructure.

Tick-borne bacterial pathogens include Rickettsia, Anaplasma, Ehrlichia, Coxiella, Orientia, and Borrelia. Among them, Rickettsia are obligate intracellular Gram-negative bacteria, and are recognized as the causative agents of important emerging TBDs [5,6]. The symptoms of human rickettsiosis include chills, high fever, headache, skin rash, and photophobia [7]. Species of the agents of human rickettsiosis differ region-wise. For example, R. japonica causes Japanese spotted fever prevalent in East Asia, R. parkeri causes American Boutonneuse Fever in the USA, and R. africae causes African tick bite fever in Africa [8,9,10,11]. Furthermore, Anaplasma and Ehrlichia are obligate intracellular bacteria belonging to the family Anaplasmataceae. Some of these bacteria cause TBDs in humans and animals. For example, A. phagocytophilum causes human granulocytic anaplasmosis and has been reported worldwide, including in Africa [12,13,14]. Anaplasma platys has primarily been isolated from dogs with cyclic thrombocytopenia; it has also been reported in Africa [15]. Importantly, human infection with A. platys has also been reported in Venezuela and South Africa [16,17].

The common tick-borne protozoan pathogens are members of the phylum Apicomplexa and belong to the genera Babesia, Theileria, and Hepatozoon. Babesia microti, B. divergens, B. venatorum, and B. duncani are the major etiological agents of human babesiosis. Most human cases of babesiosis have been reported in the USA, but this disease has also been reported in Asia, Africa, Australia, Europe, and South America [18]. Babesia gibsoni, B. canis, B. rossi, and B. vogeli are widely known as causative agents of canine babesiosis [19]. Babesia bigemina and B. bovis are agents of bovine babesiosis [20,21]. Theileria species, particularly T. annulata and T. parva, have caused the most significant economic losses in livestock production worldwide. Theileria annulata causes tropical theileriosis in several tropical regions in southern Europe, northern Africa, and Asia [22]. Conversely, T. parva causes East Coast fever, which is distributed in the eastern, central, and southern parts of Africa [23]. Hepatozoon canis and H. americanum have been reported to cause canine and feline hepatozoonoses worldwide, which are the most common and important tick-borne hepatozoonoses [24].

Studies on tick-borne pathogens in Zambia, such as Rickettsia, Anaplasmataceae, and Apicomplexa, have primarily been conducted in the southern, central, and eastern parts of the country [15,25,26,27,28,29,30,31]. Angola is a neighboring country and shares borders with the western region of Zambia. A few studies on tick-borne pathogens have also been reported in Angola, primarily in the central and western regions [31,32]. Geographically, wildlife can easily pass through the Zambia–Angola border, and ticks might be attached to the bodies of animals during transit. Therefore, the investigation of ticks and tick-borne pathogens in the Zambia–Angola border may provide valuable information for a better understanding of the distribution of TBDs in western Zambia and eastern Angola. In this study, we performed the molecular-level screening and characterization of Rickettsia, Anaplasmataceae, and Apicomplexa detected from ticks in Shangombo at the Zambia–Angola border.

2. Results

2.1. Identification of Tick Species

Overall, we collected 59 and 96 adult ticks infesting dogs and cattle, respectively, in Shangombo, a town in the Zambia–Angola border region (Figure 1). Morphological identification revealed that 2 Amblyomma variegatum (males), 31 Rhipicephalus lunulatus (12 females and 19 males), 23 R. sanguineus (10 females and 13 males), and 3 Rhipicephalus spp. (males) ticks were collected from dogs, and 1 A. pomposum (male), 43 A. variegatum (7 females and 36 males), 1 Hyalomma marginatum (female), 48 H. truncatum (14 females and 34 males), and 3 R. appendiculatus (females) ticks were collected from cattle (Table 1).

Figure 1

Map of the sampling site. The red and black dots are sampling place and capital city, respectively.

Table 1

Number of samples used in the study.

