Literature DB >> 35609334

Circular RNA_0001187 participates in the regulation of ulcerative colitis development via upregulating myeloid differentiation factor 88.

Wei Ouyang1, Min Wu2, Anshan Wu1, Heng Xiao3.   

Abstract

Circular RNA (circRNA) had been confirmed to participate in ulcerative colitis (UC) development. Circular RNA_0001187 (Circ_0001187) had been found to be overexpressed in patients with Crohn disease. Therefore, circ_0001187 might be an important circRNA regulating intestinal inflammatory diseases. However, the role and mechanism of circ_0001187 in UC progression remains unclear. The colonic mucosal tissues were obtained from 23 UC patients and 23 healthy normal controls. Tumor necrosis factor-α (TNF-α) was used to mimic UC cell model in vitro. Cell function was assessed by cell counting kit 8 assay, EdU assay, flow cytometry, ELISA assay and oxidative stress detection. RNA interaction was confirmed by dual-luciferase reporter assay and RIP assay. Serum exosomes were isolated by ultracentrifugation and identified by transmission electron microscope. Circ_0001187 was overexpressed in UC patients. Circ_0001187 knockdown enhanced the proliferation, while suppressed apoptosis, inflammation and oxidative stress of TNF-α-induced FHC cells. Circ_0001187 acted as miR-1236-3p sponge, and the effects of circ_0001187 downregulation on TNF-α-induced FHC cell injury were overturned by miR-1236-3p inhibitor. MYD88 was targeted by miR-1236-3p, and circ_0001187 sponged miR-1236-3p to regulate MYD88. MYD88 knockdown alleviated TNF-α-induced FHC cell injury, and its upregulation revoked the inhibition effect of miR-1236-3p on TNF-α-induced FHC cell injury. High expression of circ_0001187 also was observed in the serum exosomes of UC patients. Our data confirmed that circ_0001187 facilitated UC progression through miR-1236-3p/MYD88 axis, which might be a potential treatment and diagnosis biomarker for UC.

Entities:  

Keywords:  MYD88; Ulcerative colitis; circ_0001187; miR-1236-3p

Mesh:

Substances:

Year:  2022        PMID: 35609334      PMCID: PMC9275921          DOI: 10.1080/21655979.2022.2077572

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

Circ_0001187 knockdown alleviates TNF-α-induced FHC cell injury. Circ_0001187 acts as miR-1236-3p sponge. MiR-1236-3p targets MYD88. Circ_0001187 exists in the serum exosomes of UC patients.

Introduction

Ulcerative colitis (UC) is a chronic idiopathic inflammatory disease that mainly involves the rectum, colonic mucosa and submucosa [1,2]. Patients are characterized by abdominal pain, diarrhea, and bloody stools, and complications such as toxic megacolon and intestinal perforation can also occur when the condition is severe [3,4]. Even with great efforts, the prognosis of patients is still poor due to the difficulty in the treatment of UC and the prone to relapse [5,6]. It is important to clarify the molecular mechanisms that influence intestinal mucosal inflammatory injury to develop potential therapeutic targets for UC. At present, tumor necrosis factor-α (TNF-α)-induced colon cells has been widely used in the study of UC in vitro [7-9]. Circular RNA (circRNA), a special non-coding RNA (ncRNA) with circular structure, is highly stable in organisms [10]. CircRNA had been confirmed to act as ceRNA for microRNA (miRNA), thereby indirectly regulating downstream targets [11-13]. Studies have reported that circRNA mediates the development of human diseases [14,15]. In UC-related research, circHECTD1 was found to be downregulated in UC patients, and it could inhibit LPS-induced colonic cell inflammation injury [16]. Also, circ_0007919 was upregulated in UC patients, and it might be a therapeutic target for UC [17]. CircAtp9b had been shown to be overexpressed in UC patients, which might contribute to UC progression by enhancing colonic epithelial cell apoptosis [18]. MiR-1236-3p was overexpressed in TNBS-induced UC mice models and TNF-α-induced colon cells, and its overexpression could alleviate UC progression by inhibiting colon cell inflammation response [19]. Myeloid differentiation factor 88 (MYD88) is a key connector molecule in the Toll-like receptor signaling pathway which is involved in cellular immune responses [20]. In UC-related research, MYD88 was found to be overexpressed in UC mice models, and its silencing could reduce the expression of inflammatory factors [21,22]. One study showed that circRNA_103124 (alias: circ_0001187) was a remarkably overexpressed circRNA in the peripheral blood mononuclear cells of patients with Crohn disease [23]. Therefore, we speculated that circ_0001187 might be an important circRNA regulating intestinal inflammatory diseases. In pre-experiment, we detected significantly higher expression of circ_0001187 in the colonic mucosal tissues of UC patients, but its role in the progression of UC remains unclear. Our study aimed to investigate the role and mechanism of circ_0001187 in UC process. Here, we explored circ_0001187 roles in UC progression through measuring its effect on TNF-α-induced colon cell inflammatory injury, including proliferation (using cell counting kit 8 assay and EdU assay), apoptosis (using flow cytometry), inflammation (using ELISA assay) and oxidative stress (detecting MDA level and SOD activity). In addition, we found that circ_0001187 could sponge miR-1236-3p, and miR-1236-3p could target MYD88. Therefore, we proposed and verified the hypothesis of circ_0001187/miR-1236-3p/MYD88 axis. Our study hopes to provide a potential target for the treatment of UC.

