Literature DB >> 35616535

Cryo-sensitive aggregation triggers NLRP3 inflammasome assembly in cryopyrin-associated periodic syndrome.

Tadayoshi Karasawa1, Takanori Komada1, Naoya Yamada1, Emi Aizawa1, Yoshiko Mizushina1, Sachiko Watanabe1, Chintogtokh Baatarjav1, Takayoshi Matsumura1, Masafumi Takahashi1.   

Abstract

Cryopyrin-associated periodic syndrome (CAPS) is an autoinflammatory syndrome caused by mutations of NLRP3 gene encoding cryopyrin. Familial cold autoinflammatory syndrome, the mildest form of CAPS, is characterized by cold-induced inflammation induced by the overproduction of IL-1β. However, the molecular mechanism of how mutated NLRP3 causes inflammasome activation in CAPS remains unclear. Here, we found that CAPS-associated NLRP3 mutants form cryo-sensitive aggregates that function as a scaffold for inflammasome activation. Cold exposure promoted inflammasome assembly and subsequent IL-1β release triggered by mutated NLRP3. While K+ efflux was dispensable, Ca2+ was necessary for mutated NLRP3-mediated inflammasome assembly. Notably, Ca2+ influx was induced during mutated NLRP3-mediated inflammasome assembly. Furthermore, caspase-1 inhibition prevented Ca2+ influx and inflammasome assembly induced by the mutated NLRP3, suggesting a feed-forward Ca2+ influx loop triggered by mutated NLRP3. Thus, the mutated NLRP3 forms cryo-sensitive aggregates to promote inflammasome assembly distinct from canonical NLRP3 inflammasome activation.
© 2022, Karasawa et al.

Entities:  

Keywords:  cytokines; human; immunology; inflammasome; inflammation; interleukin; regulated cell death

Mesh:

Substances:

Year:  2022        PMID: 35616535      PMCID: PMC9177154          DOI: 10.7554/eLife.75166

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

The cryopyrin-associated periodic syndromes (CAPS) are a spectrum of rare diseases consisting of three clinically defined autosomal dominant disorders: familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), and chronic infantile neurological, cutaneous, and articular syndrome (CINCA) (Kuemmerle-Deschner et al., 2017). These three syndromes can be classified according to severity. FCAS is the mildest form of CAPS and is characterized by cold-induced fever, arthralgia, urticaria, and conjunctivitis. MWS is accompanied by systemic amyloidosis and progressive hearing loss. CINCA is the most severe phenotype and is characterized by CNS inflammation, bone deformities, and chronic conjunctivitis. Genetic causes of these disorders are gain-of-function mutations in the NLRP3 gene, encoding cryopyrin (Hoffman et al., 2001; Brydges et al., 2009; Kuemmerle-Deschner, 2015). The mutated NLRP3 protein causes overproduction of IL-1β, resulting in systemic inflammatory characteristics, such as recurrent fever, rash, conjunctivitis, and arthralgia. NLRP3 forms a multi-protein molecular complex called ‘NLRP3 inflammasome’ (Schroder and Tschopp, 2010). NLRP3 inflammasome is composed of NLRP3, apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) which acts as an adaptor protein, and the cysteine proteinase caspase-1, and functions as a scaffold for caspase-1 activation (Schroder and Tschopp, 2010; Karasawa and Takahashi, 2017). The assembly of inflammasome complex promotes oligomerization and auto-processing of caspase-1. The active caspase-1 processes precursors of inflammatory cytokines IL-1β and IL-18 and converts them to their mature forms. Another critical role of caspase-1 is the processing of gasdermin D (GSDMD) (Liu et al., 2016; Broz et al., 2020). The processed amino-terminal domain of GSDMD binds to the plasma membrane and forms pores. Therefore, caspase-1-mediated GSDMD pore induces the release of cytosolic content and subsequent necrotic cell death called pyroptosis. Although NLRP3 was initially identified as a causative gene of CAPS (Hoffman et al., 2001), the function of NLRP3 had been unclear because CAPS is a rare disease. In 2006, however, Tschopp and his colleagues found that monosodium urate crystals activate NLRP3 inflammasome (Martinon et al., 2006). Since this finding, many studies have clarified the pivotal role of NLRP3 inflammasome in inflammatory responses in both host defense and sterile inflammatory diseases. Other investigators and we have demonstrated the pathophysiological role of NLRP3 inflammasome in cardiovascular and renal diseases (Duewell et al., 2010; Usui et al., 2012; Usui et al., 2015; Komada et al., 2014; Komada et al., 2015). Despite many findings regarding molecular mechanisms and the pathophysiological role of the NLRP3 inflammasome, the disease mechanisms of CAPS are not fully understood. In particular, although FCAS is characterized by cold exposure-induced recurrent fever and inflammation, the mechanisms by which exposure to cold regulates NLRP3 inflammasome in FCAS remain unclear (Rosengren et al., 2007; Brydges et al., 2013). In the present study, we have found that CAPS-associated NLRP3 mutants form cryo-sensitive aggregates, which function as scaffolds for NLRP3 inflammasome assembly. The aggregation of the mutated NLRP3 is sensitive to Ca2+. Therefore, mutated NLRP3 triggers inflammasome assembly driven by Ca2+ influx-mediated feed-forward regulation.

Results

CAPS-associated NLRP3 mutants form cryo-sensitive foci

To investigate the pathophysiological role of CAPS-associated NLRP3 mutants (Cordero et al., 2018), we generated cell lines expressing fusion proteins of NLRP3 mutants and a green monomeric protein, mNeonGreen (Figure 1—figure supplement 1A and B). We found that FCAS-associated NLRP3-L353P and -Y563N, as well as CINCA-associated NLRP3-D303N and -Y570C formed foci without any stimulation, while wild type (WT)-NLRP3 is expressed diffusely (Figure 1A and Figure 1—figure supplement 1C). On the other hand, ASC-GFP forms a single speck per cell. To analyze the localization of NLRP3 during NLRP3 inflammasome activation without being affected by ASC, we generated ASC KO THP-1 cells (ASC KO/EF-1-NLRP3-mNeonGreen-THP-1). NLRP3-D303N formed foci in ASC KO THP-1 cells, whereas WT-NLRP3 did not form foci upon stimulation by the NLRP3 activator nigericin, indicating that the foci are distinct from canonical inflammasome assembly (Figure 1B and C). To assess whether the foci formation is cryo-sensitive, the transduced cells were exposed to cold temperature (32°C) for 24 hr. A considerable number of foci were detected in CINCA-associated D303N and Y570C mutant-expressing cells under normal temperature (37°C). Although the number of foci was increased in all of the mutant-expressing cells under cold exposure, the sensitivity to cold exposure was prominent in FCAS-associated mutants (Figure 1D–I, and Figure 1—figure supplement 1D-G). The number of foci formed was weakly associated with expression levels of NLRP3 as indicated by fluorescence of mNeonGreen. In contrast, speck formation by ASC-GFP was not affected by cold exposure (Figure 1J and Figure 1—figure supplement 1H). These results suggest that CAPS-associated NLRP3 mutants form cryo-sensitive foci consistent with disease severity and characteristics.
Figure 1—figure supplement 1.

Expression of NLRP3-mNeonGreen and apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-GFP.

(A) Amino acid sequence of chronic infantile neurological, cutaneous, and articular syndrome (CINCA)-associated D303N mutant and familial cold autoinflammatory syndrome (FCAS)-associated L353P mutant. (B) Lysates of EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N, NLRP3-Y563N, or NLRP3-Y570C-mNeonGreen-HeLa cells were analyzed by western blot. (C) EF1-NLRP3-WT-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were analyzed by confocal microscopy. (D–G) EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. The number and area of the foci, and the fluorescence intensity of the cells were analyzed by high-content analysis. (D) The histogram of foci number in foci-positive cells. (E) The scatter plot of relative fluorescence intensity and foci number in each group. (F) Relative foci area per cell and (G) average foci area were quantified. (H) EF1-ASC-GFP-HeLa cells were cultured at 37 or 32°C for 24 hr. Representative image of confocal microscopy. (F and G) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments. WT, wild type.

Figure 1.

Cryopyrin-associated periodic syndrome-associated NLRP3 mutants form cryo-sensitive foci.

(A) EF1-NLRP3-WT-, NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-HeLa cells or EF1-ASC-GFP-HeLa cells were analyzed by confocal microscopy. Line profiles of foci or specks in the images were analyzed. (B and C) ASC KO/EF1-NLRP3-WT- or NLRP3-D303N-mNeonGreen-THP-1 cells were differentiated with 200 nM phorbol-12-myristate-13-acetate for 24 hr and then treated with nigericin for 6 hr. (B) Representative images by confocal microscopy. (C) The number of foci was counted by high-content analysis. (D–F) Differentiated ASC KO/EF1-NLRP3-WT-, NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr. (G–I) EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. (D and G) Representative images by confocal microscopy. (E, F, H, and I) The number of foci and the fluorescence intensity of the cells were analyzed by high-content analysis. Pearson correlation coefficients are shown. (J) EF1-ASC-GFP-HeLa cells were cultured at 37 or 32°C for 24 hr. The number of nuclei and speck was counted. (C, F, I, and J) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of three independent experiments. WT, wild type.

(A) Amino acid sequence of chronic infantile neurological, cutaneous, and articular syndrome (CINCA)-associated D303N mutant and familial cold autoinflammatory syndrome (FCAS)-associated L353P mutant. (B) Lysates of EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N, NLRP3-Y563N, or NLRP3-Y570C-mNeonGreen-HeLa cells were analyzed by western blot. (C) EF1-NLRP3-WT-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were analyzed by confocal microscopy. (D–G) EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. The number and area of the foci, and the fluorescence intensity of the cells were analyzed by high-content analysis. (D) The histogram of foci number in foci-positive cells. (E) The scatter plot of relative fluorescence intensity and foci number in each group. (F) Relative foci area per cell and (G) average foci area were quantified. (H) EF1-ASC-GFP-HeLa cells were cultured at 37 or 32°C for 24 hr. Representative image of confocal microscopy. (F and G) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments. WT, wild type.

Cryopyrin-associated periodic syndrome-associated NLRP3 mutants form cryo-sensitive foci.

(A) EF1-NLRP3-WT-, NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-HeLa cells or EF1-ASC-GFP-HeLa cells were analyzed by confocal microscopy. Line profiles of foci or specks in the images were analyzed. (B and C) ASC KO/EF1-NLRP3-WT- or NLRP3-D303N-mNeonGreen-THP-1 cells were differentiated with 200 nM phorbol-12-myristate-13-acetate for 24 hr and then treated with nigericin for 6 hr. (B) Representative images by confocal microscopy. (C) The number of foci was counted by high-content analysis. (D–F) Differentiated ASC KO/EF1-NLRP3-WT-, NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr. (G–I) EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. (D and G) Representative images by confocal microscopy. (E, F, H, and I) The number of foci and the fluorescence intensity of the cells were analyzed by high-content analysis. Pearson correlation coefficients are shown. (J) EF1-ASC-GFP-HeLa cells were cultured at 37 or 32°C for 24 hr. The number of nuclei and speck was counted. (C, F, I, and J) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of three independent experiments. WT, wild type.

Expression of NLRP3-mNeonGreen and apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-GFP.

(A) Amino acid sequence of chronic infantile neurological, cutaneous, and articular syndrome (CINCA)-associated D303N mutant and familial cold autoinflammatory syndrome (FCAS)-associated L353P mutant. (B) Lysates of EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N, NLRP3-Y563N, or NLRP3-Y570C-mNeonGreen-HeLa cells were analyzed by western blot. (C) EF1-NLRP3-WT-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were analyzed by confocal microscopy. (D–G) EF1-NLRP3-WT-, NLRP3-L353P-, NLRP3-D303N-, NLRP3-Y563N-, or NLRP3-Y570C-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. The number and area of the foci, and the fluorescence intensity of the cells were analyzed by high-content analysis. (D) The histogram of foci number in foci-positive cells. (E) The scatter plot of relative fluorescence intensity and foci number in each group. (F) Relative foci area per cell and (G) average foci area were quantified. (H) EF1-ASC-GFP-HeLa cells were cultured at 37 or 32°C for 24 hr. Representative image of confocal microscopy. (F and G) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments. WT, wild type.

CAPS-associated NLRP3 mutants form aggregates

Since NLRP3 has a pyrin domain (PYD) scaffold domain (Figure 2—figure supplement 1A), a common feature of molecules that forms aggregates or liquid-liquid phase separation (LLPS), we hypothesized that CAPS-associated NLRP3 mutants form aggregates or LLPS (Alberti et al., 2019). To test this hypothesis, we performed fluorescence recovery after photobleaching (FRAP) analysis. After induction of foci formation by cold exposure, some of the NLRP3-L353P- and D303N-mNeonGreen-foci were bleached. The fluorescence in the bleached area was not recovered, indicating that the foci are aggregates (Figure 2A and B, Figure 2—figure supplement 2A and B). The wholly bleached area of NLRP3-L353P-mNeonGreen-foci was also not recovered (Figure 2—figure supplement 2C and D). Similar results are obtained from FRAP analysis of ASC speck, initially reported to be aggregates (Masumoto et al., 1999; Figure 2C and D). In contrast, diffusely expressed mNeonGreen was recovered after photobleaching (Figure 2—figure supplement 2E and F). In both NLRP3-L353P foci and ASC speck, the exchange of protein between bleached and unbleached area was not detected (Figure 2E and F). Furthermore, 1,6-hexanediol, an LLPS inhibitor, did not affect foci formation of NLRP3-mNeonGreen (Figure 2—figure supplement 2G). These results suggest that foci formed by CAPS-associated NLRP3 mutants are aggregates.
Figure 2—figure supplement 1.

Domains composing NLRP3.

(A) IUPred score of NLRP3 and domains in human NLRP3. PYD, pyrin domain; FISNA, fish-specific NACHT associated domain; NACHT, NACHT domain; WH, winged helix domain; HD, helical domain; LRR, leucine rich repeat.

Figure 2.

Cryopyrin-associated periodic syndrome-associated NLRP3 mutants form aggregates.

(A–F) EF1-NLRP3-L353P-mNeonGreen- or EF1-ASC-GFP-HeLa cells were cultured at 32°C for 24 hr. Foci or specks in the cells were analyzed by fluorescence recovery after photobleaching. Representative images of (A) foci formed by NLRP3-L353P-mNeonGreen or (C) specks formed by apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-GFP before and after photobleaching. The bleached and unbleached areas are shown in black lines and yellow lines, respectively. Plots of relative fluorescence units during photobleaching of (B and E) NLRP3-L353Pm-NeonGreen (n=12) and (D and F) ASC specks (n=12). (B and D) The red line represents mean values, and the gray lines represent each measurement. (E and F) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are from three independent live-cell imaging.

