Literature DB >> 33256809

Investigation of the piroplasm diversity circulating in wildlife and cattle of the greater Kafue ecosystem, Zambia.

David Squarre1,2,3, Yukiko Nakamura1, Kyoko Hayashida1,4, Naoko Kawai1, Herman Chambaro1,5, Boniface Namangala6, Chihiro Sugimoto1, Junya Yamagishi7,8.   

Abstract

BACKGROUND: Piroplasms are vector-borne intracellular hemoprotozoan parasites that infect wildlife and livestock. Wildlife species are reservoir hosts to a diversity of piroplasms and play an important role in the circulation, maintenance and evolution of these parasites. The potential for likely spillover of both pathogenic and non-pathogenic piroplasm parasites from wildlife to livestock is underlined when a common ecological niche is shared in the presence of a competent vector.
METHOD: To investigate piroplasm diversity in wildlife and the cattle population of the greater Kafue ecosystem, we utilized PCR to amplify the 18S rRNA V4 hyper-variable region and meta-barcoding strategy using the Illumina MiSeq sequencing platform and amplicon sequence variant (ASV)-based bioinformatics pipeline to generate high-resolution data that discriminate sequences down to a single nucleotide difference.
RESULTS: A parasite community of 45 ASVs corresponding to 23 species consisting of 4 genera of Babesia, Theileria, Hepatozoon and Colpodella, were identified in wildlife and the cattle population from the study area. Theileria species were detected in buffalo, impala, hartebeest, sable antelope, sitatunga, wild dog and cattle. In contrast, Babesia species were only observed in cattle and wild dog. Our results demonstrate possible spillover of these hemoprotozoan parasites from wildlife, especially buffalo, to the cattle population in the wildlife-livestock interface.
CONCLUSION: We demonstrated that the deep amplicon sequencing of the 18S rRNA V4 hyper-variable region for wildlife was informative. Our results illustrated the diversity of piroplasma and the specificity of their hosts. They led us to speculate a possible ecological cycle including transmission from wildlife to domestic animals in the greater Kafue ecosystem. Thus, this approach may contribute to the establishment of appropriate disease control strategies in wildlife-livestock interface areas.

Entities:  

Keywords:  Kafue ecosystem; Meta-barcoding; Piroplasma; Zambia

Mesh:

Year:  2020        PMID: 33256809      PMCID: PMC7708252          DOI: 10.1186/s13071-020-04475-7

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Piroplasmida is an order of intracellular heamoprotozoan parasites that belong to the phylum Apicomplexa. The species of genera Theileria and Babesia cause clinical disease in vertebrate hosts including domestic and wild animals [1, 2]. The parasites are transmitted by vectors of ixodid ticks and have a considerable socio-economic impact on livestock production in sub-Saharan Africa, threatening livelihoods and food security [3]. The Theileria and Babesia genera consist of a wide diversity of species and genotypes [4, 5]. Wildlife plays an important role in the circulation, maintenance and evolution of these parasites. African buffalos (Syncerus caffer), for example, are reservoirs of buffalo-derived Theileria parva, which causes theileriosis or corridor disease in cattle [6, 7]. This disease is transmitted from buffalo to cattle and not between cattle, because cattle acutely die before piroplasms emerge or infect new ticks [8, 9]. Conversely, in East Coast fever (ECF) caused by T. parva circulating among the cattle population, some infected cattle survive because of the immune response and occasional chemotherapy and then become asymptomatic carriers, leading to the continuous spread of the parasite among cattle [10]. Although Theileria is by far the most important piroplasma having a considerable effect on livestock production, Babesia also cause a wide range of infectious diseases in domestic animals. Redwater in cattle, canine babesiosis and equine piroplasmosis are caused by Babesia bigemina/B. bovis, B. canis and B. caballi/B. equi, respectively. Several wildlife species are natural hosts of a wide diversity of piroplasma that are either pathogenic or non-pathogenic to domestic animals. The greater Kafue ecosystem, measuring 68,000 km2 in size, is a large conservation area in central Zambia. It is composed of the Kafue National Park (22,400 km2) and nine adjacent game management area (GMAs) that act as a buffer to the national park. The national park is host to numerous wildlife species and particularly is devoid of human settlements and livestock. The GMAs that immediately surround the park are notably characteristic of wildlife cohabiting with communities and their livestock, thus forming a wildlife-livestock interface area [11, 12]. The potential for likely spillover of arthropod-borne pathogens such as piroplasmas from wildlife to livestock occurs when a common ecological niche is shared in the presence of a competent vector [13]. In addition to the interface in conservation areas, the growing game ranching industry in Zambia has integrated wildlife and livestock farming, creating widespread patches of ex-situ wildlife-livestock interface areas across the country. The primary source of wildlife for stocking game ranches is conservation areas such as the greater Kafue ecosystem. This is likely to spread parasites and create a vortex of piroplasm parasites across the country. Highlighting comprehensive piroplasm parasite community composition including cryptic species/genotype diversity of circulating parasites in the wildlife, livestock and vector population is essential to understand disease ecology and to prepare optimized countermeasures. A reservoir of important pathogens and their transmission path will be illustrated by this approach. Interaction between pathogens under mixed infection, which may cause discriminated manifestation, is another interest. Understanding the parasite community also has implications for the choice of assays to adopt in control options such as calf immunization and in epidemiology studies of piroplasm infections [14-18]. It provides basic information for the selection of live or recombinant vaccines to be used in a specific area as well [19]. To investigate the parasite diversity, deep amplicon sequencing of the 18S rRNA V4 hyper-variable region by next-generation sequencing (NGS) technology has been developed [14, 17, 20, 21]. The scheme has been adopted for cattle [20], African buffalo [14, 17], Asian buffalo, cattle and sheep [21]. We also adopted the scheme and expanded the target to whole wildlife in this study to investigate and illustrate the diversity of the piroplasm community in wildlife and cattle in a discrete geographical region of the greater Kafue ecosystem of Zambia.