Methods

Samples collection

23 UC patients and 23 healthy normal controls who underwent screening colonoscopies were admitted at Zhuzhou Hospital Affiliated to Xiangya School of Medicine, Central South University, and all participants signed written informed consent. Inclusion criteria were based on clinical and histological diagnosis of UC with endoscopically active inflammation, excluding bacterial dysentery and infectious colitis. Healthy normal controls included patients who had no colonic inflammation or adenomas. The colonic mucosal tissues (pinch biopsies) were obtained from the sigmoid colon of all participants and stored at −80°C for future use. The blood samples were collected for exosome isolation. This study was approved by the Ethics Committee of the Zhuzhou Hospital Affiliated to Xiangya School of Medicine, Central South University.

Cell culture, TNF-α treatment and transfection

Human normal colorectal mucosa cells (FHC) (ATCC, Manassas, VA, USA) were cultured in DMEM/F12 medium containing 10% FBS, 20 ng/mL EGF, 100 ng/ml hydrocortisone, 0.005 mg/ml transferrin, 0.005 mg/ml insulin, 10 ng/ml cholera toxin, 10 mM HEPES, and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA) at 37°C with 5% CO2. FHC cells were hatched with different concentrations of TNF-α for 12 h to detect targeted gene and protein expression. In cell transfection, FHC cells were transfected with circ_0001187 small interfering RNA (si-circ_0001187) or pCD5 overexpression vector, miR-1236-3p mimic or inhibitor (anti-miR-1236-3p), MYD88 siRNA (si-MYD88) or pcDNA overexpression vector, as well as negative controls (all from RibiBio, Guangzhou, China) using Lipofectamine 3000 (Invitrogen). 24 h post transfection, cells were treated with 10 ng/mL TNF-α for 12 h as previously described [8].

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated by TRIzol reagent (Invitrogen), and then RNA (1 μg) was reverse-transcribed into cDNA by First-Strand Synthesis System (Invitrogen). PCR was performed by SYBR Green (Takara, Tokyo, Japan) in PCR system. The PCR cycling was as follows: 95°C for 30 sec; followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec; and 1 cycle of 95°C for 5 sec, 60°C for 60 sec; lastly 1 cycle of 50°C for 30 sec. Data were analyzed by 2−ΔΔCt method with GAPDH or U6 as internal control. Primer sequences were listed in Table 1. Additionally, RNA extracted from FHC cells was treated with RNase R followed by performed qRT-PCR.
Table 1.

Primer sequences used for qRT-PCR

Name Primers (5’-3’)
circ_0001187ForwardCAAAAGAGACCTGTCGATCTCC
ReverseTGGCTTGTTCCAAAAGACAAA
miR-1236-3pMYD88ForwardGCCGAGCCTCTTCCCCTTGTCT
ReverseForwardReverseATCCAGTGCAGGGTCCGAGGCCTCTAGAACAACCCAGCCACTGCACAAACTGGATGTCGC
GAPDHForwardCTCTGCTCCTCCTGTTCGAC
ReverseCGACCAAATCCGTTGACTCC
U6ForwardCTCGCTTCGGCAGCACA
ReverseAACGCTTCACGAATTTGCGT
Primer sequences used for qRT-PCR

Cell counting kit 8 (CCK8) assay

After transfection and treatment, FHC cells were harvested and reseeded in 96-well plates. 48 h later, cells were treated with CCK8 reagent (Dojindo, Kumamoto, Japan). Cell viability at 450 nm was analyzed using a microplate reader as previously described [24].