(A) IUPred score of NLRP3 and domains in human NLRP3. PYD, pyrin domain; FISNA, fish-specific NACHT associated domain; NACHT, NACHT domain; WH, winged helix domain; HD, helical domain; LRR, leucine rich repeat.

(A–D) EF1-NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-HeLa cells were cultured at 32°C for 24 hr. Foci in the cells were analyzed by fluorescence recovery after photobleaching (FRAP). Representative images of foci formed (A) by NLRP3-D303N-mNeonGreen or (C) by NLRP3-L353P-mNeonGreen before and after photobleaching. The bleached area and unbleached area are shown in black lines and yellow lines, respectively. Plot of relative fluorescence unit during photobleaching of (B) NLRP3-D303N-mNeonGreen (n=7) and (D) NLRP3-L353P-mNeonGreen (n=10). The red line represents the mean value, and the gray lines represent each measurement. Data are from two or three independent live-cell imaging. (E and F) mNeonGreen-HeLa cells were analyzed by FRAP. (E) Representative images of mNeonGreen before and after photobleaching. The targeted area is shown by black circle. (F) Plot of relative fluorescence unit during photobleaching of mNeonGreen (n=10). The red line represents the mean value, and the gray lines represent each measurement. (G) EF1-NLRP3-L353P- or NLRP3-D303N-mNeonGreen-HeLa cells were treated with 5% 1,6-hexanediol for 30 min. Representative images of live-cell imaging.

Figure 2—figure supplement 2.

Cryopyrin-associated periodic syndrome-associated NLRP3 mutants form aggregates.

(A–D) EF1-NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-HeLa cells were cultured at 32°C for 24 hr. Foci in the cells were analyzed by fluorescence recovery after photobleaching (FRAP). Representative images of foci formed (A) by NLRP3-D303N-mNeonGreen or (C) by NLRP3-L353P-mNeonGreen before and after photobleaching. The bleached area and unbleached area are shown in black lines and yellow lines, respectively. Plot of relative fluorescence unit during photobleaching of (B) NLRP3-D303N-mNeonGreen (n=7) and (D) NLRP3-L353P-mNeonGreen (n=10). The red line represents the mean value, and the gray lines represent each measurement. Data are from two or three independent live-cell imaging. (E and F) mNeonGreen-HeLa cells were analyzed by FRAP. (E) Representative images of mNeonGreen before and after photobleaching. The targeted area is shown by black circle. (F) Plot of relative fluorescence unit during photobleaching of mNeonGreen (n=10). The red line represents the mean value, and the gray lines represent each measurement. (G) EF1-NLRP3-L353P- or NLRP3-D303N-mNeonGreen-HeLa cells were treated with 5% 1,6-hexanediol for 30 min. Representative images of live-cell imaging.

Cryopyrin-associated periodic syndrome-associated NLRP3 mutants form aggregates.

(A–F) EF1-NLRP3-L353P-mNeonGreen- or EF1-ASC-GFP-HeLa cells were cultured at 32°C for 24 hr. Foci or specks in the cells were analyzed by fluorescence recovery after photobleaching. Representative images of (A) foci formed by NLRP3-L353P-mNeonGreen or (C) specks formed by apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-GFP before and after photobleaching. The bleached and unbleached areas are shown in black lines and yellow lines, respectively. Plots of relative fluorescence units during photobleaching of (B and E) NLRP3-L353Pm-NeonGreen (n=12) and (D and F) ASC specks (n=12). (B and D) The red line represents mean values, and the gray lines represent each measurement. (E and F) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are from three independent live-cell imaging.

Domains composing NLRP3.

(A) IUPred score of NLRP3 and domains in human NLRP3. PYD, pyrin domain; FISNA, fish-specific NACHT associated domain; NACHT, NACHT domain; WH, winged helix domain; HD, helical domain; LRR, leucine rich repeat. (A–D) EF1-NLRP3-L353P-, or NLRP3-D303N-mNeonGreen-HeLa cells were cultured at 32°C for 24 hr. Foci in the cells were analyzed by fluorescence recovery after photobleaching (FRAP). Representative images of foci formed (A) by NLRP3-D303N-mNeonGreen or (C) by NLRP3-L353P-mNeonGreen before and after photobleaching. The bleached area and unbleached area are shown in black lines and yellow lines, respectively. Plot of relative fluorescence unit during photobleaching of (B) NLRP3-D303N-mNeonGreen (n=7) and (D) NLRP3-L353P-mNeonGreen (n=10). The red line represents the mean value, and the gray lines represent each measurement. Data are from two or three independent live-cell imaging. (E and F) mNeonGreen-HeLa cells were analyzed by FRAP. (E) Representative images of mNeonGreen before and after photobleaching. The targeted area is shown by black circle. (F) Plot of relative fluorescence unit during photobleaching of mNeonGreen (n=10). The red line represents the mean value, and the gray lines represent each measurement. (G) EF1-NLRP3-L353P- or NLRP3-D303N-mNeonGreen-HeLa cells were treated with 5% 1,6-hexanediol for 30 min. Representative images of live-cell imaging.

Aggregates formed by CAPS-associated NLRP3 mutants are the scaffold for inflammasome activation

Next, we investigated whether aggregates formed by mutated NLRP3 function as a scaffold for inflammasome assembly and trigger subsequent IL-1β release. In order to analyze colocalization of NLRP3 and ASC, we developed THP-1 cells harboring two reporters; TRE-NLRP3-mNeonGreen and EF1-ASC-BFP. After induction of NLRP3-L353P-mNeonGreen by doxycycline (DOX), ASC speck was colocalized with the NLRP3 mutant-formed aggregate (Figure 3A–C). To exclude the possibility that NLRP3 mutant aggregation is due to its fluorescent tag, the cells expressing NLRP3 mutants under TET-ON promoter were developed (Figure 3—figure supplement 1A and B). In accordance with the cryo-sensitive formation of aggregates by NLRP3-L353P, insoluble complex formation and oligomerization of ASC induced by NLRP3-L353P were enhanced by cold exposure (Figure 3D and E). Further, NLRP3 mutants formed insoluble complexes in ASC KO THP-1 cells (Figure 3—figure supplement 1C). In contrast, the ASC oligomerization induced by nigericin was attenuated under cold exposure (Figure 3F). ASC-speck formation was further assessed by fusion protein of ASC-GFP reporter. Similarly, NLRP3-L353P-induced ASC-speck formation was increased under cold exposure (Figure 3G). Moreover, cold exposure enhanced IL-1β release induced by the NLRP3-L353P, whereas nigericin- and nanosilica-induced IL-1β release was restrained under cold exposure (Figure 3H and Figure 3—figure supplement 1D). Cold exposure also enhanced IL-1β release in CINCA-associated NLRP3-D303N-expressing cells (Figure 3—figure supplement 1E). In contrast, WT-NLRP3 failed to induce IL-1β release (Figure 3—figure supplement 1F and G). These results demonstrate that cryo-sensitive aggregates formed by CAPS-associated NLRP3 mutants function as a scaffold for inflammasome activation and induce subsequent IL-1β release.
Figure 3.

Aggregates formed by cryopyrin-associated periodic syndrome-associated NLRP3 mutant are the scaffold for inflammasome activation.

(A–C) EF1-ASC-BFP/TRE-NLRP3-WT or L353P-mNeonGreen-THP-1 cells were treated with doxycycline (DOX). (A) Localization of apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and NLRP3 was analyzed by confocal microscopy. (B) The number of foci was counted. (C) The ASC-speck number in NLRP3 foci was analyzed. (D and E) TRE-NLRP3-L353P-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate (PMA) for 24 hr and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. (D) Triton X-soluble and triton X-insoluble fractions were analyzed by western blot. (E) Oligomerized ASC in Triton X-insoluble fractions was crosslinked with bis(sulfosuccinimidyl)suberate (BS3) and analyzed by western blot. (F) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with nigericin at 37 or 32°C for 6 hr. Triton X-insoluble fractions were crosslinked with BS3 and analyzed by western blot. (G) EF-1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were differentiated with PMA for 24 hr and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Representative images by confocal microscopy and the number of nuclei and specks were counted. (H) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with DOX at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (B, C and H) Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by (B, C, and H) two-way ANOVA with a post hoc test or (G) Fisher’s exact test with the Holm correction. Data are representative of two or three independent experiments.

(A) TRE-NLRP3-L353P- or (B and E) NLRP3-D303N- or (C) ASC KO/TRE-NLRP3-L353P- or (F and G) NLRP3WT-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate for 24 hr and then treated with doxycycline (DOX) at 37 or 32°C for 6 hr. (D) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with 5 µM nigericin or nanosilica (30 µg/mL) at 37 or 32°C for 6 hr. (A, B, C, and F) Lysates and supernatants were analyzed by western blot. (D, E, and G) The levels of IL-1β in the supernatants were assessed by ELISA (n=3). Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Figure 3—figure supplement 1.

Cold exposure enhances IL-1β release in NLRP3 familial cold autoinflammatory syndrome mutant-expressing cells.

(A) TRE-NLRP3-L353P- or (B and E) NLRP3-D303N- or (C) ASC KO/TRE-NLRP3-L353P- or (F and G) NLRP3WT-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate for 24 hr and then treated with doxycycline (DOX) at 37 or 32°C for 6 hr. (D) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with 5 µM nigericin or nanosilica (30 µg/mL) at 37 or 32°C for 6 hr. (A, B, C, and F) Lysates and supernatants were analyzed by western blot. (D, E, and G) The levels of IL-1β in the supernatants were assessed by ELISA (n=3). Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Aggregates formed by cryopyrin-associated periodic syndrome-associated NLRP3 mutant are the scaffold for inflammasome activation.

(A–C) EF1-ASC-BFP/TRE-NLRP3-WT or L353P-mNeonGreen-THP-1 cells were treated with doxycycline (DOX). (A) Localization of apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and NLRP3 was analyzed by confocal microscopy. (B) The number of foci was counted. (C) The ASC-speck number in NLRP3 foci was analyzed. (D and E) TRE-NLRP3-L353P-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate (PMA) for 24 hr and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. (D) Triton X-soluble and triton X-insoluble fractions were analyzed by western blot. (E) Oligomerized ASC in Triton X-insoluble fractions was crosslinked with bis(sulfosuccinimidyl)suberate (BS3) and analyzed by western blot. (F) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with nigericin at 37 or 32°C for 6 hr. Triton X-insoluble fractions were crosslinked with BS3 and analyzed by western blot. (G) EF-1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were differentiated with PMA for 24 hr and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Representative images by confocal microscopy and the number of nuclei and specks were counted. (H) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with DOX at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (B, C and H) Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by (B, C, and H) two-way ANOVA with a post hoc test or (G) Fisher’s exact test with the Holm correction. Data are representative of two or three independent experiments.

Cold exposure enhances IL-1β release in NLRP3 familial cold autoinflammatory syndrome mutant-expressing cells.

(A) TRE-NLRP3-L353P- or (B and E) NLRP3-D303N- or (C) ASC KO/TRE-NLRP3-L353P- or (F and G) NLRP3WT-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate for 24 hr and then treated with doxycycline (DOX) at 37 or 32°C for 6 hr. (D) Differentiated TRE-NLRP3-L353P-THP-1 cells were treated with 5 µM nigericin or nanosilica (30 µg/mL) at 37 or 32°C for 6 hr. (A, B, C, and F) Lysates and supernatants were analyzed by western blot. (D, E, and G) The levels of IL-1β in the supernatants were assessed by ELISA (n=3). Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Canonical inflammasome pathway is dispensable for NLRP3 mutant-mediated inflammasome assembly

To elucidate the regulatory mechanisms of NLRP3 mutant-mediated inflammasome activation under cold exposure, we assessed the involvement of K+ efflux. Unexpectedly, inhibition of K+ efflux failed to prevent NLRP3-L353P-induced IL-1β release, while it inhibited nigericin-induced IL-1β release (Figure 4—figure supplement 1A). Since NEK7 functions as an essential component of K+ efflux-mediated NLRP3 inflammasome, we developed NEK7-deficient cells (Figure 4—figure supplement 1B-D). However, deficiency of NEK7 failed to inhibit NLRP3 mutant-mediated IL-1β release, although it inhibited nigericin-induced IL-1β release (Figure 4A and B, Figure 4—figure supplement 1E). Recent studies have suggested that NLRP3 is localized on the membrane of trans-Golgi network (TGN) via its polybasic linker, and TGN dispersion plays a critical role in canonical inflammasome assembly (Andreeva et al., 2021; Chen and Chen, 2018). To investigate the involvement of TGN in NLRP3 mutant-mediated inflammasome activation, we developed the mutants lacking three lysine residues (K129, K131, and K132) in the polybasic linker of NLRP3 by introducing alanine (Figure 4—figure supplement 1F). However, both linker mutants of L353P and D303N formed aggregates (Figure 4C). Although the foci formation by NLRP3-D303N was slightly decreased by the polybasic linker mutation, cold exposure enhanced the formation of foci even in the polybasic linker mutants (Figure 4D and E). These results suggest that K+ efflux-mediated canonical inflammasome pathway is dispensable for NLRP3 mutant-mediated inflammasome assembly.
Figure 4—figure supplement 1.

K+ efflux is dispensable for inflammasome activation induced by cryopyrin-associated periodic syndrome-associated NLRP3 mutant.

(A) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with the indicated dose of KCl or NaCl and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. (B–D) NEK7-mutated (B and C) TRE-NLRP3-L353P-THP-1 cells or (D) TRE-NLRP3-D303N-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate for 24 hr. (B and D) mRNA expression of NEK7 was analyzed by real-time PCR (n=3). (C) Lysates were analyzed by western blot. (E) Differentiated NEK7-mutated TRE-NLRP3-D303N-THP-1 cells were treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (F) Lysates of EF1-NLRP3-L353P-, NLRP3-L353P-linker mutant-, NLRP3-D303N, or NLRP3-D303N-linker mutant-mNeonGreen-HeLa cells were analyzed by western blot. (A, B, D, and E) Data are expressed as the mean ± SD. *p<0.05, **<0.01, and ***p<0.005 as determined by (B and D) one-way or (A and E) two-way ANOVA with a post hoc test. Data are representative of two independent experiments.

Figure 4.

NEK7 and polybasic linker in NLRP3 are dispensable for cryopyrin-associated periodic syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A and B) Differentiated NEK7-mutated TRE-NLRP3-L353P-THP-1 cells were treated with (A) doxycycline (DOX) (30 ng/mL) or (B) nigericin at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (C) EF1-NLRP3-L353P-, NLRP3-L353P3KA-, EF1-NLRP3-D303N-, or NLRP3-D303N3KA-mNeonGreen-HeLa cells were analyzed by confocal microscopy. (D and E) EF1-NLRP3-L353P-, NLRP3-L353P-linker mutant-, EF1-NLRP3-D303N-, or NLRP3-D303N-linker mutant-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. The number of foci and the fluorescence intensity of the cells were analyzed by high-content analysis. Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of three independent experiments.