Host Species	Tick Species	Female	Male
Dogs	Amblyomma variegatum	0	2
	Rhipicephalus lunulatus	12	19
	R. sanguineus	10	13
	Rhipicephalus spp.	0	3
Cattle	A. pomposum	0	1
	A. variegatum	7	36
	Hyalomma marginatum	1	0
	H. truncatum	14	34
	R. appendiculatus	3	0

2.2. Detection and Characterization of Rickettsia

Ticks infesting cattle were used for screening Rickettsia spp. using a polymerase chain reaction (PCR) targeting the gltA gene. As a result, Amblyomma variegatum (n = 7) and Hyalomma truncatum (n = 20) were positive for Rickettsia spp., representing three sequence variants. Sequence variants 1 and 2 identified from A. variegatum showed 100% identities to Rickettsia africae clones AT-11 and C10-F8-303, respectively, while sequence variant 3 identified from H. truncatum showed a 100% identity to Rickettsia aeschlimannii (Figure 2). Prevalence of R. africae in A. variegatum and R. aeschlimannii in H. truncatum were 15.6% and 41.7%, respectively.

Figure 2

Phylogenetic trees of detected Rickettsia spp. based on the sequences of five genes: (a) gltA; (b) ompA; (c) ompB; (d) sca4; and (e) htrA. The accession numbers for the nucleotide sequences are provided after the species names. The analyses were performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are indicated on the interior branch nodes.

2.3. Detection and Characterization of Anaplasmataceae

For the screening of Anaplasmatacea, 59 ticks from dogs and 96 ticks from cattle were used. Hyalomma truncatum (n = 10) and H. marginatum (n = 1) were positive for Anaplasmataceae, representing three sequence variants. Sequence variants 1 and 2 identified from H. truncatum showed 100% identities to Ehrlichia sp. and Ehrlichia minasensis, respectively, while sequence variant 3 identified from H. marginatum showed a 100% identity to Candidatus Midichloria mitochondrii (Figure 3). The prevalence of Ehrlichia sp. and E. minasensis in H. truncatum were 2% and 18.8%, respectively, while the prevalence of Ca. Midichloria mitochondrii in H. marginatum was 100%.

Figure 3

Phylogenetic trees of Anaplasmataceae based on partial 16S ribosomal DNA sequences (305 bp). The analysis was performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are shown on the interior branch nodes.

2.4. Detection and Characterization of Apicomplexa

The same ticks collected from dogs and cattle were used to screen Apicomplexa. As a result, Rhipicephalus lunulatus (n = 2), R. sanguineus (n = 1), and Amblyomma variegatum (n = 5) were positive for Apicomplexa, representing three sequence variants. Sequence variant 1 identified from R. lunulatus and R. sanguineus showed a 100% identity to Hepatozoon canis. Sequence variant 2 identified from three A. variegatum showed a 100% identity to Theileria velifera, while sequence variant 3 identified from two A. variegatum showed a 98.1% identity to Babesia caballi (Figure 4). The prevalence of H. canis in R. lunulatus and R. sanguineus was 6.5% and 4.3%, respectively, while the prevalence of T. verifera and B. caballi in A. variegatum was 6.7% and 4.4%, respectively.

Figure 4

Phylogenetic tree of the detected protozoa based on the partial 18S ribosomal DNA sequences. The accession numbers for the nucleotide sequences are mentioned after the species names. The analyses were performed using the maximum likelihood method. Bootstrap values >70% based on 1000 replications are presented on the interior branch nodes.

2.5. Coinfection

Coinfections of Rickettsia aeschlimannii and Ehrlichia minasensis were observed from two Hyalomma truncatum ticks. None of the tick samples were coinfected with Apicomplexa and Rickettsia or Anaplasmataceae.

3. Discussion

We investigated the presence of Rickettsia, Anaplasmataceae, and Apicomplexa species in ticks collected from cattle and dogs in Shangombo, a town located at the border of Zambia and Angola. We identified R. africae, R. aeschlimannii, E. minasensis, Ehrlichia sp., Ca. M. mitochondrii, H. canis, T. velifera, and B. caballi. To the best of our knowledge, this is the first study to report Ca. M. mitochondrii and E. minasensis, and the second study to report B. caballi, in the country.