EdU assay

Edu positive cell rate was determined by EdU Apollo567 In Vitro Imaging Kit (RiboBio) to assess the proliferation of FHC cells. Briefly, transfected and treated FHC cells were re-seeded into 24-well plates and then stained by EdU solution, Apollo567 solution and DAPI solution. Cell images were then captured under a fluorescence microscope to analyze the EdU positive cell rate as previously described [8].

Flow cytometry

FHC cells were harvested and re-suspended in binding buffer followed by staining with Annexin V-FITC and PI solution (Beyotime, Shanghai, China) for 15 min [25]. Cell apoptosis rate was detected using FACSCalibur flow cytometer and CellQuest software.

Western blot (WB) analysis

According to the previous report [26], total protein was extracted with RIPA lysis buffer (Beyotime). After quantification, equal protein (30 μg) was loaded on 10% SDS-PAGE gel and transferred onto PVDF membranes. Membrane was probed by primary antibody (Abcam, Cambridge, CA, USA) at 4°C overnight, including anti-Bcl-2 (ab32124, 1:1,000), anti-Bax (ab32503, 1:2,000), anti-MYD88 (ab2064, 1:1,000), anti-GAPDH (ab9485, 1:2,500), and then hatched with secondary antibody (Goat anti-rabbit IgG, ab205718, 1:50,000) for 1 h. Protein signals were detected by ECL reagent (Millipore, Billerica, MA, USA), and band gray was analyzed by ImageJ software.

ELISA assay

The concentrations of IL-6 and IL-1β in cell supernatant were analyzed by Human IL-6 and IL-1β ELISA Kits (Abcam) in accordance with manufacturer’s protocols.

Cell oxidative stress assay

After FHC cells were transfected and treated, the cell supernatants were collected. MDA level and SOD activity were analyzed by MDA Assay Kit and SOD Assay Kit (Solarbio, Beijing, China) following the kit instructions.

Dual-luciferase reporter assay

The wild-type and mutant-type of circ_0001187 (WT/MUT-circ_0001187) or MYD88 3ʹUTR (WT/MUT-MYD88 3ʹUTR) vectors were generated by inserting their sequences into psiCHECK-2 vectors. After transfected with the vectors and miR-1236-3p mimic/miR-NC into 293 T cells (ATCC) for 48 h, luciferase activity was analyzed using Dual-Lucy Assay Kit (Solarbio).

RIP assay

As previously described [27], FHC cells were harvested and lysed by RIP buffer (Millipore). Cell lysates were treated with magnetic beads-conjugated with Ago2 antibody or IgG antibody. Then, the immunoprecipitated RNA was collected for qRT-PCR to examine circ_0001187, miR-1236-3p and MYD88 enrichments.

Exosome isolation and identification

The exosomes from the serum of UC patients and healthy normal controls were collected by ultracentrifugation (300 ×g for 10 min, 2000 ×g for 10 min, 10000 ×g for 30 min, 100000 ×g for 70 min). Exosomes were identified by transmission electron microscope (TEM). Additionally, exosome protein markers (CD9 and CD63) were identified by WB analysis using anti-CD9 (ab236630, 1:1,000) and anti-CD63 (ab134045, 1:1,000).

Statistical analysis

Data were represented as mean ± SD and each experiment was performed in triplicate. Comparisons were analyzed by Student’s t-test and ANOVA using GraphPad Prism 7.0 software. P< 0.05 were considered statistically significant.

Results

Our study explored the role and molecular mechanism of circ_0001187 in UC progression. Here, we discovered that circ_0001187 knockdown relieved TNF-α-stimulated FHC cell injury through the regulating of miR-1236-3p/MYD88 axis. This research provided a potential target for treating UC.