(A) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with the indicated dose of KCl or NaCl and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. (B–D) NEK7-mutated (B and C) TRE-NLRP3-L353P-THP-1 cells or (D) TRE-NLRP3-D303N-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate for 24 hr. (B and D) mRNA expression of NEK7 was analyzed by real-time PCR (n=3). (C) Lysates were analyzed by western blot. (E) Differentiated NEK7-mutated TRE-NLRP3-D303N-THP-1 cells were treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (F) Lysates of EF1-NLRP3-L353P-, NLRP3-L353P-linker mutant-, NLRP3-D303N, or NLRP3-D303N-linker mutant-mNeonGreen-HeLa cells were analyzed by western blot. (A, B, D, and E) Data are expressed as the mean ± SD. *p<0.05, **<0.01, and ***p<0.005 as determined by (B and D) one-way or (A and E) two-way ANOVA with a post hoc test. Data are representative of two independent experiments.

NEK7 and polybasic linker in NLRP3 are dispensable for cryopyrin-associated periodic syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A and B) Differentiated NEK7-mutated TRE-NLRP3-L353P-THP-1 cells were treated with (A) doxycycline (DOX) (30 ng/mL) or (B) nigericin at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (C) EF1-NLRP3-L353P-, NLRP3-L353P3KA-, EF1-NLRP3-D303N-, or NLRP3-D303N3KA-mNeonGreen-HeLa cells were analyzed by confocal microscopy. (D and E) EF1-NLRP3-L353P-, NLRP3-L353P-linker mutant-, EF1-NLRP3-D303N-, or NLRP3-D303N-linker mutant-mNeonGreen-HeLa cells were cultured at 37 or 32°C for 24 hr. The number of foci and the fluorescence intensity of the cells were analyzed by high-content analysis. Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of three independent experiments.

K+ efflux is dispensable for inflammasome activation induced by cryopyrin-associated periodic syndrome-associated NLRP3 mutant.

(A) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with the indicated dose of KCl or NaCl and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. (B–D) NEK7-mutated (B and C) TRE-NLRP3-L353P-THP-1 cells or (D) TRE-NLRP3-D303N-THP-1 cells were differentiated with phorbol-12-myristate-13-acetate for 24 hr. (B and D) mRNA expression of NEK7 was analyzed by real-time PCR (n=3). (C) Lysates were analyzed by western blot. (E) Differentiated NEK7-mutated TRE-NLRP3-D303N-THP-1 cells were treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (F) Lysates of EF1-NLRP3-L353P-, NLRP3-L353P-linker mutant-, NLRP3-D303N, or NLRP3-D303N-linker mutant-mNeonGreen-HeLa cells were analyzed by western blot. (A, B, D, and E) Data are expressed as the mean ± SD. *p<0.05, **<0.01, and ***p<0.005 as determined by (B and D) one-way or (A and E) two-way ANOVA with a post hoc test. Data are representative of two independent experiments.

Ca2+ is required for NLRP3 mutant-mediated inflammasome assembly

To further explore upstream pathways of NLRP3 mutant-mediated inflammasome assembly, the involvement of lysosomal destabilization, mitochondrial reactive oxygen species (ROS) generation, and Ca2+ mobilization was investigated. Among these, EGTA, a chelator of Ca2+, inhibited NLRP3-L353P-induced IL-1β release, while inhibition of lysosomal or mitochondrial ROS pathway did not suppress it (Figure 5A, Figure 5—figure supplement 1A-C). Moreover, decreased IL-1β release by NLRP3-L353P under Ca2+-depleted conditions was restored by Ca2+ supplementation at 32°C (Figure 5B). Next, we assessed whether deprivation or supplementation of Ca2+ alters ASC oligomerization. Ca2+ deprivation by EGTA attenuated NLRP3-L353P-induced ASC oligomerization, whereas reduced ASC oligomerization in Ca2+-depleted conditions was restored by Ca2+ supplementation (Figure 5C and Figure 5—figure supplement 1D). The requirement of Ca2+ for inflammasome assembly was also confirmed by the use of ASC-GFP reporter cells (Figure 5D and Figure 5—figure supplement 1E). The effect of Ca2+ on NLRP3 aggregation was analyzed using NLRP3-mNeonGreen reporter cells. Cryo-sensitive aggregation of NLRP3-L353P was decreased by Ca2+ depletion (Figure 5E and F), even though cryo-sensitive aggregation of NLRP3-L353P was detected in Ca2+-depleted conditions (Figure 5—figure supplement 2A). Moreover, DOX-induced NLRP3-L353P aggregation and ASC-speck formation were attenuated by Ca2+ depletion (Figure 5G and H). Although a similar dependency on Ca2+ was also detected in the CINCA-associated NLRP3-D303N (Figure 5—figure supplement 1F and Figure 5—figure supplement 2B and C), the impact of Ca2+ depletion was less effective in IL-1β release by NLRP3-D303N. These results suggest that Ca2+ regulates the aggregation of CAPS-associated NLRP3 mutants and subsequent activation of NLRP3 inflammasome.
Figure 5.

Ca2+ is required for cryopyrin-associated periodic syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A–C) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with indicated conditions, and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. (A and B) The IL-1β levels in the supernatants were assessed by ELISA (n=3). (C) Oligomerized apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) in Triton X-insoluble fractions was crosslinked with bis(sulfosuccinimidyl)suberate and analyzed by western blot. (D) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37°C. ASC-speck formation was analyzed by confocal microscopy. (E and F) ASC KO / EF1-NLRP3-WT- or L353P- mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted or -supplemented media. The number of foci and fluorescent intensity was analyzed by high-content analysis. (G and H) Differentiated EF1-ASC-BFP/TRE-NLRP3-L353P-mNeonGreen THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37°C. (G) Representative images by confocal microscopy. (H) The number of foci was analyzed by high-content analysis. (A, B, F, and G) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by (A, B, E, and H) two-way ANOVA with a post hoc test or (D) Fisher’s exact test with the Holm correction. Data are representative of two or three independent experiments.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with the indicated inhibitors and then treated with doxycycline (DOX) (30 ng/mL) or nigericin (5 µM) at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (C) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Lysates and supernatants were analyzed by western blot. (D) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Oligomerized apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) in Triton X-insoluble fractions was crosslinked by bis(sulfosuccinimidyl)suberate and analyzed by western blot. (E) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37°C. The formation of ASC speck was analyzed by high-content analysis. (F) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (A, B, E, and F) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

(A) ASC KO/EF1-NLRP3-L353P-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted media. The number of foci and fluorescent intensity was analyzed by high-content analysis. (B and C) ASC KO/EF1-NLRP3-D303N-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted or -supplemented media. The number of foci and fluorescent intensity was analyzed by high-content analysis. Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by Welch’s t test or two-way ANOVA with a post hoc test. Data are representative of three independent experiments.

Figure 5—figure supplement 1.

Ca2+ is necessary for inflammasome activation induced by cryopyrin-associated periodic syndrome-associated NLRP3 mutant.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with the indicated inhibitors and then treated with doxycycline (DOX) (30 ng/mL) or nigericin (5 µM) at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (C) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Lysates and supernatants were analyzed by western blot. (D) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Oligomerized apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) in Triton X-insoluble fractions was crosslinked by bis(sulfosuccinimidyl)suberate and analyzed by western blot. (E) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37°C. The formation of ASC speck was analyzed by high-content analysis. (F) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (A, B, E, and F) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Figure 5—figure supplement 2.

Ca2+ is necessary for aggregation of cryopyrin-associated periodic syndrome-associated NLRP3 mutant.

(A) ASC KO/EF1-NLRP3-L353P-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted media. The number of foci and fluorescent intensity was analyzed by high-content analysis. (B and C) ASC KO/EF1-NLRP3-D303N-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted or -supplemented media. The number of foci and fluorescent intensity was analyzed by high-content analysis. Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by Welch’s t test or two-way ANOVA with a post hoc test. Data are representative of three independent experiments.

Ca2+ is required for cryopyrin-associated periodic syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A–C) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with indicated conditions, and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. (A and B) The IL-1β levels in the supernatants were assessed by ELISA (n=3). (C) Oligomerized apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) in Triton X-insoluble fractions was crosslinked with bis(sulfosuccinimidyl)suberate and analyzed by western blot. (D) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37°C. ASC-speck formation was analyzed by confocal microscopy. (E and F) ASC KO / EF1-NLRP3-WT- or L353P- mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted or -supplemented media. The number of foci and fluorescent intensity was analyzed by high-content analysis. (G and H) Differentiated EF1-ASC-BFP/TRE-NLRP3-L353P-mNeonGreen THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37°C. (G) Representative images by confocal microscopy. (H) The number of foci was analyzed by high-content analysis. (A, B, F, and G) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by (A, B, E, and H) two-way ANOVA with a post hoc test or (D) Fisher’s exact test with the Holm correction. Data are representative of two or three independent experiments.

Ca2+ is necessary for inflammasome activation induced by cryopyrin-associated periodic syndrome-associated NLRP3 mutant.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with the indicated inhibitors and then treated with doxycycline (DOX) (30 ng/mL) or nigericin (5 µM) at 37 or 32°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (C) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Lysates and supernatants were analyzed by western blot. (D) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with Ca2+-depleted or -supplemented media and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. Oligomerized apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) in Triton X-insoluble fractions was crosslinked by bis(sulfosuccinimidyl)suberate and analyzed by western blot. (E) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37°C. The formation of ASC speck was analyzed by high-content analysis. (F) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with EGTA and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (A, B, E, and F) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Ca2+ is necessary for aggregation of cryopyrin-associated periodic syndrome-associated NLRP3 mutant.

(A) ASC KO/EF1-NLRP3-L353P-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted media. The number of foci and fluorescent intensity was analyzed by high-content analysis. (B and C) ASC KO/EF1-NLRP3-D303N-mNeonGreen-THP-1 cells were cultured at 37 or 32°C for 24 hr in Ca2+-depleted or -supplemented media. The number of foci and fluorescent intensity was analyzed by high-content analysis. Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by Welch’s t test or two-way ANOVA with a post hoc test. Data are representative of three independent experiments.

Ca2+ influx is provoked during mutated NLRP3-mediated inflammasome assembly

To further investigate the role of Ca2+ in mutated NLRP3-mediated inflammasome activation, we monitored changes in Ca2+ levels using Fluo-8, a fluorescent Ca2+ indicator. After DOX-mediated induction of NLRP3-L353P or NLRP3-D303N, Ca2+ increase was clearly detected (Figure 6A–C and Figure 6—figure supplement 1A and B). This increased intracellular Ca2+ is due to influx because Ca2+ increase was not observed in the absence of extracellular Ca2+ (Figure 6D–F, Video 1). The increased Ca2+ levels were not provoked by membrane rupture because Ca2+ influx occurred prior to the release of cytosolic content as indicated by Kusabira orange or membrane permeabilization as indicated by SYTOX (Figure 6—figure supplement 2A-D). Notably, NLRP3-L353P-mediated inflammasome assembly monitored by ASC-BFP and Ca2+ increase occurred coincidentally (Figure 6G–I). The size of ASC speck increased with the increase in Ca2+. These results indicate that Ca2+ influx occurs during inflammasome activation induced by NLRP3 mutants.
Figure 6.

Ca2+ influx is provoked during mutated NLRP3-mediated inflammasome assembly.

(A–C) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. (D–F) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr in Ca2+-depleted or -supplemented media. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (D) Representative temporal subtraction images. (E) The frequency of intracellular Ca2+ increase at each time point. (F) The cumulative number of Fluo-8-positive cells. (G–I) Differentiated EF1-ASC-BFP/TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C. The images were recorded at 5 min intervals. (G) Representative images of the cells with increased Fluo-8 signals. (H) The apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-BFP speck size (I) and fluorescent intensity of Fluo-8 were analyzed. The peak time point of Fluo-8 signals was defined as 0 min. (H) The blue line and the (I) green line represent mean values, and the gray line represents each measurement. *p<0.05, **p<0.01, and ***p<0.005 as determined by (C and F) Fisher’s exact test with the Holm correction or (H and I) repeated one-way ANOVA with a post hoc test. (A–G) Data are representative of three independent experiments. (H and I) Data are from three independent live-cell imaging.

(A–C) Differentiated TRE-NLRP3-D303N-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. ***p<0.005 as determined by Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. (A) Representative images of cells with increased Fluo-8 signal. (B) The relative fluorescent intensity of Fluo-8 and Kusabira Orange in cells with increased Fluo-8 signal was quantified (n=10). (C and D) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr in the presence of SYTOX Deep Red. (C) Representative images of cells with increased Fluo-8 signal. (D) The relative fluorescent intensity of Fluo-8 and SYTOX Deep Red in cells with increased Fluo-8 signal was quantified (n=5). Data are expressed as the mean ± SD. *p<0.05 as determined by repeated one-way ANOVA with a post hoc test. Data are analyzed from two independent time-lapse imaging.

Figure 6—figure supplement 1.

Ca2+ influx is induced by chronic infantile neurological, cutaneous, and articular syndrome-associated NLRP3 mutant.

(A–C) Differentiated TRE-NLRP3-D303N-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. ***p<0.005 as determined by Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

Video 1.

Ca2+ influx is induced by familial cold autoinflammatory syndrome-associated NLRP3 mutant.

Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 μM Fluo-8 for 1 hr and treated with doxycycline (30 ng/mL) at 37°C for 6 hr in Ca2+-depleted or -supplemented media. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr.

Figure 6—figure supplement 2.

Pyroptosis is induced by mutated NLRP3 after Ca2+ influx.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. (A) Representative images of cells with increased Fluo-8 signal. (B) The relative fluorescent intensity of Fluo-8 and Kusabira Orange in cells with increased Fluo-8 signal was quantified (n=10). (C and D) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr in the presence of SYTOX Deep Red. (C) Representative images of cells with increased Fluo-8 signal. (D) The relative fluorescent intensity of Fluo-8 and SYTOX Deep Red in cells with increased Fluo-8 signal was quantified (n=5). Data are expressed as the mean ± SD. *p<0.05 as determined by repeated one-way ANOVA with a post hoc test. Data are analyzed from two independent time-lapse imaging.

Ca2+ influx is provoked during mutated NLRP3-mediated inflammasome assembly.