Rickettsia africae detected from A. variegatum in this study is widely known as a causative agent of African tick bite fever, which is one of the zoonotic tick-borne fevers from the spotted fever group of rickettsiae of emerging global health concern [33]. In addition, we also detected Rickettsia aeschlimannii from H. truncatum, which is a human pathogenic rickettsia [34]. Previous epidemiological studies on rickettsia in Zambia were conducted in the central, eastern, and southern parts of the country [25,26,35,36,37,38,39]. Thus, this study is the first evidence of pathogenic rickettsiae in the western part of the country.

Ehrlichia minasensis was first isolated from cattle in midwestern Brazil in 2014, and it was experimentally confirmed to be an agent of clinical ehrlichiosis in calves [40]. To date, E. minasensis has been reported worldwide, including in South Africa, Kenya, and Ethiopia [41,42,43]. The primary vectors of E. minasensis are Rhipicephalus microplus and other Rhipicephalus ticks, but it has also been detected in Amblyomma, Hyalomma, and Haemaphysalis ticks [44,45,46,47]. In this study, E. minasensis was detected in nine H. truncatum ticks for the first time in Zambia. Our results expanded the distribution records of E. minasensis, suggesting the likelihood of bovine ehrlichiosis caused by E. minasensis occurring in Zambia. Further investigations of E. minasensis are warranted to evaluate the current situation in the country.

Candidatus Midichloria mitochondrii is an endosymbiont of ixodid ticks, such as Ixodes ricinus, A. americanum, H. marginatum, R. turanicus, and H. wellingtoni, and has been reported worldwide [48,49,50,51,52]. Recently, it was also reported in the argasid tick, Ornithodoros turicata [53]. The role of Ca. M. mitochondrii in the host tick is speculated to enhance the host fitness and/or for ensuring its presence in the host population [54]. In this study, we provided the first evidence of Ca. M. mitochondrii in H. marginatum ticks in Zambia.

We detected Theileri velifera and Babesia caballi in A. variegatum. Theileria velifera has been associated with low pathogenic or asymptomatic animal infections in cattle in Africa. Previous studies have reported the detection of T. velifera in impalas, buffalos, and cattle in Zambia, and it has been found to show a high prevalence in cattle [55,56], while, B. caballi is a pathogenic protozoan found in horses, donkeys, and zebras. Interestingly, B. caballi was detected in A. variegatum ticks infesting cattle in the Republic of Guinea [57] and was detected in 5.3% (16/299) of cattle blood samples by a reverse line blot hybridization assay in Zambia [55], even though B. caballi is known as an equine babesia. Thus, we speculated that a genotype of B. caballi is able to infect cattle and be carried by A. variegatum; however, further studies on the B. caballi in cattle in Zambia are required to evaluate this hypothesis.

Hepatozoon canis, an agent of canine hepatozoonosis [24,58], was detected in two R. lunulatus and one R. sanguineus ticks in the present study. In addition, a previous study in the same area showed a relatively high prevalence of H. canis in dogs [15]. Therefore, Shangombo might be an endemic area of H. canis. For better vigilance, veterinarians and dog owners residing in an around Shangombo should be aware of the symptoms of canine hepatozoonosis.

Amblyomma variegatum is a three-host tick that utilizes different hosts during each life stage. The larva and nymph ticks are generally present in great numbers on small mammals and birds, such as the mongoose and cattle egret. While adult ticks utilize larger mammals, such as camels and cattle. Evidence of cattle egret playing a role in transporting the larvae and nymphs of the tick, and that the dispersal of A. variegatum is associated with the migration patterns of the bird have been reported [59,60]. Given this, as well as the detection of R. africae, T. velifera, and B. caballi in A. variegatum, these pathogens might be crossing the Zambia–Angola border.

In this study, ticks were collected from dogs and cattle. Therefore, we cannot eliminate the possibility for detecting pathogens in blood meal in ticks, which is the limitation of this study. Further study in ticks collected from pasture in the study area is required to determine the vector ticks of the detected pathogens.

In conclusion, we studied tick-borne bacterial and protozoan pathogens in Shangombo, as there is relatively limited information on tick-borne pathogens in this area. This study provided information on the presence of R. africae, R. aeschlimannii, E. minasensis, Ca. M. mitochondrii, H. canis, T. velifera, and B. caballi in the study region. The information may be helpful to researchers and individuals not only from Zambia but also from Angola for preventing TBDs. Further investigation of tick-borne pathogens in the area is necessary to evaluate the prevalence of TBDs in the area.