Methods

Sample collection and DNA extraction

The greater Kafue ecosystem (Fig. 1) is a conservation area located in central Zambia (14°03″ S/16°43″ S and 25°13″ E/26°46″ E) measuring about 67,806 km2 in size. Whole-blood samples were collected from wild animals captured during a restocking program conducted between May and August of 2017 and 2018. Approximately 5 mL of blood was collected through venipuncture into EDTA vacutainers and immediately placed on ice. The samples were collected from 253 wild animals consisting of 12 wildlife species (Table 1) during chemical immobilization and physical restraint as previously described [22, 23]. An additional 232 blood samples were collected from cattle in the interface between the GMA and open area in Zambia’s Itezhi-Tezhi district between April and May 2019 (Table 1).
Fig. 1

Map of the Kafue ecosystem consisting of the Kafue National Park and the game management areas (GMAs) showing sampling sites of wildlife and cattle

Table 1

Detection of heamoparasites in wildlife species and cattle from the Kafue ecosystem using RLB-PCR

Species sampledNumberRLB-PCR positivePositive rate (%)
1Impala (Aepyceros melampus)1066561.3
2Hartebeest (Alcelaphus buselaphus)471940.0
3Sable antelope (Hippotragus niger)88100
4Lion (Panthera leo)4125.0
5Wild dog (Lycaon pictus)22100
6Sitatunga (Tragelaphus spekii)4374.0
7Buffalo (Syncerus caffer)533362.3
8Lechwe (Kobus leche leche)900.0
9Cheetah (Acinonyx jubatus)100.0
10Vevert monkey (Chlorocebus pygerythrus)100.0
11Baboon (Papio ursinus)100.0
12Warthog (Phacochoerus africanus)1700.0
13Cattle (Bos taurus)23214763.4
Total48327857.6
Map of the Kafue ecosystem consisting of the Kafue National Park and the game management areas (GMAs) showing sampling sites of wildlife and cattle Detection of heamoparasites in wildlife species and cattle from the Kafue ecosystem using RLB-PCR From each blood sample collected, genomic DNA was extracted using the DNA Isolation Kit for Mammalian Blood (Roche Applied Science, Indianapolis, IN, USA) for wild animal samples and QuickGene DNA Whole-Blood Kit S (Kurabo, Osaka, Japan) for cattle samples as per the manufacturer’s protocol. A final volume of 200 μL DNA was eluted in tubes and stored at − 80 °C until analysis.