(A–C) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. (D–F) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr in Ca2+-depleted or -supplemented media. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (D) Representative temporal subtraction images. (E) The frequency of intracellular Ca2+ increase at each time point. (F) The cumulative number of Fluo-8-positive cells. (G–I) Differentiated EF1-ASC-BFP/TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C. The images were recorded at 5 min intervals. (G) Representative images of the cells with increased Fluo-8 signals. (H) The apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-BFP speck size (I) and fluorescent intensity of Fluo-8 were analyzed. The peak time point of Fluo-8 signals was defined as 0 min. (H) The blue line and the (I) green line represent mean values, and the gray line represents each measurement. *p<0.05, **p<0.01, and ***p<0.005 as determined by (C and F) Fisher’s exact test with the Holm correction or (H and I) repeated one-way ANOVA with a post hoc test. (A–G) Data are representative of three independent experiments. (H and I) Data are from three independent live-cell imaging.

Ca2+ influx is induced by chronic infantile neurological, cutaneous, and articular syndrome-associated NLRP3 mutant.

(A–C) Differentiated TRE-NLRP3-D303N-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. ***p<0.005 as determined by Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

Pyroptosis is induced by mutated NLRP3 after Ca2+ influx.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. (A) Representative images of cells with increased Fluo-8 signal. (B) The relative fluorescent intensity of Fluo-8 and Kusabira Orange in cells with increased Fluo-8 signal was quantified (n=10). (C and D) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr in the presence of SYTOX Deep Red. (C) Representative images of cells with increased Fluo-8 signal. (D) The relative fluorescent intensity of Fluo-8 and SYTOX Deep Red in cells with increased Fluo-8 signal was quantified (n=5). Data are expressed as the mean ± SD. *p<0.05 as determined by repeated one-way ANOVA with a post hoc test. Data are analyzed from two independent time-lapse imaging.

Ca2+ influx is induced by familial cold autoinflammatory syndrome-associated NLRP3 mutant.

Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 μM Fluo-8 for 1 hr and treated with doxycycline (30 ng/mL) at 37°C for 6 hr in Ca2+-depleted or -supplemented media. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr.

Caspase-1 inhibition prevents FCAS-associated NLRP3 mutant-mediated inflammasome assembly

Recent studies have suggested that caspase activation causes the influx of Ca2+ (Rühl et al., 2018). Therefore, we postulated that caspase-dependent Ca2+ influx might enhance inflammasome assembly. To investigate the effect of caspase-1 inhibition on Ca2+ influx, cells were treated with VX-765, a caspase-1 inhibitor, prior to DOX-mediated NLRP3-L353P induction. Indeed, VX-765 canceled Ca2+ influx (Figure 7A–C, Video 2, Figure 7—figure supplement 1A and B) and inhibited ASC oligomerization and speck formation induced by NLRP3-L353P (Figure 7D and E). In accordance with reduced inflammasome assembly, VX-765 also prevented mutated NLRP3-induced IL-1β release (Figure 7F and Figure 7—figure supplement 1 C). To further validate the role of caspase-1 in Ca2+ influx, we developed CASP1-deficient cells (Figure 7—figure supplement 1D). Ca2+ influx and ASC-speck formation induced by NLRP3-L353P were attenuated by CASP1 deficiency (Figure 7G–I). These results indicate that caspase-1 activation induced by NLRP3 mutants promotes incremental inflammasome assembly by regulating Ca2+ influx.
Figure 7.

Caspase-1 inhibition prevents familial cold autoinflammatory syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A –C) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and were pretreated with VX-765 (20 µM) for 30 min. After doxycycline (DOX) (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. (D and F) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with VX-765 (20 µM) for 30 min and then treated with DOX (30 ng/mL) or nigericin (5 µM) at 37 or 32°C. (D) Triton X-insoluble fractions were crosslinked with bis(sulfosuccinimidyl)suberate and analyzed by western blot. (F) The IL-1β levels in the supernatants were assessed by ELISA (n=3). (E) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with 20 µM VX-765 for 30 min and then treated with DOX (30 ng/mL) at 37°C. ASC-speck formation was analyzed by confocal microscopy. (G and H) The differentiated CASP1-mutated TRE-NLRP3-L353P-THP-1 cells were treated with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr. (G) The frequency of intracellular Ca2+ increase at each time point. (H) The cumulative number of Fluo-8-positive cells. (I) The differentiated CASP1-mutated EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were treated with DOX (30 ng/mL) at 37°C for 6 hr. ASC-speck formation was analyzed by confocal microscopy. (F) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by (C, E, G, and H) Fisher’s exact test with the Holm correction or (F) two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

(A and B) Differentiated NLRP3-L353P-THP-1 cells were loaded with 3 µM Fura2 for 1 hr. Cells were pretreated 20 µM VX-765 for 30 min and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. Fluorescence (A) at 37 and (B) 32°C was measured at hourly interval (n=6). (C) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with VX-765 for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (D) The differentiated CASP1-mutated TRE-NLRP3-L353P-THP-1 cells were treated with DOX (30 ng/mL) at 37°C for 6 hr. Lysates were analyzed by western blot. (C) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Video 2.

Caspase activity is required for Ca2+ influx induced by familial cold autoinflammatory syndrome-associated NLRP3 mutant.

Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 μM Fluo-8 for 1 hr and were pretreated with VX-765 (20 μM) for 30 min. After doxycycline (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr.

Figure 7—figure supplement 1.

Caspase activity is required for inflammasome assembly induced by familial cold autoinflammatory syndrome-associated NLRP3 mutant.

(A and B) Differentiated NLRP3-L353P-THP-1 cells were loaded with 3 µM Fura2 for 1 hr. Cells were pretreated 20 µM VX-765 for 30 min and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. Fluorescence (A) at 37 and (B) 32°C was measured at hourly interval (n=6). (C) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with VX-765 for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (D) The differentiated CASP1-mutated TRE-NLRP3-L353P-THP-1 cells were treated with DOX (30 ng/mL) at 37°C for 6 hr. Lysates were analyzed by western blot. (C) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Caspase-1 inhibition prevents familial cold autoinflammatory syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A –C) Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 µM Fluo-8 for 1 hr and were pretreated with VX-765 (20 µM) for 30 min. After doxycycline (DOX) (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (A) Representative temporal subtraction images. (B) The frequency of intracellular Ca2+ increase at each time point. (C) The cumulative number of Fluo-8-positive cells. (D and F) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with VX-765 (20 µM) for 30 min and then treated with DOX (30 ng/mL) or nigericin (5 µM) at 37 or 32°C. (D) Triton X-insoluble fractions were crosslinked with bis(sulfosuccinimidyl)suberate and analyzed by western blot. (F) The IL-1β levels in the supernatants were assessed by ELISA (n=3). (E) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with 20 µM VX-765 for 30 min and then treated with DOX (30 ng/mL) at 37°C. ASC-speck formation was analyzed by confocal microscopy. (G and H) The differentiated CASP1-mutated TRE-NLRP3-L353P-THP-1 cells were treated with 4 µM Fluo-8 for 1 hr and treated with DOX (30 ng/mL) at 37°C for 6 hr. (G) The frequency of intracellular Ca2+ increase at each time point. (H) The cumulative number of Fluo-8-positive cells. (I) The differentiated CASP1-mutated EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were treated with DOX (30 ng/mL) at 37°C for 6 hr. ASC-speck formation was analyzed by confocal microscopy. (F) Data are expressed as the mean ± SD. *p<0.05, **p<0.01, and ***p<0.005 as determined by (C, E, G, and H) Fisher’s exact test with the Holm correction or (F) two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Caspase activity is required for inflammasome assembly induced by familial cold autoinflammatory syndrome-associated NLRP3 mutant.

(A and B) Differentiated NLRP3-L353P-THP-1 cells were loaded with 3 µM Fura2 for 1 hr. Cells were pretreated 20 µM VX-765 for 30 min and then treated with doxycycline (DOX) (30 ng/mL) at 37 or 32°C for 6 hr. Fluorescence (A) at 37 and (B) 32°C was measured at hourly interval (n=6). (C) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with VX-765 for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (D) The differentiated CASP1-mutated TRE-NLRP3-L353P-THP-1 cells were treated with DOX (30 ng/mL) at 37°C for 6 hr. Lysates were analyzed by western blot. (C) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test. Data are representative of two or three independent experiments.

Caspase activity is required for Ca2+ influx induced by familial cold autoinflammatory syndrome-associated NLRP3 mutant.

Differentiated TRE-NLRP3-L353P-THP-1 cells were loaded with 4 μM Fluo-8 for 1 hr and were pretreated with VX-765 (20 μM) for 30 min. After doxycycline (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr.

Pannexin 1 inhibition attenuates FCAS-associated NLRP3 mutant-mediated inflammasome assembly

Pannexin 1, a large-pore channel, is activated by caspases and functions as a Ca2+-permeable channel. Therefore, we investigated the contribution of pannexin 1 to mutated NLRP3-mediated inflammasome activation. A pannexin 1 inhibitor, trovafloxacin, attenuated the Ca2+ influx and ASC-speck formation induced by NLRP3-L353P (Figure 8A–F). Moreover, probenecid, which is a clinically used drug for gout and inhibits pannexin 1, attenuated ASC-speck formation. Since probenecid was used in fluo-8 imaging to block fluo-8 leakage, we confirmed that caspase-1-dependent Ca2+ influx was induced in the absence of probenecid (Figure 8—figure supplement 1A-D). Finally, the inhibition of pannexin 1 by trovafloxacin and probenecid-attenuated IL-1β release induced by NLRP3-L353P, whereas it was not effective in preventing nigericin-induced IL-1β release (Figure 8G and H, Figure 8—figure supplement 1E and F). However, the effect of pannexin 1 inhibition is limited to FCAS-associated mutants because it failed to inhibit IL-1β release induced by NLRP3-D303N (Figure 8—figure supplement 1G). On the other hand, MCC950 (Coll et al., 2015), a potent NLRP3 inhibitor, failed to prevent ASC-speck formation and IL-1β release induced by NLRP3-L353P, although MCC950 efficiently inhibited nigericin-induced IL-1β release (Figure 8I and J, Figure 8—figure supplement 1H). These results suggest that inhibition of pannexin 1-mediated Ca2+ influx could be a potential therapeutic target of FCAS.
Figure 8.

Pannexin 1 inhibition prevents familial cold autoinflammatory syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and trovafloxacin (20 µM) for 30 min. After doxycycline (DOX) (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (A) The frequency of intracellular Ca2+ increase at each time point. (B) The cumulative number of Fluo-8-positive cells. (C–F) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with (C and D) trovafloxacin (20 µM) or (E and F) probenecid (1 mM) for 30 min and then treated with DOX (30 ng/mL) at 37°C for 6 hr. Apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-speck formation was analyzed by confocal microscopy. (C and E) Representative images by confocal microscopy. (D and F) The number of nuclei and specks was counted. (G – I) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with (G) trovafloxacin, (H) probenecid, or (I) MCC950 for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (J) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with MCC950 and then treated with DOX (30 ng/mL) at 37°C. The formation of ASC speck was analyzed by high-content analysis. (G–J) Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by (G–J) two-way ANOVA with a post hoc test or (B, D, and F) Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and then treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) The frequency of intracellular Ca2+ increase at each time point. (B) The cumulative number of Fluo-8-positive cells. (C and D) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and VX-765 (20 µM) for 30 min. After DOX (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (C) The frequency of intracellular Ca2+ increase at each time point. (D) The cumulative number of Fluo-8-positive cells. (E, F, H) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with (E) trovafloxacin, (F) probenecid, or (H) MCC950 for 30 min and then treated with nigericin (5 µM) at 37°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (G) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with probenecid for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (E–H) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test or (B, D) Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

Figure 8—figure supplement 1.

Pannexin 1 inhibition prevents familial cold autoinflammatory syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and then treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) The frequency of intracellular Ca2+ increase at each time point. (B) The cumulative number of Fluo-8-positive cells. (C and D) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and VX-765 (20 µM) for 30 min. After DOX (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (C) The frequency of intracellular Ca2+ increase at each time point. (D) The cumulative number of Fluo-8-positive cells. (E, F, H) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with (E) trovafloxacin, (F) probenecid, or (H) MCC950 for 30 min and then treated with nigericin (5 µM) at 37°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (G) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with probenecid for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (E–H) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test or (B, D) Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

Pannexin 1 inhibition prevents familial cold autoinflammatory syndrome-associated NLRP3 mutant-mediated inflammasome assembly.

(A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and trovafloxacin (20 µM) for 30 min. After doxycycline (DOX) (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (A) The frequency of intracellular Ca2+ increase at each time point. (B) The cumulative number of Fluo-8-positive cells. (C–F) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with (C and D) trovafloxacin (20 µM) or (E and F) probenecid (1 mM) for 30 min and then treated with DOX (30 ng/mL) at 37°C for 6 hr. Apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC)-speck formation was analyzed by confocal microscopy. (C and E) Representative images by confocal microscopy. (D and F) The number of nuclei and specks was counted. (G – I) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with (G) trovafloxacin, (H) probenecid, or (I) MCC950 for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (J) EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1 cells were pretreated with MCC950 and then treated with DOX (30 ng/mL) at 37°C. The formation of ASC speck was analyzed by high-content analysis. (G–J) Data are expressed as the mean ± SD. **p<0.01 and ***p<0.005 as determined by (G–J) two-way ANOVA with a post hoc test or (B, D, and F) Fisher’s exact test with the Holm correction. Data are representative of three independent experiments. (A and B) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and then treated with doxycycline (DOX) (30 ng/mL) at 37°C for 6 hr. The images were recorded by confocal microscopy at 5 min intervals from 3 hr to 6 hr. (A) The frequency of intracellular Ca2+ increase at each time point. (B) The cumulative number of Fluo-8-positive cells. (C and D) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with 4 µM Fluo-8 for 1 hr and VX-765 (20 µM) for 30 min. After DOX (30 ng/mL) treatment, the images were recorded at 5 min intervals from 3 hr to 6 hr. (C) The frequency of intracellular Ca2+ increase at each time point. (D) The cumulative number of Fluo-8-positive cells. (E, F, H) Differentiated TRE-NLRP3-L353P-THP-1 cells were pretreated with (E) trovafloxacin, (F) probenecid, or (H) MCC950 for 30 min and then treated with nigericin (5 µM) at 37°C for 6 hr. The levels of IL-1β in the supernatants were assessed by ELISA (n=3). (G) Differentiated TRE-NLRP3-D303N-THP-1 cells were pretreated with probenecid for 30 min and then treated with DOX (30 ng/mL) at 37 or 32°C for 6 hr. The IL-1β levels in the supernatants were assessed by ELISA (n=3). (E–H) Data are expressed as the mean ± SD. ***p<0.005 as determined by two-way ANOVA with a post hoc test or (B, D) Fisher’s exact test with the Holm correction. Data are representative of three independent experiments.

