| Literature DB >> 35631025 |
Ravalona Jessica Zemtsa1,2, Michel Noubom1,3, Luria Leslie Founou2,4, Brice Davy Dimani5,6, Patrice Landry Koudoum1,6, Aurelia Djeumako Mbossi2, Charles Kouanfack1,7, Raspail Carrel Founou1,6.
Abstract
The exacerbation of antimicrobial resistance (AMR) is a major public health threat worldwide. In sub-Saharan Africa, there is a scarcity of data regarding multidrug-resistant (resistance to at least one antibiotic of three or more families of antibiotics) as well as extended spectrum β-lactamase-producing Enterobacterales (ESBL-PE), isolated among clinical and asymptomatically healthy patients, especially in women living with HIV (WLHIV) despite their immunocompromised status. The overarching aim of this study was set to determine the prevalence and characterize genotypically multi-drug resistant Enterobacterales (MDR-E) and ESBL- PE isolated from vaginal swabs of WLHIV attending the Yaoundé Central Hospital, Yaoundé, Cameroon. A cross-sectional study was conducted among WLHIV during a four-month periods from 1 February to 31 May 2021. A total of 175 WLHIV, of childbearing age and under antiretroviral treatment were contacted. One hundred and twenty participants (120) were recruited and vaginal swabs were collected from them. After culture on Eosine-Methylen Blue (EMB) agar, the identification of Enterobacterales was performed using API 20E kit. A double-screening of ESBL-PE was performed using a combined disc diffusion method and ROSCO Diagnostica kits. An antibiotic susceptibility test was carried out by disc diffusion as per the Kirby-Bauer method and the β-lactamase resistance genes, blaCTX-M, blaCTX-M-group1-2-9, blaTEM were molecularly characterized using a conventional Polymerase Chain Reaction (PCR). Overall, 30.83% (37/120) of the included WLHIV were colonized with Enterobacterales and the prevalence of vaginal carriage of MDR Enterobacterales among them was 62.16% (23/37). Among MDR-E isolates, the most prevalent species were E. coli (56.0%; 14/25) and K. pneumoniae (20.0%; 5/25). High rates of resistance to trimethoprim-sulfamethoxazole (96.0%; 24/25), amoxicillin-clavulanic acid (88.0%; 22/25) and gentamicin (72%; 18/25) were observed. The resistance mechanisms detected among these isolates were ESBL (48.0%; 12/25), ESBL+ porin loss (8.0%; 2/25), ESBL+AmpC (24%; 6/25), with blaCTX-M, blaCTX-M-group-1,2,9 being identified at 48.0% (12/25) for each of them and blaTEM at 72.0% (18/25). Our findings confirm the high-prevalence of MDR as well as ESBL-PE isolated in WLHIV, and suggest that a real time monitoring system of antimicrobial resistant bacteria coupled with the reinforcement of infection prevention control (IPC) strategies are needed to sustainably contain these life-threatening pathogens especially in the most vulnerable populations.Entities:
Keywords: Cameroon; ESBLs; Enterobacterales; HIV; MDR; antibiotic resistance
Year: 2022 PMID: 35631025 PMCID: PMC9143656 DOI: 10.3390/pathogens11050504
Source DB: PubMed Journal: Pathogens ISSN: 2076-0817
Summary of socio-demographics characteristics of women living with HIV according to MDR- and ESBL-positive status.