RLB-PCR amplification and library preparation

Amplification of the V4 hypervariable region of the 18S rRNA gene was obtained by piroplasma-specific RLB-PCR using primers RLB-F and RLB-R (Table 2) [24]. The 10 μL reaction mix contained 5.0 μL Ampdirect plus buffer (Shimadzu, Kyoto, Japan), 3.95 μL PCR-grade water, 0.05 μL Bio Taq HS (Bioline, London, UK), 0.5 μL DNA template and 0.25 μL each of the RLB primers. The thermocycler conditions were 94 °C for 10 min denaturation and 40 cycles of 94 °C for 1 min, annealing at 50 °C for 1 min, extension at 72 °C for 1.5 min and final extension at 72 °C for 10 min.
Table 2

Primers used for piroplasm parasite detection

Primer’s target regionPrimer namePrimer sequence (5′–3′)References
18S rRNA V4 hyper-variable regionReverse Line Blot-F (RLB-F)GAGGTAGTGACAAGAAATAACAATA[24]
Reverse Line Blot-R (RLB-R)TCTTCGATCCCCTAACTTTC
Illumine tail-tagged RLB primerIllumina RLB-FACACTCTTTCCCTACACGACGCTCTTCCGATCT[RLB-F]
Illumina RLB-RGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT[RLB-R]
Illumina-index primerIllumina-i5 primersAATGATACGGCGACCACCGAGATCTACAC[index*] ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina-i7 primersCAAGCAGAAGACGGCATACGAGAT[index*] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

*Index: 8-bp nucleotide to provide a unique index to each sample

Primers used for piroplasm parasite detection *Index: 8-bp nucleotide to provide a unique index to each sample The second PCR adding Illumina tail was conducted using 100 times diluted first PCR amplicons as template. The reaction volume of 10 μL comprised the same volumes of reagents as the first RLB-PCR but instead replaced the primer with 10 μM Illumina tail-tagged RLB primers (Table 2). The thermocycler conditions were the same as for the first PCR except amplification was set at 12 cycles. The Illumina tail-tagged amplicons from the second PCR were then diluted 50 times, and 1 μL was added to a 20 μL reaction mixture for index PCR. The other reagents included 4 μL of 5× buffer, 1.4 μL MgCl2 (25 mM), 0.5 μL 10 mM dNTP mix, 1 μL mixed Illumina-index primer (Table 2), 11.975 μL nuclease-free water and 0.125 μL KAPATaq Extra. The indexing PCR was run with thermocycler conditions of 95 °C initial denaturation for 5 min followed by 15 cycles of 92 °C for 30 s, 45 °C for 30 s and 72 °C for 30 s and a final extension at 72 °C for 15 min. The obtained amplicons, which have a unique 8-bp index on both sides for each sample, were quantified by agarose gel electrophoresis. Then, an equal amount of each sample was pooled into one library and gel-purified using Wizard SV Gel and the PCR Clean-Up System (Promega, Madison, WI, USA).

Amplicon sequencing and bioinformatic analysis

The RLB-PCR amplicon library was sequenced with the MiSeq [17, 21] using a 300-bp paired-end sequencing protocol and the MiSeq Sequencing Reagent Kit v3 (Illumina, Hayward, CA, USA) with 25% PhiX DNA spike-in control according to the manufacturer’s instructions. Quality control and filtering were conducted with Trimmomatic [25] using the following parameters: TRAILING:20, SLIDINGWINDOW:4:15 and MINLEN:36. Concatenation between forward and reverse reads and primer trimming was conducted with AMPtk [26], allowing a minimum merged length of 400 bp. Primer sequences to be trimmed were GAGGTAGTGACAAGAAATAACAATA and TCTTCGATCCCCTAACTTTC for forward and reverse reads, respectively. A set of amplicon sequence variants (ASVs) was generated by DADA2 and LULU in the AMPtk package using the default parameters. The obtained sequences were annotated based on sequence homology with the Basic Local Alignment Tool (BLAST) and non-redundant nucleotide database by NCBI using -max_target_seqs 1, -perc_identity 70, -qcov_hsp_perc 70 and -evalue 1e-20 as a set of parameters [27]. Operational taxonomic units (OTUs) were further generated by clustering the ASVs using usearch [28] with 99% identity as clustering threshold. Observed ASVs in each sample were filtered out if the number of the assigned reads was < 1% of the total number of assigned reads.

Phylogenetic analyses

The phylogenetic relationships among ASVs were analyzed using the neighbor-joining method [29] implemented in MEGA X [30]. The evolutionary distances were computed using the maximum composite likelihood method [31] and default parameters with 10,000 bootstraps. Visualization and annotation were conducted using iTOL v5.5 [32]. Each clade was annotated based on sequence identity obtained by the BLAST analysis.