Discussion

In the present study, we demonstrated that CAPS-associated NLRP3 mutants form cryo-sensitive foci intracellularly. These foci are aggregates that function as a scaffold for inflammasome activation. Consistent with this finding, inflammasome assembly and subsequent IL-1β release induced by CAPS-associated NLRP3 mutants are cryo-sensitive. The aggregation of CAPS-associated NLRP3 mutants is regulated by intracellular Ca2+ levels. Furthermore, caspase-1 inhibition prevents Ca2+ influx and inflammasome assembly induced by CAPS-associated NLRP3 mutants. These findings provide new insights into the molecular mechanisms of inflammasome activation in CAPS. The formation of cryo-sensitive aggregates by CAPS-associated NLRP3 mutants is a significant finding of this study. Oligomerization or polymerization is a common feature of domains contained in inflammasome components. Both caspase recruitment domain (CARD) in ASC and caspase-1 and PYD in ASC and NLRP3 form filamentous assemblies (Masumoto et al., 1999; Lu et al., 2014; Karasawa et al., 2015; Stutz et al., 2017). In addition, full-length ASC, which has both PYD and CARD, forms a large aggregate called speck. Therefore, aggregation of CAPS-associated NLRP3 mutants seems to be mediated by their PYD-PYD interaction. However, the mechanisms by which CAPS-associated NLRP3 mutants, which typically occur in other domains including NACHT domain and LRR, promote aggregation and affect their cryo-sensitivity have remained unclear. During the preparation of this manuscript, the structure of full-length NLRP3 and complex of NLRP3 oligomer have been determined. Andreeva et al., 2021 have suggested that full-length murine NLRP3 forms oligomer called double-ring cage via interaction with LRR. Further analyses are required to clarify the role of double-ring cage formation in aggregation of CAPS-associated NLRP3 mutants. With regard to cryo-sensitivity, recent studies have suggested that the formation of aggregates and LLPS is modulated by conditions including temperature and pH (Alberti et al., 2019; Riback et al., 2020). These factors shift the threshold of aggregation and LLPS under a constant protein concentration. In the present study, the frequency of foci formation by mutated NLRP3 was weakly associated with its expression levels. Furthermore, increased expression of mutated NLRP3 dose dependently promoted inflammasome assembly. The temperature and its expression levels seems to be an essential determinant of the aggregation of mutated NLRP3. Although all of the analyzed NLRP3 mutants exhibited cryo-sensitivity, the sensitivity of FCAS-associated L353P and Y563N mutants was more prominent than that of CINCA-associated D303N and Y570C mutants. Meanwhile, CINCA-associated mutants formed a large number of aggregates compared to FCAS-associated mutants at 37°C. Therefore, we assume that different cryo-sensitivity plays a causative role in the disease severity and sensitivity to cold exposure of CAPS. Further analyses are required to clarify the association between disease severity and capacity to form aggregates. Cold exposure also affected inflammasome activation induced by extrinsic stimulation. Unlike NLRP3 mutant-mediated inflammasome activation, nigericin- or nanosilica-induced NLRP3 inflammasome activation was blunted by cold exposure. Since NLRP3 inflammasome assembly requires ATPase activity, the temperature may influence extrinsic stimulation-induced inflammasome assembly via its enzymatic activity (Duncan et al., 2007). Increasing evidence suggests that K+ efflux is a main upstream event of NLRP3 inflammasome activation (Munoz-Planillo et al., 2013; He et al., 2016a). Although the precise mechanism underlying K+ efflux-mediated NLRP3 inflammasome assembly is still unclear, NEK7 has been shown to interact with NLRP3 directly and promote inflammasome assembly as a downstream of K+ efflux (He et al., 2016b). Unexpectedly, we demonstrated that inflammasome activation induced by NLRP3-L353P is not prevented by supplementation with extracellular K+ or a deficiency of NEK7, indicating that K+ efflux is dispensable for inflammasome activation induced by FCAS-associated NLRP3 mutant. Instead, our data clearly showed that both NLRP3 aggregation and inflammasome assembly induced by NLRP3-L353P are dependent on the presence of Ca2+. Several studies indicate that Ca2+ is another upstream signal of NLRP3 inflammasome activation (Lee et al., 2012; Murakami et al., 2012; Rossol et al., 2012; Horng, 2014). Further studies are necessary to elucidate whether the previously identified mechanism of Ca2+-mediated WT-NLRP3 inflammasome activation shares the mechanism with inflammasome activation induced by CAPS-associated NLRP3 mutants. However, the Ca2+-sensitive NLRP3 aggregation appears to be distinct from canonical inflammasome assembly because the stimulation with nigericin failed to form NLRP3 aggregates. Of note, we showed that the elevation of intracellular Ca2+ induced by NLRP3-L353P was dependent on caspase-1 activity. Recent studies have suggested that gasdermin pore formation induced by caspase activation regulates the influx of Ca2+ (de Vasconcelos et al., 2019). Broz and his colleagues have suggested that the Ca2+ influx induced by GSDMD pore formation initiates membrane repair by ESCRT complex, which negatively regulates pyroptosis (Rühl et al., 2018). Another possible pore channel downstream of caspases is pannexin 1. Previous studies have suggested that caspase-11 and caspase-7 cleave and activate pannexin 1 during pyroptosis and apoptosis, respectively (Chekeni et al., 2010; Yang et al., 2015). The Ca2+ influx induced by NLRP3-L353P was probably mediated by pannexin 1 because two pannexin 1 inhibitors, probenecid and trovafloxacin, attenuated Ca2+ influx and inflammasome assembly induced by NLRP3-L353P. In the present study, pharmacological inhibition of caspase-1 and pannexin 1 prevents the elevation of intracellular Ca2+ and ASC oligomerization and speck formation. Therefore, we consider that CAPS-associated NLRP3 mutant forms cryo-sensitive inflammasome assemblies, which trigger caspase-1-mediated feed-forward loop of Ca2+ influx, leading to incremental inflammasome assembly. Ca2+ seems to promote this incremental inflammasome assembly rather than the initial assembly because the aggregation of NLRP3 mutants was blunted but still induced in the absence of Ca2+. In comparison with NLRP3-L353P, NLRP3-D303N was less sensitive to Ca2+ because Ca2+ depletion partially inhibited IL-1β release induced by NLRP3-D303N. Furthermore, the pannexin 1 inhibition failed to prevent IL-1β release induced by NLRP3-D303N. It is likely that CINCA-associated mutants exhibit constitutive active properties, and feed-forward regulation mediated by Ca2+ influx promotes inflammasome assembly only in FCAS-associated NLRP3 mutants. Taken together, the inhibition of caspase-1-pannexin 1 axis could be a potential target to inhibit inflammasome assembly induced by FCAS-associated NLRP3 mutants. In the present study, we investigated the mechanisms of cryo-sensitive inflammasome assembly in CAPS-associated NLRP3 mutants. However, this study has a few limitations. First, to analyze the function of mutated NLRP3, we used mutated NLRP3 expressing under an inducible promoter or in ASC KO cells because the expression of mutated NLRP3 induces pyroptotic cell death. To clarify the dynamics of endogenously expressed NLRP3, a study using a knock-in model would be required. Second, the aggregation of NLRP3 was analyzed by fusion protein with mNeonGreen. A biochemical analysis of aggregation using mutated NLRP3 without any tags or fluorescent proteins is also required in the future. In conclusion, we found that CAPS-associated NLRP3 mutants form cryo-sensitive aggregates, which can function as the scaffold for NLRP3 inflammasome activation. The aggregation of mutated NLRP3 is not dependent on K+ efflux but rather is regulated by intracellular Ca2+ levels. We expect that our findings would be valuable for the development of novel therapies for CAPS.

Materials and methods

Plasmids

PCR-generated cDNAs encoding human NLRP3 were subcloned into pENTR4 vector. The mutated NLRP3-D303N and NLRP3-L353P were generated using the PrimeSTAR Mutagenesis Basal kit (Takara Bio, Shiga, Japan) (Aizawa et al., 2020). The primers for introducing mutations were as follows: D303N (forward, 5′-GGCTTCAATGAGCTGCAAGGTGCCTTTGACGAG-3′; reverse, 5′-CAGCTCATTGAAGCCGTCCATGAGGAAGAGGAT-3′) and L353P (forward, GTGGCCCCGGAGAAACTGCAGCACTTGCTGGAC-3′; reverse, 5′-TTTCTCCGGGGCCACAGGTCTCGTGGTGATGAG-3′). To produce DOX-inducible expression vector, the mutated NLRP3 and WT-NLRP3 were transferred into CS-IV TRE CMV KT (kindly provided by Dr. H. Miyoshi, RDB12876, RIKEN BRC, Tsukuba, Japan) with LR clonase (Thermo Fisher Scientific). To develop NLRP3-mNeonGreen or ASC-BFP-expressing lentiviral vector, PCR-generated NLRP3-WT, NLRP3-L353P, NLRP3-D303N, NLRP3-Y563N, NLRP3-Y570C, NLRP3-L353P3KA, NLRP3-D303N3KA, ASC, mNeonGreen, and moxBFP (a gift from Erik Snapp; Addgene plasmid #68064) were Gibson subcloned into CS-EF-1 (derived from CS-CA-MCS; RIKEN BRC). The sgRNA targeting NEK7 was designed with CRISPR direct (http://crispr.dbcls.jp) and subcloned into LentiCRISPRv2, which was a gift from Feng Zhang (Addgene plasmid #52961; http://n2t.net/addgene: 52961; RRID: Addgene_52961). The sgRNA targeting ASC and CASP1 was developed previously (Aizawa et al., 2020).

Cell lines

HeLa cells (gifted from Dr. Kenji Tago) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Wako, Osaka, Japan) supplemented with 10% fetal calf serum (FCS) and antibiotics. THP-1 cells (ATCC) were cultured in RPMI1640 (Sigma, St Louis, MO, USA) supplemented with 10% FCS and antibiotics. THP-1 macrophages were differentiated with 200 nM phorbol-12-myristate-13-acetate (PMA) for 24 hr. LentiX293T cells were obtained from TAKARA (Takara Bio, Shiga, Japan) and cultured in DMEM supplemented with 10% FCS, 1 mM sodium pyruvate, and antibiotics. Unless otherwise indicated, cells were cultured at 37°C in 5% CO2. Cell lines were authenticated by analysis of short tandem repeat profiling (BEX, Tokyo, Japan) and confirmed as negative for mycoplasma contamination using TaKaRa PCR Mycoplasma Detection Set (Takara Bio) and Hoechst staining.

Lentiviral preparation

LentiX293T cells were co-transfected with self-inactivating vectors, pLP1, pLP2, and pVSVG using PEI MAX (Polysciences, Warrington, PA, USA) to prepare the lentiviral vectors. Culture media containing the lentiviral vectors were collected 3 days after transfection. The collected media were filtered with a 0.45 µm filter and ultracentrifuged at 21,000 rpm using a Type 45 Ti rotor (Beckman Coulter, Brea, CA, USA), and the pellets were resuspended in PBS containing 5% FCS. The lentivirus titer was measured using a Lentivirus quantitative PCR Titer kit (Applied Biological Materials, Richmond, BC, Canada). For lentiviral transduction, the cells were incubated with purified lentiviral vectors in the presence of 8 µg/mL polybrene (Sigma). The details of the developed cells are described in the key resource table.

Treatment of reagents and cold exposure

The transduced THP-1 cells were differentiated with 200 nM PMA for 24 hr and treated with DOX (Wako) or nigericin (InvivoGen) at the indicated concentrations. Next, cells were cultured at 37 or 32°C. Cells were then pretreated with inhibitors including CA-074 (Wako), MCC950 (Adipogen, San Diego, CA), probenecid (Cayman, Ann arbor, MI), trovafloxacin mesylate (Cayman), VX-765 (Selleck), and Z-VAD-FMK (MBL) for 30 min prior to cold exposure.

Confocal microscopy

For imaging of fixed cells, the transduced cells were seeded on an eight-well chamber slide (Matsunami Glass Ind., Ltd., Osaka, Japan) and then fixed with neutral buffered formalin or 1% paraformaldehyde and stained with 1 µg/mL 4',6-diamidino-2-phenylindole, dihydrochloride (DAPI; Dojindo). For live-cell imaging, cells were seeded at 1×105 cells/well on eight-well cover glass chambers (IWAKI, Shizuoka, Japan) and labeled with Hoechst33342 for 20 min before treatment. The images were captured using confocal microscopy (FLUOVIEW FV10i; Olympus, Tokyo, Japan).

High-content analysis

The transduced HeLa cells or THP-1 cells were seeded on 96-well plates and treated with the indicated stimuli. For analysis of fixed cells, nuclei were stained with DAPI after fixation by 1% paraformaldehyde. For live-cell imaging, cells were stained with DRAQ5 (Biolegend, San Diego, CA) and analyzed by an Operetta CLS high-content analysis system (PerkinElmer, Waltham, MA).

FRAP analysis

The transduced HeLa cells were seeded on eight-well cover glass chambers (IWAKI), cultured at 32°C for 24 hr, and analyzed by FV1000 confocal microscopy (Olympus) at 32°C. Images were captured using an UPLA SAPO 60XO objective. The GFP and mNeonGreen signals were captured using a line sequential scan setting with excitation laser lines at 488 nm. For FRAP analysis, a 1 s pulse of the 488 nm laser line at 5% power was used to bleach the NLRP3-mNeonGreen foci. A 5 s pulse of 488 nm laser line at 30% power was used to bleach the ASC-GFP specks, and a 1 s pulse of 405 nm laser line at 50% power was used to bleach unfused mNeonGreen. The changing of fluorescence was monitored by imaging every 0.2 ms.

IL-1β secretion assay

Cells were seeded into 96-well plates at 5×104 cells/well. After the indicated treatments, culture supernatants were collected and the IL-1β levels were measured by ELISA using a commercial kit (R&D Systems, Minneapolis, MN, USA). The supernatants were precipitated with ice-cold acetone and resolved in 1×Laemmli buffer for western-blot analysis.

Western-blot analysis

Samples were separated by sodium dodecyl sulfate-polyacrylamide electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes. After blocking with Blocking One (Nacalai Tesque, Kyoto, Japan) for 30 min, the membranes were incubated overnight at 4°C with the following primary antibodies (Abs): anti-ASC (AL-177; Adipogen), anti-β actin (clone AC-15; Sigma), anti-caspase-1 (3866; Cell Signaling Technology), anti-IL-1β (H153; Santa Cruz Biotechnology), anti-NEK7 (EPR4900; abcam, Cambridge, UK), and anti-NLRP3 (clone Cryo-2; Adipogen). As secondary Abs, HRP-goat anti-mouse Superclonal IgG (Thermo Fisher Scientific) or HRP-goat anti-rabbit IgG (Cell Signaling Technology) was incubated with membrane for 1 hr. After being washed with TBS-Tween, immunoreactive bands were visualized using Western BLoT Quant HRP Substrate (Takara Bio) or Western BLoT Ultra Sensitive HRP Substrate (Takara Bio).