Knockdown of circ_0001187 alleviated TNF-α-stimulated FHC cell injury

We found that circ_0001187 expression was elevated in the colonic mucosal tissues of UC patients (Figure 1(a)), and was increased gradually with the increase of TNF-α concentration in FHC cells stimulated by TNF-α (Figure 1(b)). Circ_0001187 could resist the digestion of RNase R (Figure 1(c)), confirmed that circ_0001187 had circular structures. To confirm the role of circ_0001187 in UC progression, we explored the effect of circ_0001187 on TNF-α-stimulated FHC cell injury. As shown in Figure 1(d), the transfection of si-circ_0001187 decreased circ_0001187 expression promoted by TNF-α treatment in FHC cells. Function experiments suggested that TNF-α treatment inhibited cell viability and EdU positive cell rate, while circ_0001187 knockdown reversed this effect (Figure 1(e,f)). After TNF-α treatment, FHC cell apoptosis rate and Bax protein expression were increased, while Bcl-2 protein expression was decreased. However, silenced circ_0001187 also suppressed TNF-α-induced FHC cell apoptosis (Figure 1(g-i)). Also, TNF-α treatment promoted inflammation factors (IL-6 and IL-1β) concentrations, increased MDA level and restrained SOD activity in FHC cells, while these effects were abolished by silencing circ_0001187 (Figure 1(j-l)). All data revealed that circ_0001187 knockdown relieved TNF-α-induced FHC cell injury, confirming that circ_0001187 might promote UC progression.
Figure 1.

Effects of si-circ_0001187 on TNF-α-stimulated FHC cell injury. (a) The circ_0001187 expression in the colonic mucosal tissues of UC patients and healthy normal controls was measured by qRT-PCR. (b) The circ_0001187 expression was detected by qRT-PCR in FHC cells treated with TNF-α. (c) RNase R assay was used to assess the resistance of circ_0001187 on RNase R digestion. (d-l) FHC cells were transfected with si-NC or si-circ_0001187 followed by treated with TNF-α. (d) The circ_0001187 expression was determined by qRT-PCR. CCK8 assay (e), EdU assay (f) and flow cytometry (g) were used to assess cell proliferation and apoptosis. (h-i) Protein expression was detected by WB analysis. (j) ELISA assay was performed to measure the concentrations of IL-6 and IL-1β. (k-l) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Effects of si-circ_0001187 on TNF-α-stimulated FHC cell injury. (a) The circ_0001187 expression in the colonic mucosal tissues of UC patients and healthy normal controls was measured by qRT-PCR. (b) The circ_0001187 expression was detected by qRT-PCR in FHC cells treated with TNF-α. (c) RNase R assay was used to assess the resistance of circ_0001187 on RNase R digestion. (d-l) FHC cells were transfected with si-NC or si-circ_0001187 followed by treated with TNF-α. (d) The circ_0001187 expression was determined by qRT-PCR. CCK8 assay (e), EdU assay (f) and flow cytometry (g) were used to assess cell proliferation and apoptosis. (h-i) Protein expression was detected by WB analysis. (j) ELISA assay was performed to measure the concentrations of IL-6 and IL-1β. (k-l) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Circ_0001187 sponged miR-1236-3p

Circinteractome software predicted that miR-1236-3p could bind with circ_0001187 (Figure 2(a)). We discovered that miR-1236-3p mimic only decreased the luciferase activity of WT-circ_0001187 vector (Figure 2(b)), and miR-1236-3p and circ_0001187 had enriched expression in Ago2 (Figure 2(c)). In the colonic mucosal tissues of UC patients, miR-1236-3p expression was decreased and was negatively correlated with circ_0001187 expression (Figure 2(d,e)). Also, miR-1236-3p expression was decreased with the increase of TNF-α concentration (Figure 2(f)). Circ_0001187 expression was markedly enhanced by the transfected with pCD5 circ_0001187 overexpression vector (Figure 2(g)). Circ_0001187 knockdown promoted miR-1236-3p expression in TNF-α-induced FHC cells, and its overexpression had an opposite effect (Figure 2(h)).
Figure 2.

Circ_0001187 sponged miR-1236-3p. (a) The binding sites between circ_0001187 and miR-1236-3p were shown. Dual-luciferase reporter assay (b) and RIP assay (c) were used to assess RNA interaction. (d) MiR-1236-3p expression was measured by qRT-PCR in the colonic mucosal tissues of UC patients and healthy normal controls. (e) Pearson correlation analysis was used to assess linear correlation. (f) The miR-1236-3p expression in FHC cells treated with TNF-α was detected by qRT-PCR. (g) The circ_0001187 expression was examined by qRT-PCR in TNF-α-treated FHC cells transfected with circ_0001187 overexpression vector. (h) The miR-1236-3p expression was detected by qRT-PCR. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Circ_0001187 sponged miR-1236-3p. (a) The binding sites between circ_0001187 and miR-1236-3p were shown. Dual-luciferase reporter assay (b) and RIP assay (c) were used to assess RNA interaction. (d) MiR-1236-3p expression was measured by qRT-PCR in the colonic mucosal tissues of UC patients and healthy normal controls. (e) Pearson correlation analysis was used to assess linear correlation. (f) The miR-1236-3p expression in FHC cells treated with TNF-α was detected by qRT-PCR. (g) The circ_0001187 expression was examined by qRT-PCR in TNF-α-treated FHC cells transfected with circ_0001187 overexpression vector. (h) The miR-1236-3p expression was detected by qRT-PCR. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Circ_0001187 regulated TNF-α-stimulated FHC cell injury via targeting miR-1236-3p