Results

Detection of the piroplasm parasite by PCR and taxonomical annotation

Of 253 sampled wild animals, 61.3% (65/106) of impalas, 40% (19/47) of hartebeests, 62.3% (33/53) of buffalos, 74% (3/4) of sitatungas, 25% (1/4) of lions and all the sable antelope (8/8) and wild dogs (2/2) were positive for piroplasmosis by RLB-PCR. In case of cattle, 63.4% (147/232) were RLB-PCR positive. Of the 12 wildlife species sampled and screened, 7 species were infected by piroplasm parasites (Table 1, Additional file 1: Table S1). All the positive amplicons were subjected to sequence analysis to identify their taxonomic classification. In total, 2.80 M raw reads were obtained from 278 PCR positive samples and then merged into 2.46 M contigs (Additional file 1: Table S1). A total of 45 ASVs of the V4 hyper-variable region of the 18S rRNA gene were obtained from both wildlife species and cattle sampled from the greater Kafue ecosystem (Table 3). The taxonomic assignment of ASV using BLASTn resulted in the identification of four genera, Theileria, Babesia, Hepatozoon and Colpodella, which consisted of 11, 3, 2 and 1 known species and 36, 6, 2 and 1 ASVs, respectively (Additional file 1: Table S1).
Table 3

Diversity of piroplasmas detected in wildlife and cattle samples collected from the Kafue ecosystem

GenusSpeciesGenotypesBLAST top hitIDOTUASV% Identity
TheileriaT. veliferaT. veliferaT. velifera KSA_D_Th6LC43155011100.00
799.78
6499.78
9299.78
T. velifera ATheileria cf. velifera AGU7333752698.69
T. velifera BTheileria cf. velifera (Syncerus caffer) clone H4aJN572701129100.00
5599.78
T. mutansT. mutansTheileria mutans isolate MT15KU206320113100.00
1699.78
T. mutans MSDTheileria sp. B15aJN572700125100.00
T. mutans-like 1Theileria cf. mutans 1 (Syncerus caffer) clone C21bJN572699132699.56
T. mutans-like 2Theileria cf. mutans 2 (Syncerus caffer) clone Q15dJN572696144298.68
6098.46
T. parvaTheileria parva isolate F45P16MH9293222315100.00
Theileria parvaAF013418238699.78
10199.56
Theileria sp. (buffalo)Theileria sp. ex Syncerus caffer MCO-2011 clone V8bHQ8959822310100.00
1199.78
1899.56
2299.56
Theileria sp. (bougasvlei)Theileria sp. KS-2015 isolate CAT79KP4102672225100.00
T. taurotragiTheileria taurotragiL19082203597.80
214699.78
62100.00
Theileria sp. (sable)Theileria sp. BM-2010/sableGU73337816899.78
1499.57
8599.35
Theileria sp. (waterbuck)Theileria sp. NG-2013c isolate waterbuck 39 clone 6KF59707219499.35
Theileria sp. (tsessebe)Theileria sp. ex Damaliscus lunatus clone TS22_11HQ17976616999.57
2399.78
49100.00
Theileria sp. (giraffe)Theileria sp. NG-2012b isolate 44 clone 2JQ928925152*95.90
106*95.66
47*95.71
Theileria sp. (bongo)Uncultured Theileria sp. isolate BNG13MH569462171297.82
Uncultured Theileria sp. isolate BNG10MH569463181399.57
BabesiaB. bigeminaBabesia bigemina clone PR28CL7MH050387732100.00
7199.77
Babesia bigemina isolate B_bi11EF458200767100.00
Babesia bigemina clone PR38CL1BBIGMH047819719100.00
Babesia sp.Babesia sp. 9 1093 cl1KX218437105898.95
B. occultansBabesia occultans isolate Trender1KP745626628100.00
HepatozoonH. canisHepatozoon canis isolate 70MK64596984099.60
Hepatozoon sp.Hepatozoon sp. 2 BCS-2013 isolate L4KF27066598299.00
ColpodellidaeUncultured Colpodellidae clone PL31MN103986357100.00

ASV numbers shown in italics and with an asterisk represent the identity against the reference sequence of 100% and 95.7–95.9%, respectively

OTU operational taxonomic unit, ASV amplicon sequence variant

Diversity of piroplasmas detected in wildlife and cattle samples collected from the Kafue ecosystem ASV numbers shown in italics and with an asterisk represent the identity against the reference sequence of 100% and 95.7–95.9%, respectively OTU operational taxonomic unit, ASV amplicon sequence variant In the phylogenetic analysis, we observed both Theileria and Babesia clade (Fig. 2). The Theileria clade consisted of a subclade for T. velifera, T. mutans, T. parva and T. taurotragi.
Fig. 2

Phylogenetic tree of ASVs and the map of positive ASVs per animal species. On the top is the neighbor-joining tree of 45 ASV sequences, using a total of 411 positions in the final dataset. Bootstrap values > 70 are shown as proportionate size circles for each node. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Below is a table showing the positive wildlife and cattle samples for each ASV