ASC-oligomerization assay

Cells were lysed in 0.5% Triton X-100 buffer (20 mM Tris HCl, 10 mM KCl, 1.5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 320 mM sucrose, and 0.5% Triton X-100) for 20 min. Lysates were then centrifuged at 5000× g for 10 min. The insoluble pellets were reacted with 2 mM bis(sulfosuccinimidyl)suberate (Thermo Fisher Scientific) for 30 min and the reactions were terminated by an excess amount of glycine.

Reverse transcription and real-time PCR

Total RNA was prepared using ISOGEN (Nippon Gene Co., Tokyo, Japan) according to the manufacturer’s instructions. Total RNA was reverse transcribed using a SuperScript VILO cDNA Synthesis kit (Life Technologies). Real-time PCR was performed using SYBR Premix Ex Taq II (Takara Bio). The primers used in the assay were as follows: NEK7 (forward, 5′-GCCTTACGACCGGATATGGG-3′; reverse, 5′-CACTAAATTGTCCGCGACCAA–3′) and ACTB (forward, 5′- GGCACTCTTCCAGCCTTCCTTC-3′; reverse, 5′-GCGGATGTCCACGTCACACTTCA-3′).

Ca2+ imaging using Fluo-8

Cells were seeded at 1×105 cells/well on an eight-well cover glass chamber (IWAKI). Fluo-8 (Santa Cruz Biotechnology) was loaded at 4 µM for 60 min in the presence of 0.04% Pluronic F127 (Sigma) and 1.25 mM probenecid (Cayman). After removal of the loading medium, cells were treated with DOX in the presence of 1.25 mM probenecid. In experiments not using probenecid, cells were pretreated with Fluo-8 at 4 µM for 60 min in the presence of 0.04% Pluronic F127 and then treated with DOX. Z-stack time-lapse images at 37°C were captured using confocal microscopy (FLUOVIEW FV10). To normalize the cell number, nuclei were labeled with Hoechst 33,342 (1 µg/mL) or DRAQ5. For detection of dying cells, images were captured in the presence of 100 nM SYTOX Deep Red.

Fura2 assay

Cells were seeded at 5×104 cells/well into 96-well plates and loaded with 3 µM fura 2-AM (Dojindo, Kumamoto, Japan) for 30 min. After cells were treated with the indicated reagents, fluorescence intensity (Excitation:340 or 380, Emission:510 nm) was measured by using a multimode microplate reader (Spark; TECAN, Switzerland) at 37 or 32°C.

Statistical analysis

Data are expressed as mean ± SD. Differences between two groups were determined by Student’s t-test. Differences between multiple group means were determined by two-way ANOVA combined with the Tukey’s post hoc test. Differences between multiple groups with repeated measurements were evaluated by repeated one-way ANOVA or repeated two-way ANOVA combined with the post hoc test. Analyses were performed using GraphPad Prism 6 software (Graph Pad Software, La Jolla, CA, USA) or R version 4.0.2 (https://www.r-project.org). A p-value of <0.05 was considered statistically significant. Biological replicates indicate replicates of the same experiment conducted upon separately seeded culture on separate days. The number of biological replicates is described in the figure legend. For plate reader-based assay, n represents replicates that were acquired from different cells. In live-cell imaging assay, n represents replicates that were acquired from each cell through multiple set of experiments. Gain of function mutations in NLRP3 are associated with a group of autoinflammatory diseases called the cryopyrin-associated periodic syndromes (CAPS). Karasawa and colleagues reveal that CAPS-associated NLRP3 mutants form cryo-sensitive aggregates that promote NLRP3 inflammasome assembly and Caspase-1 activation through elegant immunofluorescence studies, providing mechanistic insights into CAPS. Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work. Decision letter after peer review: Thank you for submitting your article "Cryo-sensitive aggregation triggers NLRP3 inflammasome assembly in cryopyrin-associated periodic syndrome" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Carla Rothlin as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Seth L Masters (Reviewer #2); Hal Hoffman (Reviewer #3). The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. Essential revisions: 1. The role of Ca in constitutive aggregation of NLRP3 CAPS mutants and the subsequent inflammasome assembly, and role for caspase 1 should be clarified as suggested by Reviewer 1. 2. Additional triggers of NLRP3 should be tested for the reasons described by Reviewer 2. 3. Whether the cryo-sensitive aggregation a common characteristic of other autoinflammation-associated NLRP3 mutants should be examined. 4. Attempt to address why a CINCA mutation seen in patients in which cold is not a trigger of clinical symptoms have similar cold induced aggregation. Reviewer #1 (Recommendations for the authors): It is not clear if Ca is required for both the constitutive aggregation of NLRP3 CAPS mutants and the subsequent inflammasome assembly. Is the aggregation of NLRP3 CAPS mutants the trigger for Ca influx? This would then argue against a role for Ca in the aggregation of NLRP3 CAPS mutants. Casp1 inhibitor impairing Ca influx suggests that Ca influx amplifies rather than triggers the activation of NLRP3 CAPS mutants. In which case, Ca-independent aggregation of NLRP3 CAPS mutants should be demonstrated. Furthermore, the authors should address how Ca influx amplifies the activation of NLRP3 CAPS mutants. Is this cryo-sensitive aggregation a common characteristic of other autoinflammation-associated NLRP3 mutants? Biochemical demonstration of aggregation of NLRP3 CAPS mutants would strengthen the immunofluorescence data in Figure 1 (L353P and D303N). Figure 3 and its supplement should include direct comparisons of WT NLRP3 and NLRP3 mutants. NEK7 deletion should be verified by western blotting. Reviewer #2 (Recommendations for the authors): Can the authors quantify the area of mutant NLRP3 foci per cell, at normal and low temperatures. Presumably this is important as the aggregate size (and number) are likely to be functions of temperature? Again as suggested above, consider additional triggers for NLRP3 activation in case temperature affects nigericin and silica in independent ways. Perhaps a more direct trigger, things that disturb the TGN, what about K+ efflux independent activation with transfected imiquimod? In general, only two mutations in NLRP3 are considered, when there are a wider variety associated with FCAS. Some of these might have alternate mechanisms of activation, be further from the ATP binding site or oligomerise the molecule in other ways, so it would be good to confirm that a variety still form temperature dependent foci. It may also be informative to make a mutant of the polybasic region to establish if this is involved in mutant NLRP3 foci formation, however presumably these do not colocalise with the dTGN or another structure within the cell? It is very confusing that the increase in specks for mutant NLRP3 does not occur with Casp1 inhibitors as this does not seem consistent with increased mutant NLRP3 foci observed in the absence of ASC. Perhaps mutant NLRP3 foci need to be quantified with the Caspase-1 inhibitors, or some other explanation to this apparent contradiction? In general I remain unclear about the importance of feedforward effects for Caspase-1 in this process and would consider to remove this data unless the physiological significance is clear. At the very least, more controls like the genetic deletion of Caspase-1 would be critical to establish that this is not a non-specific effect of VX-765. Reviewer #3 (Recommendations for the authors): Abstract Concise and clear. Introduction Initial symptoms described should be described as unique or differentiating clinical features of the subtypes. Cryopyrin refers to the protein, not the gene. Initial identification of NLRP3 was in 2001. Methods Adequate detail of techniques Results Overall mostly clear presentation of data in main and supplemental figures and mostly accurate interpretation. I found the insertion of figures into the text more difficult to read. While the figure legends are accurate the authors should label the subfigures better since it is difficult to keep track of what is transfected in each sub figure. The use of two mutant constructs is a major strength, but there are some clear differences between the two and the authors only study both constructs in some of the experiments which may ignore some of these differences. Specific comments Figure 1A – I don't understand the difference between foci and speck, especially since they are both shown to be aggregates later in figure 2. In the images shown it appears than the FCAS transfected cells have several low intensity areas and the CINCA transfected cells have similar low intensity areas but also have one speck similar to the ASC GFP transfected cells. Figure 1D-E. This is the most novel finding of the paper in that mutants have increased foci number while WT have reduced or unchanged foci number when cultured at 32 C. However, the cold induced data is not consistent with clinical findings since CINCA patients do not experience cold induced symptoms. The authors should at least comment on this and make an attempt to explain it. One of the most exciting findings of this figure is that the data is consistent with the severity of the disease associated with the specific mutation. These assays could provide quantitative methods to quantify mutation pathogenicity. Figure 2 Clear demonstration of aggregates and not LLPS. However, if they are both aggregates, then why are the authors describing them differently. Other than the LLPS inhibitor, I don't understand what is different about supplemental Figure 2. Figure 3 and supplemental Figure 3 The use of the TET ON system is novel, and clearly shows increased NLRP3 expression and dimerization as well as ASC solublilty changes when induced and with temperature but I don't understand why it proves that the tag isn't responsible for the aggregate formation. I found the reduction of cold induced IL-1B release with extrinsic stimulation of WT cells to be interesting. This should be emphasized as more evidence of mutation specific effects. This figure might actually help the authors in that the cold induction of IL-1B expression and release in the CINCA transfected cells is much more modest than in the FCAS transfected cells. Its possible that CINCA patient do have cold induction but don't notice it since their baseline inflammation is so high and there is so little change with cold. Do foci number correlate well with IL-1B release? Figure 4 Clear. This is some of the strongest data of the paper. Potassium and NEK7 data is interesting and could be moved from supplemental. It might be useful to see if the CINCA mutation has some K and NEK7 dependence. Figure 5 Clear and novel. Are results the same for CINCA mutations. Figure 6 Clear and translational. Involvement of Caspase 1 in calcium mobilization is novel finding. 6B I don't understand. 6D Interesting that casp 1 inhibition affects ASC solubility. MCC950 data could be moved from Supplemental to main. Are results the same for CINCA mutations. Figure 7 Clear and helpful. Discussion Concisely written. Data supports conclusions. Limitations discussed. Need to discuss differences in mutation and try to relate to clinical findings. References – Mostly Adequate. Essential revisions: 1. The role of Ca in constitutive aggregation of NLRP3 CAPS mutants and the subsequent inflammasome assembly, and role for caspase 1 should be clarified as suggested by Reviewer 1. Thank you for pointing out this issue. We showed that ca2+ promotes both the initial aggregation and subsequent inflammasome assembly. Although the presence of ca2+ enhanced the aggregation of mutated NLRP3, the aggregation still occurred in the absence of ca2+ (Figure 5C­–E, Figure 5­—figure supplement 2A–C). The initial aggregation of mutated NLRP3 triggered ca2+ influx because inflammasome assembly visualized by ASC-BFP occurred prior to ca2+ influx (Figure 6G–I). Furthermore, ca2+ influx was mediated by caspase-1 because pharmacological inhibition of caspase-1 prevented ca2+ influx and ASC speck formation induced by mutated NLRP3 (Figure 7A–E). In the revised manuscript, the involvement of caspase-1 was further validated by genetically mutated cells (Figure 7G and H). With regard to the mechanism of ca2+ influx, we found that inhibition of pannexin 1 attenuated ca2+ influx and the formation of inflammasome assembly (Figure 8A–H). We have added the data and discussed these issues in the revised manuscript (page 8, paragraph 1, page 9, paragraph 1 and 2, and page 12, paragraph 2). 2. Additional triggers of NLRP3 should be tested for the reasons described by Reviewer 2. According to the suggestions, we investigated additional regulatory mechanisms of inflammasome activation induced by mutated NLRP3. Recent studies have suggested that dispersion of TGN plays a critical role in both K+ efflux-dependent and independent inflammasome activation (Nature, 2018;564:71). Since the polybasic linker in NLRP3 is required for its TGN localization, we introduced mutation in the polybasic linker of mutated NLRP3. However, the NLRP3 polybasic linker mutants formed cryo-sensitive foci, indicating that TGN localization is dispensable for inflammasome activation induced by mutated NLRP3 (Figure 4C–E and Figure 4—figure supplement 1F). Instead, according to the reviewer’s suggestion, we assessed the effect of pannexin 1 inhibitor and found that pannexin 1 was involved in ca2+ influx and subsequent inflammasome assembly induced by FCAS-associated NLRP3 mutant (Figure 8A–H and Figure 8—figure supplement 1A–D). We have added the data and mentioned these issues in the revised manuscript (page 7, paragraph 1, and page 9, paragraph 2). 3. Whether the cryo-sensitive aggregation a common characteristic of other autoinflammation-associated NLRP3 mutants should be examined. We appreciate this important comment. In addition to L353P and D303N mutants, we developed FCAS-associated Y563N and CINCA-associated Y570C mutants. Whereas previously developed L353P and D303N mutants are located in NBD, these two mutations are located in NLRC4HD domain of NLRP3 (Figure 1—figure supplement 1A). Expectedly, both two mutants form cryo-sensitive aggregates (Figure 1I and Figure 1—figure supplement 1B–E). We have added the data and mentioned these issues in the revised manuscript (page 4, paragraph 3, and page 5, paragraph 1). 4. Attempt to address why a CINCA mutation seen in patients in which cold is not a trigger of clinical symptoms have similar cold induced aggregation. We appreciate this invaluable comment. We further analyzed FCAS-associated L353P and Y563N mutants and CINCA-associated D303N and Y570C mutants. Although all of the analyzed mutated NLRP3 exhibited cryo-sensitivity, the sensitivity of FCAS mutants was more prominent than that of CINCA mutants (Figure 1F and I, Figure 1—figure supplement 1D–G). Moreover, the foci number of CINCA-associated mutants was higher than that of FCAS-associated mutants at 37ºC. Thus, it is likely that CINCA-associated NLRP3 mutants exhibit cryo-sensitivity, but their ability to form aggregates is potent enough to induce inflammasome activation at 37ºC. We have added the data and discussed these issues in the revised manuscript (page 5, paragraph 1, and page 11, paragraph 1). Reviewer #1 (Recommendations for the authors): It is not clear if Ca is required for both the constitutive aggregation of NLRP3 CAPS mutants and the subsequent inflammasome assembly. Is the aggregation of NLRP3 CAPS mutants the trigger for Ca influx? This would then argue against a role for Ca in the aggregation of NLRP3 CAPS mutants. (Please also see the response to the Editor #1): Thank you for pointing out this important issue. Ca2+ promotes both the initial aggregation and subsequent inflammasome assembly. However, aggregation of mutated NLRP3 occurred in the absence of ca2+. NLRP3 L353P mutant and D303N mutant formed cold-exposure-induced foci in ca2+-depleted condition (Figure 5­—figure supplement 2A–C). As the reviewer suggested, the initial aggregation of mutated NLRP3 triggered ca2+ influx because inflammasome assembly visualized by ASC-BFP occurred prior to ca2+ influx (Figure 6G–I). With regard to the mechanism of ca2+ influx, we found that inhibition of pannexin 1 attenuated ca2+ influx and inflammasome assembly (Figure 8A–H). We have added the data and discussed these issues in the revised manuscript (page 9, paragraph 2, and page 12, paragraph 2). Casp1 inhibitor impairing Ca influx suggests that Ca influx amplifies rather than triggers the activation of NLRP3 CAPS mutants. In which case, Ca-independent aggregation of NLRP3 CAPS mutants should be demonstrated. Furthermore, the authors should address how Ca influx amplifies the activation of NLRP3 CAPS mutants. We appreciate your constructive comment. We agree that ca2+ influx functions as an amplifier of inflammasome assembly induced by mutated NLRP3. As the reviewer suggested, cold exposure promoted aggregation of mutated NLRP3 even in the absence of ca2+ (Figure 5­—figure supplement 2A–C). However, the supplementation of ca2+ promoted aggregation of mutated NLRP3 (Figure 5E). Previous studies have suggested that cationic ions regulate protein aggregates such as α-synuclein (Sci Rep. 2018;8:1895, doi: 10.1038/s41598-018-20320-5.). Therefore, we speculate that the influx of ca2+ is a direct regulator of mutated NLRP3 aggregation. We have added the data and mentioned these issues in the revised manuscript (page 8, paragraph 1). Is this cryo-sensitive aggregation a common characteristic of other autoinflammation-associated NLRP3 mutants? (Please also see the response to the Editor #3): We appreciate this invaluable comment. According to the comment, we developed the cells expressing other CAPS-associated NLRP3 mutants: FCAS-associated Y563N and CINCA-associated Y570C. Expectedly, both two mutants form cryo-sensitive aggregate (Figure 1I, Figure1—figure supplement 1B–G). Moreover, sensitivity to cold exposure is more prominent in FCAS-associated Y563N than CINCA-associated Y570C. We have added the data and mentioned these issues in the revised manuscript (page 5, paragraph 1). Biochemical demonstration of aggregation of NLRP3 CAPS mutants would strengthen the immunofluorescence data in Figure 1 (L353P and D303N). Thank you for this valuable suggestion. To assess the aggregation of mutated NLRP3 without being affected by fluorescent tag, we developed the ASC-KO /TRE-NLRP3-L353P- and ASC-KO /TRE-NLRP3-D303N-THP-1 cells and showed that the mutated NLRP3 were detected in the detergent-insoluble fraction in the absence of ASC. This biochemical experiment supports that mutated NLRP3 forms aggregates (Figure 3—figure supplement 1C). We have added the data and mentioned these issues in the revised manuscript (page 6, paragraph 1). Figure 3 and its supplement should include direct comparisons of WT NLRP3 and NLRP3 mutants. Thank you for your important comment. We agree that direct comparisons between mutants are helpful to validate the potency of each mutant. In our experiment, however, transduction of lentiviral vector encoding mutated NLRP3 induced massive cell death in the presence of ASC probably due to carrying over of mutated NLRP3 protein produced in 293T cells during lentiviral production. Therefore, we established each cell line from survived cells with limiting dilution. IL-1β release and ASC speck formation were evaluated in each clone. Instead, we directly compared the effect of WT and L353P on ASC recruitment to the aggregates (Figure 3A–C). We would like to validate the potency to produce IL-1β in each mutant in future work. NEK7 deletion should be verified by western blotting. According to this suggestion, we confirmed the deficiency of NEK7 by western blotting (Figure 4—figure supplement 1C). We have added the data and mentioned this issue in the revised manuscript (page 7, paragraph 1). Reviewer #2 (Recommendations for the authors): As suggested above, can the authors quantify the area of mutant NLRP3 foci per cell, at normal and low temperatures. Presumably this is important as the aggregate size (and number) are likely to be functions of temperature? Thank you for this important comment. We quantified the area and number of foci formed by NLRP3 mutants. Although the total area of foci was increased by cold exposure, the mean area of foci was not increased by cold exposure (Figure 1—figure supplement 1F and G). In contrast, the number of foci was increased by cold exposure (Figure 1H and I). These results suggest that the temperature affects the number of foci rather than their size. We have added the data and mentioned these issues in the revised manuscript (page 5, paragraph 1). Again as suggested above, consider additional triggers for NLRP3 activation in case temperature affects nigericin and silica in independent ways. Perhaps a more direct trigger, things that disturb the TGN, what about K+ efflux independent activation with transfected imiquimod? Thank you for this helpful comment. A previous report has suggested that imiquimod induces TGN-dispersion and inflammasome activation in a K+ efflux-independent manner. In our experiment with THP-1 cells, however, the treatment with imiquimod failed to induce IL-1β release (Author response image 1). Therefore, we were not able to evaluate the effect of cold exposure on imiquimod-induced response. Instead, we investigated the involvement of TGN because the dispersion of TGN plays a critical role in both K+-efflux-dependent and independent inflammasome activation. Although we introduced mutation into polybasic linker, which interacts with phosphorylated phosphatidylinositide on TGN membrane, the NLRP3 polybasic linker mutant forms cryo-sensitive aggregation (Figure 4C–E). On the other hand, we found that pannexin 1 is involved in ca2+ influx and subsequent inflammasome assembly induced by NLRP3 L353P mutant (Figure 8A–H). We have added the data and mentioned these issues in the revised manuscript (page 7, paragraph 1, and page 9, paragraph 2).
Author response image 1.