To explore whether circ_0001187 sponged miR-1236-3p to regulate TNF-α-stimulated FHC cell injury, the rescue experiments were performed. The addition of anti-miR-1236-3p decreased miR-1236-3p expression promoted by si-circ_0001187 in TNF-α-treated FHC cells (Figure 3(a)). The enhancing effects of circ_0001187 knockdown on cell viability and EdU positive cell rate in TNF-α-treated FHC cells were revoked (Figure 3(b,c)). The decreasing of si-circ_0001187 on apoptosis rate and Bax expression, and the increasing on Bcl-2 expression in TNF-α-treated FHC cells were reversed by anti-miR-1236-3p (Figure 3(d-g)). Additionally, anti-miR-1236-3p also overturned the regulation of si-circ_0001187 on TNF-α-induced FHC cell inflammation and oxidative stress, showing that the inflammatory factor concentrations were increased, SOD activity was decreased, and MDA level was promoted in the co-transfection group (Figure 3(h-j)).
Figure 3.

Effects of si-circ_0001187 and anti-miR-1236-3p on TNF-α-stimulated FHC cell injury. (a) The miR-1236-3p expression was detected by qRT-PCR. Cell proliferation and apoptosis were determined by CCK8 assay (b), EdU assay (c) and flow cytometry (d-e). (f-g) WB analysis was used to assess protein expression. (h) The concentrations of IL-6 and IL-1β were evaluated by ELISA assay. (i-j) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Effects of si-circ_0001187 and anti-miR-1236-3p on TNF-α-stimulated FHC cell injury. (a) The miR-1236-3p expression was detected by qRT-PCR. Cell proliferation and apoptosis were determined by CCK8 assay (b), EdU assay (c) and flow cytometry (d-e). (f-g) WB analysis was used to assess protein expression. (h) The concentrations of IL-6 and IL-1β were evaluated by ELISA assay. (i-j) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

MiR-1236-3p directly interacted with MYD88

Through the Targetscan software, we discovered that miR-1236-3p could bind to the 3ʹUTR of MYD88 (Figure 4(a)). The luciferase activity of WT-MYD88 3ʹUTR vector could be inhibited by miR-1236-3p mimic (Figure 4(b)), and the enrichments of miR-1236-3p and MYD88 were increased in Ago2 (Figure 4(c)). In the colonic mucosal tissues of UC patients, we found that MYD88 mRNA expression was markedly upregulated and was negatively correlated with miR-1236-3p expression (Figure 4(d,e)). Also, we noted that the protein level of MYD88 was upregulated in UC patients and was increased with TNF-α concentration in TNF-α-induced FHC cells (Figure 4(f,g)). After confirmed that anti-miR-1236-3p indeed repressed miR-1236-3p expression and miR-1236-3p mimic could enhance miR-1236-3p expression in TNF-α-induced FHC cells (Figure 4(h)), we measured MYD88 protein level. The data suggested that anti-miR-1236-3p promoted MYD88 protein level, while miR-1236-3p suppressed MYD88 protein expression in TNF-α-induced FHC cells (Figure 4(i)).
Figure 4.

MiR-1236-3p directly interacted with MYD88. (a) The binding sites between miR-1236-3p and MYD88 3ʹUTR were shown. RNA interaction was evaluated by dual-luciferase reporter assay (b) and RIP assay (c). (d) The MYD88 mRNA expression was examined by qRT-PCR in the colonic mucosal tissues of UC patients and healthy normal controls. (e) Linear correlation was analyzed by Pearson correlation analysis. (f) The MYD88 protein expression in the colonic mucosal tissues of UC patients and healthy normal controls was detected by WB analysis. (g) The MYD88 protein expression in FHC cells treated with different concentrations of TNF-α was tested by WB analysis. (h) The miR-1236-3p expression was examined by qRT-PCR in TNF-α-treated FHC cells transfected with anti-miR-1236-3p or miR-1236-3p mimic. (i) The MYD88 protein expression was detected by WB analysis in TNF-α-treated FHC cells transfected with anti-miR-1236-3p or miR-1236-3p mimic. **P < 0.01, ***P < 0.001, ****P < 0.0001.