Phylogenetic tree of ASVs and the map of positive ASVs per animal species. On the top is the neighbor-joining tree of 45 ASV sequences, using a total of 411 positions in the final dataset. Bootstrap values > 70 are shown as proportionate size circles for each node. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Below is a table showing the positive wildlife and cattle samples for each ASV The T. velifera subclade consisted of seven ASVs, and sequence identity to T. velifera was 98.7% to 100% (Table 3), suggesting all of these ASVs belong to T. velifera. The subclade was further divided into two groups based on sequence identity. One was ASV6, 29 and 55, which were detected only in buffalo; ASV7, 64 and 92 were detected only in cattle while ASV1 was detected in cattle and impala (Fig. 2, Additional file 1: Table S1). A similar correlation among sequence identity and hosts was observed in the T. mutans clade. ASV26, 42 and 60 were buffalo specific, and ASV3, 5, 16 were detected in both buffalo and cattle. All of them had more than 99.5% identity to the reference sequences of T. mutans (Fig. 2, Additional file 1: Table S1, Table 3). Interestingly, most of the observed ASVs in the T. parva clade were detected only in buffalo except ASV15 (T. parva) and ASV11 (Theileria sp. buffalo), which were detected in both buffalo and cattle (Na032 and Na142, respectively) (Additional file 1: Table S1). ASV25 showed 100% identity to Theileria sp. bougasvlei but was adjacent to the T. parva clade (Table 3, Fig. 2). T. taurotragi was detected in four cattle. ASV46 and 62 had > 99.8% identity to a T. taurotragi reference sequence but ASV35 had 97.8% identity, implying this can be categorized in a different genotype (Table 3). There were two additional clades in Theileria (Fig. 2). One consisted of ASV8, 9, 14, 23, 49 and 85. It was almost exclusively detected in hartebeest even though ASV8 and 23 were also detected in a wild dog (Da082). They showed high identity to unspecified Theileria spp. The other consisted of ASV2, 47 and 106, which were detected in impala. ASV4 was detected in both hartebeest and sable antelope but also found in a buffalo (Da109). ASV12 and 13 were detected in sitatunga. The Babesia clade consisted of a subclade for B. bigemina and B. occultans. ASVs in the B. bigemina subclade showed more than 99.8% identity to B. bigemina reference sequences. Both B. bigemina and B. occultans were detected only in cattle (Fig. 2, Table 3, Additional file 1: Table S1). A Hepatozoon canis sequence was detected in a lion and another Hepatozoon sp. was detected in a wild dog. Interestingly, a Colpodellidae sequence, ASV57, was also detected in cattle (Fig. 2, Additional file 1: Table S1).

Discussion

We applied the deep amplicon sequencing method to investigate piroplasmas [17, 21] in the wildlife and cattle population of the Kafue National Park and surrounding wildlife-livestock interface area of the greater Kafue ecosystem. Blood samples from 253 wild animals consisting of 12 mammalian species and 232 cattle were collected in 2018 and 2019, respectively. Although the wildlife and cattle were sampled in different but consecutive years, this may not have affected the comparison and interpretation of the results obtained, because fundamental change of biodiversity in a functional and resilient ecosystem like Kafue takes a long period. Our data show that 45 ASVs and 23 species consisting of 4 genera (Babesia, Theileria, Hepatozoon and Colpodella) were detected. Among the 45 ASVs, 14 were identical to previously published sequences. However, 28 ASVs demonstrated percentage identity of 95.7–99.8%, suggesting that novel genotypes may also exist. ASV2, 47 and 106 presented 95.7–95.9% identity to Theileria sp., suggesting possible novel Theileria spp. or undeposited sequences of known Theileria spp. (asterisk in Table 3). Within Theileria species, 36 ASVs were detected (Table 4). As an important natural reservoir host, buffalo had a diversity of 18 Theileria ASVs, which was the highest compared to other wildlife species. This finding is consistent with a previous report from a serological study involving buffalos [13]. Importantly, three ASVs of T. parva (OTU23 comprising ASV15, 86 and 101) were obtained from buffalo, providing important epidemiological insight into cattle in the area in terms of corridor disease transmission. Indeed, T. parva ASV15 was detected in cattle (Na032), suggesting possible spillover of T. parva from buffalo to domestic cattle. The presence of Theileria sp. (buffalo) (49.1%; 26 of 53) and Theileria sp. (bougasvlei) (18.9%; 10 of 53) in buffalo (Table 4) is of diagnostic importance as it affects the accurate detection of T. parva in mixed infections when performing hybridization PCR assay [33]. In addition to buffalo, Theileria sp. (buffalo) was also detected in the cattle population (0.4%; 1 of 232). This result supports the observations and findings from studies conducted in Kenya that also identified Theileria sp. (buffalo) from cattle, suggesting that Theileria sp. (buffalo) infection in cattle occurs in the field where buffalo and cattle share pasture [20, 34]. Nevertheless, more knowledge on the infection epidemiology and pathogenicity to cattle will be required. The presence of T. taurotragi circulating in the cattle population is consistent with findings in other similar studies [35]. The characterization of the parasite community and molecular ecology raises awareness about the consequences and limitations of specific diagnostic tests and requires further caution for the interpretation of the results used for diagnostics or surveillance in a specified area.
Table 4