The effect of imiquimod on IL-1β release in THP-1 cells.

THP-1 cells were differentiated with PMA for 24 h and then treated with nigericin, imiquimod, or nanosilica at 37ºC or 32ºC for 6 h. The levels of IL-1β in the supernatants were assessed by ELISA (n = 3). Data are expressed as the mean ± SD.

The effect of imiquimod on IL-1β release in THP-1 cells.

THP-1 cells were differentiated with PMA for 24 h and then treated with nigericin, imiquimod, or nanosilica at 37ºC or 32ºC for 6 h. The levels of IL-1β in the supernatants were assessed by ELISA (n = 3). Data are expressed as the mean ± SD. In general, only two mutations in NLRP3 are considered, when there are a wider variety associated with FCAS. Some of these might have alternate mechanisms of activation, be further from the ATP binding site or oligomerise the molecule in other ways, so it would be good to confirm that a variety still form temperature dependent foci. (Please also see the response to the Editor #3): We appreciate this helpful comment. According to the comment, we developed the cells expressing other CAPS-associated NLRP3 mutants: FCAS-associated Y563N and CINCA-associated Y570C. These two mutations are located in NLRC4HD domain of NLRP3. Expectedly, both two mutants form cryo-sensitive aggregates (Figure 1I, Figure 1—figure supplement 1B–G). We have added the data and mentioned these issues in the revised manuscript (page 4, paragraph 3, and page 5, paragraph 1). It may also be informative to make a mutant of the polybasic region to establish if this is involved in mutant NLRP3 foci formation, however presumably these do not colocalise with the dTGN or another structure within the cell? We appreciate this valuable suggestion. As described in the response to the comment #2, we developed the mutants lacking three lysine residues (K129, K131, and K132) in the polybasic linker of NLRP3 by introducing alanine. Notably, the polybasic region mutant still formed foci (Figure 4C). Although foci formation by D303N mutant was decreased by polybasic linker mutation, cold exposure-enhanced foci formation was detected even in the polybasic linker mutant (Figure 4D and E). These results suggest that localization to TGN is dispensable for cryo-sensitive aggregation of mutated NLRP3. We have added the data and mentioned these issues in the revised manuscript (page 7, paragraph 1). It is very confusing that the increase in specks for mutant NLRP3 does not occur with Casp1 inhibitors as this does not seem consistent with increased mutant NLRP3 foci observed in the absence of ASC. Perhaps mutant NLRP3 foci need to be quantified with the Caspase-1 inhibitors, or some other explanation to this apparent contradiction? In general I remain unclear about the importance of feedforward effects for Caspase-1 in this process and would consider to remove this data unless the physiological significance is clear. At the very least, more controls like the genetic deletion of Caspase-1 would be critical to establish that this is not a non-specific effect of VX-765. Thank you for this thoughtful comment. The inhibition of caspase-1 with VX-765 partially attenuated inflammasome assembly (Figure 7D and E). Therefore, we postulate that caspase-1-mediated ca2+ influx was dispensable for the initial aggregation of NLRP3 mutants. According to the suggestions, we further validate the effect of CASP1-deficiency on mutated NLRP3-mediated ca2+ influx and inflammasome assembly. Indeed, CASP1-deficiency attenuated ca2+ influx and ASC speck formation induced by mutated NLRP3 (Figure 7G and H). We have added the data and mentioned these issues in the revised manuscript, (page 9, paragraph 1). Reviewer #3 (Recommendations for the authors): Introduction Initial symptoms described should be described as unique or differentiating clinical features of the subtypes. Thank you for this helpful suggestion. We described symptoms of each of the three syndromes in detail as follows: “FCAS is the mildest form of CAPS and is characterized by cold-induced fever, arthralgia, urticaria, and conjunctivitis. MWS is accompanied by systemic amyloidosis and progressive hearing loss. CINCA is the most severe phenotype and is characterized by central nervous system inflammation, bone deformities, and chronic conjunctivitis.” (page 3, paragraph 1). Cryopyrin refers to the protein, not the gene. Initial identification of NLRP3 was in 2001. We do apologize for our mistake. According to the suggestion, we have amended the sentence as follows: “Genetic causes of these disorders are gain-of-function mutations in the Nucleotide-binding oligomerization domain, leucine-rich repeat and pyrin domain containing 3 (NLRP3) gene, encoding cryopyrin (Hoffman et al., 2001; Brydges et al., 2009; Kuemmerle-Deschner, 2015).” (page 3, paragraph 3). Results Overall mostly clear presentation of data in main and supplemental figures and mostly accurate interpretation. I found the insertion of figures into the text more difficult to read. While the figure legends are accurate the authors should label the subfigures better since it is difficult to keep track of what is transfected in each sub figure. We do apologize for troubling you. According to the suggestion, we have amended the arrangement of figures. In the revised manuscript, figures are provided separately. Further, we have added the label of the transduced gene in each subfigure. The use of two mutant constructs is a major strength, but there are some clear differences between the two and the authors only study both constructs in some of the experiments which may ignore some of these differences. Thank you for this invaluable comment. In the previous manuscript, we analyzed FCAS-associated L353P mutant and CINCA-associated D303N mutant. In some experiments, we mainly analyzed L353P mutant to clarify the mechanisms of its cryo-sensitivity. In the revised manuscript, we performed additional experiments using D303N mutant and confirmed that D303N mutant-mediated inflammasome assembly is independent of NEK7 and dispensable for TGN (Figure 4—figure supplement 1E, and Figure 4D). Meanwhile, although the expression of D303N mutant also caused ca2+ influx (Figure 6—figure supplement 1A and B), the inhibition of pannexin 1 failed to inhibit IL-1β release induced by D303N mutant (Figure 8—figure supplement 1G). D303N mutant was less sensitive to ca2+ because ca2+-depletion partially inhibited IL-1β release induced by D303N (Figure 5—figure supplement 1F and Figure 5—figure supplement 2B). Moreover, a remarkable difference between FCAS and CINCA-associated mutants was observed in the formation of aggregates at 37ºC. Whereas foci formation in FCAS-mutants was markedly induced at 32ºC, a large number of foci were detected even at 37ºC in CINCA-associated mutants (Figure 1I). These results suggest that D303N mutant displays constitutive active properties. We have added the data and discussed these issues in the revised manuscript (page 11, paragraph 1, and page 12, paragraph 2). Specific comments Figure 1A – I don't understand the difference between foci and speck, especially since they are both shown to be aggregates later in figure 2. In the images shown it appears than the FCAS transfected cells have several low intensity areas and the CINCA transfected cells have similar low intensity areas but also have one speck similar to the ASC GFP transfected cells. Thank you for pointing out this issue. Previous studies have suggested that ASC forms a large speck aggregate (J Biol Chem. 1999;274, 33835. doi: 10.1074/jbc.274.48.33835.). ASC generally forms a single speck per cell, and the size of the speck is 1–2 µm in a diameter (Cell death Differ. 2007. 2007;14:1590, doi: 10.1038/sj.cdd.4402194.). In contrast, NLRP3 mutants form small multiple foci in the cells. To validate the number of mutated NLRP3 foci per cell, we analyzed the data of high content analysis and confirmed that mutated NLRP3 forms one to multiple foci in the cells (Figure 1—figure supplement 1D). Figure 1D-E. This is the most novel finding of the paper in that mutants have increased foci number while WT have reduced or unchanged foci number when cultured at 32 C. However, the cold induced data is not consistent with clinical findings since CINCA patients do not experience cold induced symptoms. The authors should at least comment on this and make an attempt to explain it. (Please also see response to the Editor #3): We appreciate this important comment. We further analyzed FCAS-associated Y563N mutant and CINCA-associated Y570C mutant in the revised manuscript. Although the analyzed mutated NLRP3 exhibited cryo-sensitivity, the sensitivity of FCAS mutants was more prominent than that of CINCA (Figure 1E–I and Figure 1—figure supplement 1E and F). Moreover, foci number of CINCA-associated mutants was higher than that of FCAS-associated mutants at 37ºC. Thus, we postulate that CINCA-associated NLRP3 mutants exhibit cryo-sensitivity, but their ability to form aggregates is potent enough to induce inflammasome activation at 37ºC. We have added the data and discussed these issues in the revised manuscript (page 11, paragraph 1). One of the most exciting findings of this figure is that the data is consistent with the severity of the disease associated with the specific mutation. These assays could provide quantitative methods to quantify mutation pathogenicity. Thank you for your positive comment. Because we evaluated only four mutants in this study, it is difficult to determine the severity of CAPS associated with specific mutations by the number of mutated NLRP3 foci. Therefore, we would like to investigate the association between foci number and disease severity in future work. Other than the LLPS inhibitor, I don't understand what is different about supplemental Figure 2. I’m sorry for our insufficient explanation. In figure-supplement 2, we analyzed partially bleached D303N aggregates and wholly bleached L353P aggregates, separately (Figure 2—figure supplement 2A and C), whereas partially bleached L353P aggregate were analyzed in figure 2A and B. In addition, as a positive control of FRAP, we have added the data on FRAP analysis of unfused mNeonGreen protein (Figure 2—figure supplement 2E and F). We have added the data and mentioned these issues in the revised manuscript (page 5, paragraph 2). Figure 3 and supplemental Figure 3 The use of the TET ON system is novel, and clearly shows increased NLRP3 expression and dimerization as well as ASC solublilty changes when induced and with temperature but I don't understand why it proves that the tag isn't responsible for the aggregate formation. We do apologize for our insufficient explanation. We developed and used the cells expressing full length NLRP3 without any tags or fluorescent proteins under the TRE promoter in these experiments. The induction of mutated NLRP3 promoted ASC oligomerization and ASC speck formation (Figure 3D, E, and G). Furthermore, to investigate the aggregation of mutated NLRP3 without being affected by fluorescent tag, we developed the ASC-KO /TRE-NLRP3-L353P- and ASC-KO /TRE-NLRP3-D303N-THP-1 cells. The mutated NLRP3 proteins were detected in the detergent-insoluble fraction in the absence of ASC, supporting that mutated NLRP3 forms aggregates (Figure 3—figure supplement 1D). We have added the data and mentioned these issues in the revised manuscript (page 6, paragraph 1). I found the reduction of cold induced IL-1B release with extrinsic stimulation of WT cells to be interesting. This should be emphasized as more evidence of mutation specific effects. According to the suggestion, we have emphasized and discussed this issue in the revised manuscript (page 11, paragraph 1). This figure might actually help the authors in that the cold induction of IL-1B expression and release in the CINCA transfected cells is much more modest than in the FCAS transfected cells. Its possible that CINCA patient do have cold induction but don't notice it since their baseline inflammation is so high and there is so little change with cold. Thank you for your comment. As the reviewer mentioned, we postulate that CINCA-associated NLRP3 mutants exhibit cryo-sensitivity, but this feature is masked by its potent ability to form aggregates. Indeed, other CINCA-associated D303N and Y570C mutants exhibited a potent ability to form aggregates even at 37ºC (Figure 1I). We have discussed this issue in the revised manuscript (page 11, paragraph 1). Do foci number correlate well with IL-1B release? We are sorry for our confusing data. Because the number of foci was analyzed in the cells lacking ASC, these cells are defective in mutated NLRP3-mediated IL-1β release. We consider that further refined experimental designs are needed to evaluate the capability of IL-1β release in each NLRP3 mutant. It might be useful to see if the CINCA mutation has some K and NEK7 dependence. Thank you for your suggestion. We have moved the NEK7 data to main figure (Figure 4A and B). In addition, we have investigated the NEK7-dependency in the CINCA mutant and found that D303N mutant also induced IL-1β release in the absence of NEK7 (Figure 4—figure supplement 1D and E). We have added these data and mentioned these results in the revised manuscript (page 7, paragraph 1). Are results the same for CINCA mutations. Thank you for your helpful comment. According to the suggestion, we investigated ca2+ influx induced by CAPS-associated D303N mutant. Similar to the FCAS mutant, induction of the D303N mutant induced ca2+ influx (Figure 6—figure supplement 1A and B). 