| Variables | MDR- | MDR-ESBL- | |
|---|---|---|---|
|
| 37 (31.0) | 23 (62.0) | 11 (47.82) |
|
| |||
|
| 39 [34.0; 44.0] | 36 [31.0; 41.0] | 36 [31.0; 41.0] |
|
| 38.7 [7.3] | 36 [7.1] | 36 [7.1] |
|
| |||
|
| 2 (5.41) | 1 (50.0) | 1 (50.0) |
|
| 2 (5.41) | 1 (50.0) | 1 (50.0) |
|
| 7 (18.92) | 2 (28.0) | 2 (28.57) |
|
| 10 (27.03) | 6 (60.0) | 2 (20.0) |
|
| 8 (21.62) | 7 (87.50) | 1 (12.50) |
|
| 8 (21.62) | 6 (75.0) | 3 (37.50) |
|
| |||
|
| 0 | 0 | 0 |
|
| 4 (10.81) | 3 (75.0) | 2 (50.0) |
|
| 24 (64.86) | 16 (66.67) | 6 (25.0) |
|
| 9 (24.32) | 4 (44.44) | 2 (22.22) |
|
| |||
|
| 6 (16.22) | 5 (83.33) | 2 (33.33) |
|
| 2 (5.41) | 1 (50.0) | 1 (50.0) |
|
| 7 (18.92) | 3 (42.86) | 2 (28.57) |
|
| 8 (21.62) | 6 (75.0) | 3 (37.50) |
|
| 13 (35.14) | 7 (53.85) | 2 (15.38) |
|
| 1 (2.70) | 1 (100) | 0 |
|
| |||
|
| 32 (86.49) | 20 (62.50) | 9 (28.12) |
|
| 5 (13.51) | 3 (60.0) | 1 (20.0) |
|
| |||
|
| 7 (18.92) | 4 (57.14) | 1 (14.29) |
|
| 30 (81.08) | 19 (63.33) | 9 (30.0) |
|
| |||
|
| 0 | 0 | 0 |
|
| 37 (100) | 23 (62.16) | 10 (27.03) |
|
| |||
|
| 5 (13.51) | 3 (60.0) | 3 (60.0) |
|
| 1 (2.70) | 1 (100) | 0 |
|
| 6 (16.22) | 4 (66.67) | 3 (50.0) |
|
| 25 (67.57) | 15 (60.0) | 4 (16.0) |
|
| |||
|
| 15 (40.54) | 8 (53.33) | 2 (13.33) |
|
| 9 (24.32) | 7 (77.78) | 4 (44.44) |
|
| 11 (29.73) | 7 (63.64) | 3 (27.27) |
|
| 2 (5.41) | 1 (50.0) | 1 (50.0) |
|
| 0 | 0 | 0 |
* std: standard deviation, # IQR: Interquartile range, ARV: antiretroviral.
Distribution of ESBL producers among MDR and non-MDR Enterobacterales isolated in WLHIV.
|
|
|
|
|
|
|
|---|---|---|---|---|---|
|
| 15 (51.72) | 9 (31.03) | <0.0001 | 5 (17.24) | <0.0001 |
|
| 2 (28.57) | 1 (14.28) | 4 (57.14) | ||
|
| 0 | 1 (50.0) | 1 (50.0) | ||
|
| 1 (100) | 0 | 0 | ||
|
| 0 | 1 (100) | 0 (0) | ||
|
| 1 (100) | 0 | 0 | ||
|
| 1 (50.0) | 0 | 1 (50.0) | ||
|
| 1 (50.0) | 0 (0) | 1 (50.0) | ||
|
| 2 (100) | 0 | 0 | ||
|
| 0 | 1 (100) | 0 (0) | ||
|
| 23 (48.0) | 13 (27.0) | 12 (25.0) |
Distribution of antibiotic resistance among all MDR-Enterobacterales isolated from WLHIV at the Yaoundé Central Hospital.