MiR-1236-3p directly interacted with MYD88. (a) The binding sites between miR-1236-3p and MYD88 3ʹUTR were shown. RNA interaction was evaluated by dual-luciferase reporter assay (b) and RIP assay (c). (d) The MYD88 mRNA expression was examined by qRT-PCR in the colonic mucosal tissues of UC patients and healthy normal controls. (e) Linear correlation was analyzed by Pearson correlation analysis. (f) The MYD88 protein expression in the colonic mucosal tissues of UC patients and healthy normal controls was detected by WB analysis. (g) The MYD88 protein expression in FHC cells treated with different concentrations of TNF-α was tested by WB analysis. (h) The miR-1236-3p expression was examined by qRT-PCR in TNF-α-treated FHC cells transfected with anti-miR-1236-3p or miR-1236-3p mimic. (i) The MYD88 protein expression was detected by WB analysis in TNF-α-treated FHC cells transfected with anti-miR-1236-3p or miR-1236-3p mimic. **P < 0.01, ***P < 0.001, ****P < 0.0001.

Interference of MYD88 relieved TNF-α-induced FHC cell injury

Then, the role of MYD88 in UC progression was confirmed. The transfection of si-MYD88 could reduce MYD88 protein expression in TNF-α-induced FHC cells (Figure 5(a)). Our data revealed that silencing of MYD88 accelerated cell viability, EdU positive cell rate and Bcl-2 protein expression, while suppressed apoptosis rate and Bax protein expression in TNF-α-induced FHC cells (Figure 5(b-f)). Also, MYD88 knockdown inhibited IL-6 and IL-1β concentrations, decreased MDA level and enhanced SOD activity in TNF-α-induced FHC cells (Figure 5(g-i)). The above data showed that MYD88 contributed to TNF-α-induced FHC cell injury, confirming that it might facilitate UC progression.
Figure 5.

Effects of si-MYD88 on TNF-α-induced FHC cell injury. (a) The MYD88 protein expression was detected by WB analysis. CCK8 assay (b), EdU assay (c) and flow cytometry (d-e) were performed to measure cell proliferation and apoptosis. (f) Protein expression was tested by WB analysis. (g) The concentrations of IL-6 and IL-1β were analyzed by ELISA assay. (h-i) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Effects of si-MYD88 on TNF-α-induced FHC cell injury. (a) The MYD88 protein expression was detected by WB analysis. CCK8 assay (b), EdU assay (c) and flow cytometry (d-e) were performed to measure cell proliferation and apoptosis. (f) Protein expression was tested by WB analysis. (g) The concentrations of IL-6 and IL-1β were analyzed by ELISA assay. (h-i) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

MiR-1236-3p targeted MYD88 to alleviate TNF-α-induced FHC cell injury

The rescue experiments were performed in TNF-α-induced FHC cells transfected with miR-1236-3p mimic and MYD88 vector. The decreasing effect of miR-1236-3p on MYD88 protein level could be promoted by MYD88 vector (Figure 6(a)). The promotion effect of miR-1236-3p mimic on cell viability and EdU positive cell rate in TNF-α-induced FHC cells were reversed by MYD88 overexpression (Figure 6(b,c)). MiR-1236-3p mimic inhibited apoptosis rate, decreased Bax protein expression and promoted Bcl-2 protein expression, while these effects were overturned by overexpressing MYD88 (Figure 6(d-g)). Also, upregulation of miR-1236-3p suppressed IL-6 and IL-1β concentrations, increased SOD activity and restrained MDA level in TNF-α-induced FHC cells, while MYD88 overexpression revoked these effects (Figure 6(h-j)). The above data confirmed that miR-1236-3p repressed UC progression via targeting MYD88.
Figure 6.