4. Materials and Methods

Ticks were removed using a tick twister (H3D, Lavancia, France) or forceps from dogs and cattle in Shangombo (16.32 S, 22.10 E) (Figure 1), Western province, Zambia, in January 2016. The tick species were identified based on morphological taxonomic keys using a stereomicroscope [61]. The total DNA was extracted from individual ticks using a TRIzol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions.

For screening the rickettsial infections, DNA samples from tick-infested cattle were initially tested using gltA-PCR, as previously described [62]. The gltA-PCR was performed with the primers gltA_Fc and gltA_Rc, and the 20-μL reaction mixture contained 0.1 μL Ex Taq Hot Start version (Takara Bio Inc., Shiga, Japan), 2 μL 10 × Ex Taq buffer, 1.6 μL 2.5 mM dNTP mixture, 200 nM of each primer, and 2 μL template DNA. UltraPure™ distilled water (Invitrogen) was added as a negative control instead of template DNA. The PCR products were electrophoresed in a 1.2% agarose gel stained with Gel-Red™ (Biotium, Hayward, CA, USA), and visualized with a UV trans-illuminator. When the gltA-PCR yielded a positive result, the selected samples were used for further characterization based on the sequences of four additional genes: ompA, ompB, sca4, and htrA. The primers used in this study are listed in Table 2.

Table 2

Primers used in this study.

Organisms	Gene	Primer Name	Expected Size (bp)	Sequence (5′-3′)	Reference
Rickettsia	gltA	gltA_FcgltA_Rc	580	CGAACTTACCGCTATTAGAATGCTTTAAGAGCGATAGCTTCAAG	[62]
	ompA	Rr.190.70pRr.190.602n	530	ATGGCGAATATTTCTCCAAAAAGTGCAGCATTCGCTCCCCCT	[65]
	ompB	120_3599120_2788	816	TACTTCCGGTTACAGCAAAGTAAACAATAATCAAGGTACTGT	[66]
	sca4	D1fD928r	928	ATGAGTAAAGACGGTAACCTAAGCTATTGCGTCATCTCCG	[67]
	htrA	17K_317K_5	552	TGTCTATCAATTCACAACTTGCCGCTTTACAAAATTCTAAAAACCATATA	[68]
Anaplasmataceae	16S rDNA	EHR16SDEHR16SR	345	GGTACCYACAGAAGAAGTCCTAGCACTCATCGTTTACAGC	[63]
Babesia-Theileria-Hepatozoon	18S rDNA	BTH-1FBTH-1R	690	CCTGMGARACGGCTACCACATCTTTGCGACCATACTCCCCCCA	[64]

For the detection and characterization of Anaplasmataceae, PCR targeting the 16S rDNA of family Anaplasmataceae was performed using the primers EHR16SD and EHR16SR [63]. The universal primer set BTH-1F and BTH-1R, targeting the 18S rRNA gene of Babesia–Theileria–Hepatozoon, was used for the detection and characterization of tick-borne apicomplexans [64].

The PCR products were purified using ethanol precipitation or were cloned using the pGEM-T Easy Vector system (Promega, Southampton, Hampshire, UK) and DH5 alpha competent cells (TOYOBO, Osaka, Japan). Cycle sequencing for all amplicons was conducted using the BigDye Terminator version 3.1 chemistry (Applied Biosystems, Foster City, CA, USA). Sequencing products were run on a 3130xl Genetic Analyzer (Applied Biosystems). The DDBJ/EMBL/GenBank accession numbers obtained were LC683090 to LC683109 (See Supplementary Table S1).

Sanger sequencing data from amplified PCR products were analyzed using GENETYX version 9.1 (GENETYX Corporation, Tokyo, Japan). Phylogenetic analysis was conducted using MEGA version X [69]. The sequences were aligned with closely related sequences deposited in the databases (DDBJ/EMBL/GenBank) using ClustalW, and a maximum likelihood phylogram was applied to generate the phylogenetic trees.