Prevalence of species detected in the sampled wildlife species and cattle from the Kafue ecosystem

Parasitic speciesImpalaHartebeestSableSitatungaLionWild dogBuffaloCattleCorresponding ASV
T. velifera1 (0.9%)26 (49.1%)136 (58.6%)1, 6, 7, 29, 55, 64, 92
T. mutans20 (37.7%)140 (60.3%)3, 5, 16, 26, 42, 60
T. parva8 (15.1%)1 (0.4%)15, 86, 101
T. taurotragi4 (1.7%)35, 46, 62
Theileria sp. (buffalo)26 (49.1%)1 (0.4%)10,11,18,22
Theileria sp. (bougasvlei)10 (18.9%)25
Theileria sp. (sable)15 (31.9%)1 (50.0%)8,14,85
Theileria sp. (waterbuck)12 (25.5%)8 (100.0%)1 (1.9%)4
Theileria sp. (tsessebe)8 (17.0%)1 (50.0%)9,23,49
Theileria sp. (giraffe)65 (61.3%)2,47,106
T. bongo3 (75.0%)12, 13
B. bigemina24 (10.3%)19, 32, 67, 71
Babesia sp.1 (50.0%)58
B. occultans4 (1.7%)28
H. canis1 (25.0%)40
Hepatozoon sp.1 (50.0%)82
Colpodellodae1 (0.4%)57
Total head sampled10647844253232

ASVs amplicon sequence variants

Prevalence of species detected in the sampled wildlife species and cattle from the Kafue ecosystem ASVs amplicon sequence variants Babesia was predominantly observed in cattle but also detected in wild dogs. Babesia bigemina (10.3%; 24 of 232) and B. occultans (1.7%; 4 of 232) were the only species detected in cattle (Table 4), of which B. bigemina is a pathogenic parasite to cattle causing the clinical disorder of babesiosis, also known as redwater. These findings are similar to other comparable studies in southern Africa where the presence of Babesia in cattle and wild animals, particularly buffalo, was assessed [36]. To the best of our knowledge, this is the first report of the non-pathogenic B. ocultans in Zambia. However, its specific vectors, impact on cattle, diagnostic consequence in Babesia mixed infection and implication of infection to wildlife are not evaluated. Despite not being classified in the order of piroplasmida but Eucoccidiorida, Apicomplexan species of Hepatozoon canis and Hepatozoon sp. were detected in African lion and wild dog samples, respectively. Divergent from other arthropod-borne parasites transmitted through the vector’s salivary glands at the time of feeding, Hepatozoon are transmitted to the carnivore host exclusively by ingestion of infected vectors (ticks) during grooming [37, 38]. They cause subclinical infection in wild carnivores and clinical infection in domestic dogs [39]. Previous studies on free-ranging wild carnivores in Zambia have indicated the widespread presence of Hepatozoon sp. in lions [40]. This highlights the considered epidemiological role of wild carnivores as a sylvatic reservoir of Hepatozoon and presents the risks of likely spillover of Hepatozoon infections to domestic carnivores in the interface area. Genera of Colpodella are part of Alveolata organisms that are originally known to be free-living. However, recent studies have revealed the parasitic nature of Colpodella sp. as a human erythrocyte parasite (HEP) that has lately been reported from China to cause relapsing fevers and neurological symptoms in humans [41, 42]. Furthermore, the detection of Colpodella sp. in ticks suggests that this parasite may potentially be transmitted by tick vector(s) [41]. We detected a Colpodella sequence from one of the cattle samples, with the sequence identity of 79.6% with the reported human cases (GQ411073; Colpodella sp. HEP). The sequence detected from our cattle sample showed a perfect match (100% identity) to GenBank MN103986 (Colpodellidae clone PL31), reported in raccoon dog in Poland [43]. Thus, the detection of Colpodella sp. from a cattle sample implies support of those findings that some of the Colpodella species are associated with vertebrates and possibly cause disease. What vector is involved, how the parasite is maintained and the risk that the cattle may pose for human infection are largely undetermined. It would be important to determine the zoonotic scale of Colpodella infection to rule out incidental infections. Identification of multiple infection is the another advantage of deep amplicon sequencing [21]. It is known that the African buffalo is simultaneously infected with multiple species of Theileria [44]. According to our study, the African buffalo is the most infected animal with multiple species of Theileria (see Fig. 2 and additional data; Additional file 1: Table S1). Besides, most of the cattle were also co-infected with Theileria velifera and Theileria mutans. It is reported that co-infection of multiple Theileria spp. in cattle results in dramatically different pathological disorders compared to single-species infections [45]. Further studies with expanded sample size might demonstrate similar interactions in wildlife as well. This is particularly important since Zambia’s cattle population stronghold is in the Itezhi-Tezhi district which is adjacent to the KNP. This is cardinal as accurate diagnosis and effective control (vaccinations) of piroplasm parasites need to take the parasite community data into account. Hartebeest also tended to be co-infected with Theileria spp. In contrast, the impalas were mainly infected with Theileria spp. isolated from giraffe but hardly co-infected with other piroplasmas. The identification of tick-borne pathogens in the wildlife and cattle population in the study area supports the apparent presence of the known tick vectors implicated in their transmission. Particular Theileria species are known to be transmitted by specific ixodid tick species of Rhipicephalus appendiculatus, R. zambeziensis and Amblyomma variegatum, while Babesia species are transmitted by R. microplus, R. decororatus and R. evertsi [46, 47]. The tick species associated with transmission of Hepatozoon species is the Rhipicephalus sanguineus sensu lato (s.l.) [48]. To identify the unknown vectors of some of the parasites described in this study, there is need to conduct tick piroplasm metagenomic analysis. This would further illustrate the piroplasm parasite ecocycle more precisely.