Effects of miR-1236-3p and MYD88 on TNF-α-induced FHC cell injury. (a) The MYD88 protein expression was examined by WB analysis. Cell proliferation and apoptosis were analyzed by CCK8 assay (b), EdU assay (c) and flow cytometry (d-e). (f-g) Protein expression was detected by WB analysis. (h) ELISA assay was used to determine the concentrations of IL-6 and IL-1β. (i-j) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Effects of miR-1236-3p and MYD88 on TNF-α-induced FHC cell injury. (a) The MYD88 protein expression was examined by WB analysis. Cell proliferation and apoptosis were analyzed by CCK8 assay (b), EdU assay (c) and flow cytometry (d-e). (f-g) Protein expression was detected by WB analysis. (h) ELISA assay was used to determine the concentrations of IL-6 and IL-1β. (i-j) Cell oxidative stress was analyzed. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Circ_0001187 targeted miR-1236-3p to regulate MYD88

Our data suggested that circ_0001187 sponged miR-1236-3p, which could target MYD88. To investigate the regulation of circ_0001187 on MYD88, MYD88 protein level was examined in TNF-α-induced FHC cells transfected with si-circ_0001187 and anti-miR-1236-3p. MYD88 mRNA and protein expression levels were significantly reduced by circ_0001187 knockdown in TNF-α-induced FHC cells, while these effects were abolished by anti-miR-1236-3p (Figure 7(a,b)). The results revealed that circ_0001187 regulated MYD88 through miR-1236-3p.
Figure 7.

Circ_0001187 sponged miR-1236-3p to regulate MYD88. FHC cells were transfected with si-circ_0001187 and anti-miR-1236-3p followed by treated with TNF-α. The MYD88 mRNA and protein expression was determined by qRT-PCR (a) and WB analysis (b). **P < 0.01, ***P < 0.001, ****P < 0.0001.

Circ_0001187 sponged miR-1236-3p to regulate MYD88. FHC cells were transfected with si-circ_0001187 and anti-miR-1236-3p followed by treated with TNF-α. The MYD88 mRNA and protein expression was determined by qRT-PCR (a) and WB analysis (b). **P < 0.01, ***P < 0.001, ****P < 0.0001.

Exosomes mediated the transmission of circ_0001187

We isolated exosomes from the serum of UC patients and healthy normal controls and observed the ultrastructure of exosomes under TEM (Figure 8(a)). We also used WB analysis to observe the high expression of exosome marker proteins CD9 and CD63 in the extracted exosomes (Figure 8(b)). Through analysis, we determined that circ_0001187 expression in the serum exosomes of UC patients was significantly higher than in healthy normal controls (Figure 8(c)). These data showed that circ_0001187 existed in serum exosomes of UC patients.
Figure 8.

Exosomes mediated the transmission of circ_0001187. (a) The ultrastructure of exosomes derived from the serum of healthy normal controls and UC patients was observed under TEM. (b) The protein expression of CD9 and CD63 was detected by WB analysis. (c) The circ_0001187 expression in serum exosome from UC patients and healthy normal controls was determined by qRT-PCR. **P < 0.01, ****P < 0.0001.

Exosomes mediated the transmission of circ_0001187. (a) The ultrastructure of exosomes derived from the serum of healthy normal controls and UC patients was observed under TEM. (b) The protein expression of CD9 and CD63 was detected by WB analysis. (c) The circ_0001187 expression in serum exosome from UC patients and healthy normal controls was determined by qRT-PCR. **P < 0.01, ****P < 0.0001.

Discussion

It has been reported that ncRNA participates in UC occurrence through various mechanisms [28,29]. As a special ncRNA, circRNA has been confirmed to participate in regulating UC development [30,31]. Nevertheless, there are still many circRNAs whose functions have not been revealed. In a previous study, we selected circ_0001187, a circRNA that might play a vital role in intestinal inflammatory diseases [23], to explore its role in UC progression. Our results revealed that circ_0001187 had elevated expression in UC patients, and its knockdown restrained TNF-α-induced FHC cell injury. These results confirmed that circ_0001187 knockdown alleviated colon cell inflammation injury, suggesting that it might contribute to the progression of UC. More importantly, we confirmed that circ_0001187 was significantly overexpressed in serum exosomes of UC patients, showing that exosomal circ_0001187 could serve as UC diagnosis biomarker. In terms of mechanism, circ_0001187 was found to act as miR-1236-3p sponge. MiR-1236 had been shown to participate in regulating the progression of inflammatory lymphangiogenesis and osteoarthritis [32,33]. It was reported that miR-1236-3p played a tumor suppresser role in many cancer development, including colorectal cancer [34,35]. Consistent with the previously research [19], we confirmed that miR-1236-3p had a decreased expression in UC patients. Upregulation of miR-1236-3p suppressed TNF-α-induced injury in FHC cells, and its inhibitor also overturned the suppressing of si-circ_0001187 on TNF-α-induced FHC cell injury. These results confirmed that miR-1236-3p had a negative regulatory role in UC, and verified that circ_0001187 targeted miR-1236-3p to promote UC development. High expression of MYD88 promotes the inflammatory process, which in turn mediates the development of inflammatory disease [36,37]. Studies had suggested that MYD88 knockdown repressed LPS-induced inflammation in colorectal cancer cells [38]. Besides, long ncRNA ANRIL might accelerate LPS-induced FHC cell inflammation injury via increasing MYD88-mediated pathway [39]. In our data, we confirmed that MYD88 was upregulated in UC patients and its downregulation restrained TNF-α-induced FHC cell injury, which confirmed the pro-inflammation role of MYD88 in UC. Moreover, overexpressed MYD88 eliminated the inhibiting of miR-1236-3p on TNF-α-induced FHC cell injury, indicating that miR-1236-3p suppressed UC progression through targeting MYD88. Not only that, we presented that circ_0001187 had a positively regulation on MYD88, which verified that circ_0001187 indeed sponged miR-1236-3p to indirectly regulate MYD88. Of course, future in vivo tests are needed to confirm the existence of circ_0001187/miR-1236-3p/MYD88 axis to further improve our experimental results.