6D Interesting that casp 1 inhibition affects ASC solubility. Sorry for the lack of explanation. We investigated the effect of pharmacological inhibition of caspase-1 on ca2+ influx induced by NLRP3-L353P mutant using fluo-8. The number of fluo-8-positive cells was decreased under the caspase-1 inhibition. In the revised manuscript, we further validated the involvement of caspase-1 using CASP1-deficient cells (Figure 7G). MCC950 data could be moved from Supplemental to main. According to the suggestion, we have moved the data on MCC950 to main figure. (Figure 8I and J). Are results the same for CINCA mutations. Thank you for your helpful comment. According to the suggestion, we have added data on CINCA-associated D303N mutant (Figure 7—figure supplement 1C). The pharmacological inhibition of caspase-1 prevented IL-1β release induced by D303N mutant. However, while pannexin 1 inhibition prevented IL-1β release induced by L353P mutant, the pannexin 1 inhibition failed to prevent IL-1β release induced by D303N mutant (Figure 8A–H and Figure 8—figure supplement 1G). These results suggest that CINCA-associated mutant exhibits constitutive active properties. Thus, feed-forward regulation mediated by ca2+ influx promotes inflammasome assembly only in FCAS-associated NLRP3 mutant. We have discussed this issue in the revised manuscript (page 12, paragraph 2).
Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)LentiX293TTakara BioZ2180N
Cell line (H. sapiens)HeLaGift from Dr. Kenji TagoN/A
Cell line (H. sapiens)EF1-NLRP3-WT-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-L353P-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-D303N-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-Y563N-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-Y570C-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-L353P-linker-mutant-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-D303N-linker-mutant--mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-mNeonGreen-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-ASC-GFP-HeLaThis manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)THP-1ATCCTIB-202
Cell line (H. sapiens)ASC KO THP-1 Aizawa et al., 2020 N/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-WT-mNeonGreen/ASC KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-L353P-mNeonGreen/ASC KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-NLRP3-D303N-mNeonGreen/ASC KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)TRE-NLRP3-WT-THP-1This manuscriptN/AProduced by lentiviral transduction and limiting dilution
Cell line (H. sapiens)TRE-NLRP3-L353P-THP-1This manuscriptN/AProduced by lentiviral transduction and limiting dilution
Cell line (H. sapiens)TRE-NLRP3-L353P/ASC KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)TRE-NLRP3-L353P/NEK7 KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)TRE-NLRP3-L353P/CASP1 KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)TRE-NLRP3-D303N-THP-1 Aizawa et al., 2020 N/AProduced by lentiviral transduction and limiting dilution
Cell line (H. sapiens)TRE-NLRP3-D303N/ASC KO THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-ASC-GFP/TRE-NLRP3-L353P-THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-ASC-BFP/TRE-NLRP3-L353P-THP-1This manuscriptN/AProduced by lentiviral transduction
Cell line (H. sapiens)EF1-ASC-BFP/TRE-NLRP3-WT-mNeonGreen-THP-1This manuscriptN/AProduced by lentiviral transduction
Sequence-based reagentsgRNA sequence for GFP Aizawa et al., 2020 N/AGAGCTGGACGGCGACGTAAA
Sequence-based reagentsgRNA sequence for apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) Aizawa et al., 2020 N/ACAGCACGTTAGCGGTGAGCT
Sequence-based reagentsgRNA sequence for NEK7#1This manuscriptN/AATTACAGAAGGCCTTACGAC
Sequence-based reagentsgRNA sequence for NEK7#2This manuscriptN/AATAGCCCATATCCGGTCGTA
Sequence-based reagentsgRNA sequence for CASP1 Aizawa et al., 2020 N/AAAGCTGTTTATCCGTTCCAT
Recombinant DNA reagentCSCAMCSRIKEN BRCRDB05963Lentiviral vector for stable gene expression
Recombinant DNA reagentCSIV-TRE-RfA-CMV-KTRIKEN BRCRDB12876Lentiviral vector for inducible gene expression
Recombinant DNA reagentLentiCRISPRv2Addgene#52,961Lentiviral vector expressing sgRNA
Transfected construct (H. sapiens)CSEF1-NLRP3-WT-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-NLRP3-L353P-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-NLRP3-D303N-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-NLRP3-Y563N-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-NLRP3-Y570C-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-NLRP3-L353P-linker-mutant-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-NLRP3-D303N-linker-mutant -mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-mNeonGreenThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-ASC-GFPThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSEF1-ASC-BFPThis manuscriptN/ALentiviral vector for stable gene expression
Transfected construct (H. sapiens)CSIV-TRE-NLRP3-WT-CMV-KTThis manuscriptN/ALentiviral vector for inducible gene expression
Transfected construct (H. sapiens)CSIV-TRE-NLRP3-L353P-CMV-KTThis manuscriptN/ALentiviral vector for inducible gene expression
Transfected construct (H. sapiens)CSIV-TRE-NLRP3-D303N-CMV-KT Aizawa et al., 2020 N/ALentiviral vector for inducible gene expression
Transfected construct (H. sapiens)CSIV-TRE-NLRP3-WT-mNeonGreen-CMV-KTThis manuscriptN/ALentiviral vector for inducible gene expression
Transfected construct (H. sapiens)CSIV-TRE-NLRP3-L353P-mNeonGreen -CMV-KTThis manuscriptN/ALentiviral vector for inducible gene expression
Transfected construct(H. sapiens)LentiCRISPRv2 sgGFP Aizawa et al., 2020 N/ALentiviral vector expressing sgRNA
 Transfected construct (H. sapiens)LentiCRISPRv2 sgASC Aizawa et al., 2020 N/ALentiviral vector expressing sgRNA
 Transfected construct (H. sapiens)LentiCRISPRv2 sgNEK7This manuscriptN/ALentiviral vector expressing sgRNA
 Transfected construct (H. sapiens)LentiCRISPRv2 sgCASP1 Aizawa et al., 2020 N/ALentiviral vector expressing sgRNA
AntibodyRabbit polyclonal anti-NEK7AbcamEPR4900WB (1:1000)
AntibodyMouse monoclonal anti-NLRP3AdipogenAG-20B-0014WB (1:2000)
AntibodyRabbit polyclonal anti-ASCAdipogenAG-25B-0006WB (1:2000)
AntibodyRabbit monoclonal anti-caspase-1 (D7F10)Cell Signaling Technology#3,866WB (1:1000)
AntibodyRabbit polyclonal anti-IL-1βSanta Cruzsc-7884WB (1:1000)
AntibodyMouse monoclonal anti-β-actinSigma-AldrichA5441WB (1:4000)
Commercial assay or kitLentiviral qPCR Titration KitApplied Biological Materials#LV900
Commercial assay or kitHuman IL-1 beta/IL-1F2 DuoSet ELISAR&D SystemsDY201
Commercial assay or kitSuper Script VILO cDNA Synthesis kitThermo Fisher Scientific
Chemical compound, drugMCC950AdipoGenAG-CR1-3615-M005
Chemical compound, drugDRAQ5Biolegend424,1011 µM
Chemical compound, drugProbenecidCayman14,981
Chemical compound, drugTrovafloxacin mesylateCayman9000303
Chemical compound, drug4',6-diamidino-2-phenylindole, dihydrochlorideDOJINDOD5231 µg/mL
Chemical compound, drugFura-2/AMDOJINDOF0153 µM
Chemical compound, drugHoechst33342DOJINDOH3421 µg/mL
Chemical compound, drugPEI MAXPolyscience24765–1
Chemical compound, drugVX-765SelleckS2228
Chemical compound, drugPluronic F127Sigma-AldrichP24430.04%
Chemical compound, drugPuromycinSigma-AldrichP88332 µg/mL
Chemical compound, drugFluo-8Santa CruzSc-3625624 µM
Chemical compound, drugBis(sulfosuccinimidyl)suberateThermo Fisher Scientific21,5802 mM
Chemical compound, drugSYTOX Deep RedThermo Fisher ScientificS11380100 nM
Chemical compound, drugDoxycycline Hydrochloride n-HydrateWako049–31121
Chemical compound, drugPhorbol 12-Myristate 13-AcetateWako162–23591200 nM
Software, algorithmGraphPad Prism 6Graph Pad SoftwareRRID:SCR_002798
Software, algorithmImageJ/FIJI (2.1.0/1.53 c) Schindelin et al., 2012 RRID:SCR_002285
Software, algorithmIUpred2A Mészáros et al., 2018 RRID:SCR_014632
Software, algorithmR version 4.0.2R projectRRID:SCR_001905
  41 in total

1.  ASC, a novel 22-kDa protein, aggregates during apoptosis of human promyelocytic leukemia HL-60 cells.

Authors:  J Masumoto; S Taniguchi; K Ayukawa; H Sarvotham; T Kishino; N Niikawa; E Hidaka; T Katsuyama; T Higuchi; J Sagara
Journal:  J Biol Chem       Date:  1999-11-26       Impact factor: 5.157

2.  K⁺ efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter.

Authors:  Raúl Muñoz-Planillo; Peter Kuffa; Giovanny Martínez-Colón; Brenna L Smith; Thekkelnaycke M Rajendiran; Gabriel Núñez
Journal:  Immunity       Date:  2013-06-27       Impact factor: 31.745

3.  Unified polymerization mechanism for the assembly of ASC-dependent inflammasomes.

Authors:  Alvin Lu; Venkat Giri Magupalli; Jianbin Ruan; Qian Yin; Maninjay K Atianand; Matthijn R Vos; Gunnar F Schröder; Katherine A Fitzgerald; Hao Wu; Edward H Egelman
Journal:  Cell       Date:  2014-03-13       Impact factor: 41.582

4.  Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome.

Authors:  H M Hoffman; J L Mueller; D H Broide; A A Wanderer; R D Kolodner
Journal:  Nat Genet       Date:  2001-11       Impact factor: 38.330

5.  NLRP3 cages revealed by full-length mouse NLRP3 structure control pathway activation.

Authors:  Liudmila Andreeva; Liron David; Shaun Rawson; Chen Shen; Teerithveen Pasricha; Pablo Pelegrin; Hao Wu
Journal:  Cell       Date:  2021-12-02       Impact factor: 41.582

6.  NLRP3 inflammasomes are required for atherogenesis and activated by cholesterol crystals.

Authors:  Peter Duewell; Hajime Kono; Katey J Rayner; Cherilyn M Sirois; Gregory Vladimer; Franz G Bauernfeind; George S Abela; Luigi Franchi; Gabriel Nuñez; Max Schnurr; Terje Espevik; Egil Lien; Katherine A Fitzgerald; Kenneth L Rock; Kathryn J Moore; Samuel D Wright; Veit Hornung; Eicke Latz
Journal:  Nature       Date:  2010-04-29       Impact factor: 49.962

7.  Cryopyrin/NALP3 binds ATP/dATP, is an ATPase, and requires ATP binding to mediate inflammatory signaling.

Authors:  Joseph A Duncan; Daniel T Bergstralh; Yanhong Wang; Stephen B Willingham; Zhengmao Ye; Albert G Zimmermann; Jenny Pan-Yun Ting
Journal:  Proc Natl Acad Sci U S A       Date:  2007-05-02       Impact factor: 11.205

Review 8.  Considerations and Challenges in Studying Liquid-Liquid Phase Separation and Biomolecular Condensates.

Authors:  Simon Alberti; Amy Gladfelter; Tanja Mittag
Journal:  Cell       Date:  2019-01-24       Impact factor: 41.582

9.  Single-cell analysis of pyroptosis dynamics reveals conserved GSDMD-mediated subcellular events that precede plasma membrane rupture.

Authors:  Nathalia M de Vasconcelos; Nina Van Opdenbosch; Hanne Van Gorp; Eef Parthoens; Mohamed Lamkanfi
Journal:  Cell Death Differ       Date:  2018-04-17       Impact factor: 15.828

10.  A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases.

Authors:  Rebecca C Coll; Avril A B Robertson; Jae Jin Chae; Sarah C Higgins; Raúl Muñoz-Planillo; Marco C Inserra; Irina Vetter; Lara S Dungan; Brian G Monks; Andrea Stutz; Daniel E Croker; Mark S Butler; Moritz Haneklaus; Caroline E Sutton; Gabriel Núñez; Eicke Latz; Daniel L Kastner; Kingston H G Mills; Seth L Masters; Kate Schroder; Matthew A Cooper; Luke A J O'Neill
Journal:  Nat Med       Date:  2015-02-16       Impact factor: 53.440

View more
  1 in total

Review 1.  Activation and Pharmacological Regulation of Inflammasomes.

Authors:  Chen Chen; Pinglong Xu
Journal:  Biomolecules       Date:  2022-07-20
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.