Conclusion

Molecular epidemiology based on the strength of knowledge of the cryptic parasite community and diversity is essential in the control of piroplasmosis. Mapping of the piroplasm parasites in all major livestock landscapes beyond the Kafue ecosystem using the metagenomic approach may benefit piroplasmosis control in Zambia through high-resolution data to precisely guide diagnosis, vaccination and movement controls. Additional file 1. Metadata from Illumina MiSeq sequencing and ASV analysis.
  40 in total

1.  Basic local alignment search tool.

Authors:  S F Altschul; W Gish; W Miller; E W Myers; D J Lipman
Journal:  J Mol Biol       Date:  1990-10-05       Impact factor: 5.469

2.  Tick-borne haemoparasites and Anaplasmataceae in domestic dogs in Zambia.

Authors:  Yongjin Qiu; Chiho Kaneko; Masahiro Kajihara; Saasa Ngonda; Edgar Simulundu; Walter Muleya; May June Thu; Mudenda Bernard Hang'ombe; Ken Katakura; Ayato Takada; Hirofumi Sawa; Martin Simuunza; Ryo Nakao
Journal:  Ticks Tick Borne Dis       Date:  2018-03-26       Impact factor: 3.744

3.  Molecular epidemiology of Theileria parva in the field.

Authors:  D Geysen; R Bishop; R Skilton; T T Dolan; S Morzaria
Journal:  Trop Med Int Health       Date:  1999-09       Impact factor: 2.622

4.  Conservation of the sporozoite p67 vaccine antigen in cattle-derived Theileria parva stocks with different cross-immunity profiles.

Authors:  V Nene; A Musoke; E Gobright; S Morzaria
Journal:  Infect Immun       Date:  1996-06       Impact factor: 3.441

5.  Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization.

Authors:  J M Gubbels; A P de Vos; M van der Weide; J Viseras; L M Schouls; E de Vries; F Jongejan
Journal:  J Clin Microbiol       Date:  1999-06       Impact factor: 5.948

6.  Epidemiological analysis of tick-borne diseases in Zambia.

Authors:  Martin Simuunza; William Weir; Emily Courcier; Andy Tait; Brian Shiels
Journal:  Vet Parasitol       Date:  2010-11-24       Impact factor: 2.738

7.  Colpodella spp.-like parasite infection in woman, China.

Authors:  Cong L Yuan; Patrick J Keeling; Peter J Krause; Ales Horak; Stephen Bent; Lindsay Rollend; Xiu G Hua
Journal:  Emerg Infect Dis       Date:  2012-01       Impact factor: 6.883

8.  Mitochondrial Genome Sequences and Structures Aid in the Resolution of Piroplasmida phylogeny.

Authors:  Megan E Schreeg; Henry S Marr; Jaime L Tarigo; Leah A Cohn; David M Bird; Elizabeth H Scholl; Michael G Levy; Brian M Wiegmann; Adam J Birkenheuer
Journal:  PLoS One       Date:  2016-11-10       Impact factor: 3.240

Review 9.  Theileria parva: a parasite of African buffalo, which has adapted to infect and undergo transmission in cattle.