Conclusions

In conclusion, we revealed a new target for regulating UC progression. Our research pointed out that circ_0001187 might enhance TNF-α-induced FHC cell inflammation injury by miR-1236-3p/MYD88 pathway. The presented research revealed that circ_0001187 might be a potential molecular target for UC treatment. Click here for additional data file.
  39 in total

Review 1.  MyD88 as a therapeutic target for inflammatory lung diseases.

Authors:  Franco Di Padova; Valerie F J Quesniaux; Bernhard Ryffel
Journal:  Expert Opin Ther Targets       Date:  2018-04-20       Impact factor: 6.902

2.  Integrated analysis of circRNAs and mRNAs expression profile revealed the involvement of hsa_circ_0007919 in the pathogenesis of ulcerative colitis.

Authors:  Tingting Wang; Ning Chen; Weixia Ren; Fangfang Liu; Fangfang Gao; Lei Ye; Ying Han; Yujun Zhang; Yulan Liu
Journal:  J Gastroenterol       Date:  2019-04-29       Impact factor: 7.527

Review 3.  A comprehensive review and update on ulcerative colitis.

Authors:  Mahesh Gajendran; Priyadarshini Loganathan; Guillermo Jimenez; Anthony P Catinella; Nathaniel Ng; Chandraprakash Umapathy; Nathalie Ziade; Jana G Hashash
Journal:  Dis Mon       Date:  2019-03-02       Impact factor: 3.800

4.  MiR-146a regulates the development of ulcerative colitis via mediating the TLR4/MyD88/NF-κB signaling pathway.

Authors:  J-P Wang; L-N Dong; M Wang; J Guo; Y-Q Zhao
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-03       Impact factor: 3.507

5.  Ulcerative Colitis-Associated Long Noncoding RNA, BC012900, Regulates Intestinal Epithelial Cell Apoptosis.

Authors:  Feng Wu; Yong Huang; Fengshi Dong; John H Kwon
Journal:  Inflamm Bowel Dis       Date:  2016-04       Impact factor: 5.325

6.  MiR-146b protects against the inflammation injury in pediatric pneumonia through MyD88/NF-κB signaling pathway.

Authors:  Lei Zhang; Lili Dong; Yu Tang; Min Li; Mingming Zhang
Journal:  Infect Dis (Lond)       Date:  2019-10-04

7.  Circular RNA expression profile in peripheral blood mononuclear cells from Crohn disease patients.

Authors:  Juan Yin; Tong Hu; Lijuan Xu; Ping Li; Meifen Li; Yulan Ye; Zhi Pang
Journal:  Medicine (Baltimore)       Date:  2019-06       Impact factor: 1.817

8.  MiR-1236-3p Inhibits the Proliferation, Invasion, and Migration of Colon Cancer Cells and Hinders Epithelial-Mesenchymal Transition by Targeting DCLK3.

Authors:  Yibin Zhao; Hongyi Zhou; Jie Shen; Shaohui Yang; Ke Deng; Qi Li; Wei Cui
Journal:  Front Oncol       Date:  2021-09-03       Impact factor: 6.244

9.  Hsa_circ_0039569 facilitates the progression of endometrial carcinoma by targeting the miR-197/high mobility group protein A1 axis.

Authors:  Yi Zhou; Anyi Pan; Yudong Zhang; Xinchun Li
Journal:  Bioengineered       Date:  2022-02       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.