|
|
| ||||||
|
|
|
|
|
|
|
| |
|
| 22 (88.0) | 24 (96.0) | 11 (44.0) | 14 (56.0) | 14 (56.0) | 12 (48.0) | 0 |
|
| 12 (85.7) | 14 (100) | 5 (35.71) | 6 (42.85) | 6 (42.85) | 5 (35.71) | 0 |
|
| 4 (80.0) | 5 (100) | 4 (80.0) | 5 (100) | 5 (100) | 4 (80.0) | 0 |
|
| 1 (100) | 1 (100) | 0 | 1 (100) | 1 (100) | 1 (100) | 0 |
|
| 1 (100) | 1 (100) | 0 | 0 | 0 | 0 | 0 |
|
| 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 0 |
|
| 2 (100) | 2 (100) | 1 (50.0) | 1 (50.0) | 1 (50.0) | 1 (50.0) | 0 |
|
| 1 (100) | 0 | 0 | 0 | 0 | 0 | 0 |
|
|
| ||||||
|
|
|
|
|
| |||
|
| 18 (72.0) | 14 (56.0) | 24 (96.0) | 18 (72.0) | 20 (80.0) | ||
|
| 10 (71.42) | 6 (42.85) | 14 (100) | 11 (78.57) | 10 (71.42) | ||
|
| 4 (80.0) | 3 (60.0) | 4 (80.0) | 2 (50.0) | 4 (80.0) | ||
|
| 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | ||
|
| 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | ||
|
| 1 (100) | 1 (100) | 1 (100) | 0 | 1 (100) | ||
|
| 1 (50.0) | 1 (50.0) | 2 (100) | 2 (100) | 2 (100) | ||
|
| 0 | 1 (100) | 1 (100) | 1 (100) | 1 (100) | ||
AUG: Amoxicillin-clavulanic acid, TPZ: Piperacillin-tazobactam, CTX: Cefotaxime, CTR: Ceftriaxone, CAZ: Ceftazidime, AZT: Aztreonam, IMP: Imipenem, GEN: Gentamicin, NET: Netilmicin, TMP/SXT: Trimethoprim-sulfamethoxazole, CHL: Chloramphenicol, LEV: Levofloxacin.
Figure 1Resistance levels of MDR+ESBL positive and MDR+ESBL negative Enterobacterales. AUG: Amoxicillin-clavulanic acid, TPZ: Piperacillin–tazobactam, CTX: Cefotaxime, CTR: Ceftriaxone, CAZ: Ceftazidime, AZT: Aztreonam, IMP: Imipenem, GEN: Gentamicin, NET: Netilmicin, TMP/SXT: Trimethoprim-sulfamethoxazole, CHL: Chloramphenicol, LEV: Levofloxacin.
Antimicrobial resistance profile of the 25 MDR Enterobacterales isolated among WLHIV.
| Phenotypic Profile | Number of Family of Antibiotics | Number of Antibiotics | Number of Isolates (%) |
|---|---|---|---|
| TPZ-CHL-LEV-COT | 4 | 4 | 2 (8.33) |
| AUG-TPZ-NET-CHL-COT | 4 | 5 | 1 (4.16) |
| AUG-TPZ-GEN-CHL-COT | 2 (8.33) | ||
| AUG-TPZ-CHL-LEV-COT | 1 (4.16) | ||
| AUG-TPZ-GEN-CHL-LEV-COT | 5 | 6 | 2 (8.33) |
| AUG-TPZ-AZT-GEN-CHL-COT | 5 | 1 (416) | |
| AUG-TPZ-NET-GEN-CHL-COT | 4 | 1 (4.16) | |
| AUG-CTR-NET-CHL-LEV-COT | 6 | 1 (4.16) | |
| CTX-CTR-CAZ-ATM-CHL-COT | 4 | 6 | 1 (4.16) |
| AUG-TPZ-CTR-CAZ-AZT-NET-COT-LEV | 6 | 8 | 1 (4.16) |
| AUG-TPZ-CTR-CAZ-AZT-COT-CHL-LEV | 6 | 1 (4.16) | |
| AUG-TPZ-CTX-CTR-CAZ-GEN-NET-COT-LEV | 5 | 9 | 1 (4.16) |
| AUG-TPZ-CTX-CTR-CAZ-AZT-GEN-CHL-LEV | 6 | 10 | 2 (8.33) |
| AUG-TPZ-CTX-CTR-CAZ-AZT-GEN-NET-COT | 6 | 1 (4.16) | |
| AUG-TPZ-CTX-CTR-CAZ-AZT-GEN-NET-COT-LEV | 6 | 11 | 5 (20.83) |
| AUG-TPZ-CTR-CAZ-AZT-GEN-NET-COT-CHL-LEV | 7 | 1 (4.16) | |
| AUG-TPZ-CTX-CTR-CAZ-AZT-GEN-NET-COT-CHL-LEV | 7 | 12 | 1 (4.16) |
AUG: Amoxicillin-clavulanic acid, TPZ: Piperacillin-tazobactam, CTX: Cefotaxime, CTR: Ceftriaxone, CAZ: Ceftazidime, AZT: Aztreonam, IMP: Imipenem, GEN: Gentamicin, NET: Netilmicin, TMP/SXT: Trimethoprim-sulfamethoxazole, CHL: Chloramphenicol, LEV: Levofloxacin.