Authors:  W Ivan Morrison; Johanneke D Hemmink; Philip G Toye
Journal:  Int J Parasitol       Date:  2020-02-04       Impact factor: 3.981

10.  Co-infections determine patterns of mortality in a population exposed to parasite infection.

Authors:  Mark E J Woolhouse; Samuel M Thumbi; Amy Jennings; Margo Chase-Topping; Rebecca Callaby; Henry Kiara; Marinda C Oosthuizen; Mary N Mbole-Kariuki; Ilana Conradie; Ian G Handel; E Jane Poole; Evalyne Njiiri; Nicola E Collins; Gemma Murray; Miika Tapio; Olga Tosas Auguet; Willie Weir; W Ivan Morrison; Loeske E B Kruuk; B Mark de C Bronsvoort; Olivier Hanotte; Koos Coetzer; Philip G Toye
Journal:  Sci Adv       Date:  2015-03-20       Impact factor: 14.136

View more
  7 in total

1.  An unusually long Rift valley fever inter-epizootic period in Zambia: Evidence for enzootic virus circulation and risk for disease outbreak.

Authors:  Herman M Chambaro; Kazuyo Hirose; Michihito Sasaki; Brigadier Libanda; Yona Sinkala; Paul Fandamu; Walter Muleya; Fredrick Banda; Joseph Chizimu; David Squarre; Misheck Shawa; Yongjin Qiu; Hayato Harima; Yuki Eshita; Edgar Simulundu; Hirofumi Sawa; Yasuko Orba
Journal:  PLoS Negl Trop Dis       Date:  2022-06-02

2.  Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia-Angola Border.

Authors:  Yongjin Qiu; Martin Simuunza; Masahiro Kajihara; Joseph Ndebe; Ngonda Saasa; Penjani Kapila; Hayato Furumoto; Alice C C Lau; Ryo Nakao; Ayato Takada; Hirofumi Sawa
Journal:  Pathogens       Date:  2022-05-10

3.  First Record of Hepatozoon spp. in Alpine Wild Rodents: Implications and Perspectives for Transmission Dynamics across the Food Web.

Authors:  Giulia Ferrari; Matteo Girardi; Francesca Cagnacci; Olivier Devineau; Valentina Tagliapietra
Journal:  Microorganisms       Date:  2022-03-25

4.  Colpodella sp. (ATCC 50594) Life Cycle: Myzocytosis and Possible Links to the Origin of Intracellular Parasitism.

Authors:  Troy A Getty; John W Peterson; Hisashi Fujioka; Aidan M Walsh; Tobili Y Sam-Yellowe
Journal:  Trop Med Infect Dis       Date:  2021-07-11

5.  Ultrastructure of Myzocytosis and Cyst Formation, and the Role of Actin in Tubular Tether Formation in Colpodella sp. (ATCC 50594).

Authors:  Tobili Y Sam-Yellowe; Hisashi Fujioka; John W Peterson
Journal:  Pathogens       Date:  2022-04-11

Review 6.  Epidemiology of Ticks and Tick-Borne Pathogens in Domestic Ruminants across Southern African Development Community (SADC) Region from 1980 until 2021: A Systematic Review and Meta-Analysis.

Authors:  Mpho Tawana; ThankGod E Onyiche; Tsepo Ramatla; Sibusiso Mtshali; Oriel Thekisoe
Journal:  Pathogens       Date:  2022-08-18

7.  Exploring Prokaryotic and Eukaryotic Microbiomes Helps in Detecting Tick-Borne Infectious Agents in the Blood of Camels.

Authors:  Wessam Mohamed Ahmed Mohamed; Alsagher O Ali; Hassan Y A H Mahmoud; Mosaab A Omar; Elisha Chatanga; Bashir Salim; Doaa Naguib; Jason L Anders; Nariaki Nonaka; Mohamed Abdallah Mohamed Moustafa; Ryo Nakao
Journal:  Pathogens       Date:  2021-03-16
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.