Distribution of resistance mechanisms among MDR -Enterobacterales isolated in WLHIV at Yaoundé Central Hospital.
| Bacterial Species | N (%) | Resistance Mechanism | |||||
|---|---|---|---|---|---|---|---|
| ESBL | ESBL+AmpC | ESBL + Loss of Porin | AmpC | OXA-48 | KPC | ||
|
| 14 | 5 (35.71) | 1 (6.67) | 1 (6.67) | 2 (13.33) | 3 (20.0) | 1 (6.67) |
|
| 5 | 4 (80.0) | 3 (60.0) | 0 (0) | 3 (60.0) | 4 (80.0) | 0 (0) |
|
| 1 | 1 (100) | 1 (100) | 0 (0) | 0 (0) | 1 (100) | 0 (0) |
|
| 1 | 0 (0) | 1 (100) | 0 (0) | 0 (0) | 1 (100) | 0 (0) |
|
| 1 | 1 (100) | 0 (0) | 0 (0) | 0 (0) | 1 (100) | 0 (0) |
|
| 1 | 1 (100) | 0 (0) | 1 (100) | 0 (0) | 1 (100) | 0 (0) |
|
| 1 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| Overall n (%) | 25 | 12 (48.0) | 6 (24.0) | 2 (8.0) | 5 (20.0) | 11 (44.0) | 1 (4.0) |
Distribution of β-lactamase genes between MDR-Enterobacterales.
| MDR-E Species | β-Lactamases Genes | |||
|---|---|---|---|---|
|
| 12 (48.0) | 12 (48.0) | 12 (48.0) | 18 (72.0) |
| 5 (35.71) | 6(42.85) | 6(42.85) | 11 (78.57) | |
| 4 (80.0) | 4 (80.0) | 4 (80.0) | 4 (80.0) | |
| 1 (50.0) | 1 (50.0) | 1 (50.0) | 1 (50.0) | |
| 0 (0) | 0 (0) | 0 (0) | 1 (100) | |
| 1 (100) | 0 (0) | 0 (0) | 1 (100) | |
| 1 (100) | 1 (100) | 1 (100) | 1 (100) | |
Distribution of ß-lactamase genes among MDR-Enterobacterales according to their phenotypic characterization.
| MDR-E Species (n) | Phenotypic Screennig of | N (%) | |
|---|---|---|---|
|
| Positive | 4 (28.57%) | |
| 1 (7.14%) | |||
| Negative |
| 6 (42.8%) | |
| Negative | 1 (7.14%) | ||
|
| Positive | 4 (80.0%) | |
|
| Positive | 1 (50.0%) | |
|
| Negative |
| 1 (100%) |
|
| Positive |
| 1 (100%) |
|
| Positive | 1 (100%) |
Figure 2Agarose gel electrophoresis of amplified bla genes (blaTEM, blaCTX-M, blaCTX-M-group-1, 2, 9) from nine (09) MDR- isolated from vaginal swabs among HIV infected patients. L: 100 bp DNA ladder, NC: negative control, PC: positive control.
Characteristics of PCR primers.
| Primer Name | Sequence (5′-3′) | Amplicon Size (bp) | Annealing Temperatures | References | |
|---|---|---|---|---|---|
| TEM | TEMF | CATTTCCGTGTCGCCCTTATTC | 846 pb | 49.2 °C | [ |
| CTX-M | CTX-MU1 | CGATGTGCAGTACCAGTAA | 585 pb | 46.6 °C | [ |
| CTX-M-group-1,2,9 | CTX-MA1 | SCSATGTGCAGYACCAGTAA | 585 pb | 56.2 °C | [ |