Literature DB >> 34540665

MiR-1236-3p Inhibits the Proliferation, Invasion, and Migration of Colon Cancer Cells and Hinders Epithelial-Mesenchymal Transition by Targeting DCLK3.

Yibin Zhao1, Hongyi Zhou1, Jie Shen1, Shaohui Yang1, Ke Deng1, Qi Li1, Wei Cui1.   

Abstract

BACKGROUND: Dysregulated microRNAs (miRNAs) are common in human cancer and are involved in the proliferation, promotion, and metastasis of tumor cells. Therefore, this study aimed to evaluate the expression and biological function of miR-1236-3p in colon cancer.
METHODS: This study screened the miRNA in normal and colon cancer tissues through array analysis. In addition, quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) analysis was performed to validate the expression of miR-1236-3p in normal and tumor tissues from colon cancer patients and cancer cell lines. Online predicting algorithms and luciferase reporter assays were also employed to confirm Doublecortin Like Kinase 3 (DCLK3) was the target for miR-1236-3p. Moreover, the impact of miR-1236-3p on the progression of colon cancer was evaluated in vitro and in vivo. Western blotting and qRT-PCR were also performed to investigate the interactions between miR-1236-3p and DCLK3.
RESULTS: MiR-1236-3p was significantly downregulated in colon cancer tissues and its expression was associated with the TNM stage and metastasis of colon. In addition, the in vitro and in vivo experiments showed that miR-1236-3p significantly promoted cancer cell apoptosis and inhibited the proliferation, invasion, and migration of cancer cells. The results also showed that miR-1236-3p hindered Epithelial-mesenchymal Transition (EMT) by targeting DCLK3. Moreover, the expression of DCLK3 mediated the effects of miR-1236-3p on the progression of cancer.
CONCLUSIONS: MiR-1236-3p functions as a tumor suppressor in colon cancer by targeting DCLK3 and is therefore a promising therapeutic target for colon cancer.
Copyright © 2021 Zhao, Zhou, Shen, Yang, Deng, Li and Cui.

Entities:  

Keywords:  DCLK3; colon cancer; miR-1236-3p; miRNA; tumor progression

Year:  2021        PMID: 34540665      PMCID: PMC8446622          DOI: 10.3389/fonc.2021.688882

Source DB:  PubMed          Journal:  Front Oncol        ISSN: 2234-943X            Impact factor:   6.244


Introduction

Colorectal cancer (CRC) is a very common gastrointestinal malignancy and the major cause of cancer-related deaths worldwide. It is therefore a significant threat to public health worldwide (1). Notably, surgery, radiotherapy and chemotherapy are the standard therapeutic strategies used in patients with advanced colon cancer (2). In addition, technological advances over the recent years have enabled early diagnosis, detection, intervention, and prediction of the prognosis of CRC (3). However, the prognosis of patients with advanced stage colon cancer remains poor, despite these advances (4). Moreover, a number of molecules have been identified to determine the main phases in the progression and metastasis of colon cancer (5). Nonetheless, the molecular mechanism underlying the progression and metastasis of the cancer remain unclear. Therefore, identifying novel molecular biomarkers is important in predicting prognosis and improving patient outcomes. MicroRNAs (miRNAs) are a group of small non-coding regulatory RNA molecules that are 17–25 nucleotides long. The molecules inhibit the expression of protein-coding genes at the post-transcriptional level (6). Additionally, accumulating evidence indicates that the dysregulation of miRNAs play a critical role in various human cancers. Existing research also suggests that miRNAs can act as effective tumor suppressors or oncogenic agents by regulating the target genes (7). Moreover, miRNAs participate in the regulation of many cellular processes including cell differentiation, proliferation, and apoptosis (8). It was also reported that miRNAs involved in regulating the proliferation, promotion, invasion and metastasis of tumor cells (9). Furthermore, miRNAs are somehow involved in Epithelial–mesenchymal Transition (EMT), which is a significant indicator of the tumor metastatic process (10). Although the importance of miRNAs in tumor progression has been explored extensively, the pathological relevance and significance of miRNAs in colon cancer remain unclear. Notably, miR-1236-3p has been reported to be significantly associated with different types of cancer, including gastric cancer (11), lung cancer (12), breast cancer (13), and ovarian cancer (14). However, research on the role of miR-1236-3p in colon cancer is largely scarce. The present study used microarray analysis to show that miR-1236-3p was significantly downregulated in colon cancer tissues and that it was associated with the TNM stage and metastasis in colon cancer patients. Moreover, miR-1236-3p not only inhibited the proliferation, invasion, and migration of colon cancer cells, but also hindered EMT in vitro and in vivo by targeting Doublecortin Like Kinase 3 (DCLK3). The findings herein suggest miR-1236-3p serves as an effective suppressor of tumor development and may therefore be a promising therapeutic target for colon cancer.

Materials and Methods

Collection of Clinical Samples

The study collected 145 colon cancer tissues and 105 normal colon tissues from patients who had undergone radical resection for colon cancer between Jan, 2014 and Jan, 2017. All the enrolled patients were diagnosed with colon cancer through the support of postoperative pathology. However, the study excluded patients who had received anti-tumor treatment (radiotherapy or chemotherapy) before surgery. The pathological data for the colon cancer patients is highlighted in . Additionally, this study was approved by the Ethics Committee of the Ningbo Medical Center Lihuili Hospital and was conducted in accordance to the Helsinki Declaration. Moreover, each participant provided written informed consent. This study was carried out in compliance with the ARRIVE guidelines
Table 1

Pathological data of colon cancer patients in discovery, training and validation sets.

Variables Training setValidation setEvaluation setP-value
(n = 40)(n = 40)(n = 60)
Age (year)46.8 ± 11.546.3 ± 12.148.3 ± 10.40.715
Gender (n)0.644
 Male242839
 Female161221
TNM stage0.896
 I466
 II131019
 III171526
 IV699
Pathological data of colon cancer patients in discovery, training and validation sets.

Cell Lines and Culture

The human colon cancer cell lines (including SW620, SW480, Caco-2, HT29 and HCT116), as well as normal colon epithelial cells (FHC) were all obtained from the Cell Bank of the Type Culture Preservation Committee of the Chinese Academy of Sciences (Shanghai, China). All the acquired cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) and were maintained at 37°C with 5% CO2.

Cell Transfection

Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used to conduct the transfections, according to the manufacturer’s instructions. Briefly, miR-1236-3p mimics, the inhibitor and negative controls (Applied Biosystems, Foster City, CA, USA) were transfected into SW620 cell at a concentration of 50 nM for 48 h. In addition, the cells were co-transfected with constructs containing pcDNA3.1-DCLK3, shDCLK3 and negative controls (RiboBio, Guangdong, China), at a concentration of 4 mg, for 48 h.

In Vivo Tumor Growth Experiments

The experiments were performed according to previously published protocols (15). Briefly, male BALB/c nude mice (4–5 weeks) were obtained from the Shanghai SLAC Laboratory Animal Co., Ltd. (Shanghai, China). The mice were then divided into 2 groups (n=6 per group): miR-1236-3p mimics (SW620) and mimics control (SW620). Thereafter, a total of 1×106 SW620 cells transfected with miR-1236-3p or control plasmids were injected into the mice, subcutaneously. Tumor growth was evaluated by measuring the length (L) and width (W) of tumors every 5 days. Moreover, tumor volume was determined using the following formula: Volume = LW2/2. The mice were sacrificed on the 35th day, after which the tumors were weighed. All the animal experiments were performed following ethical approval by the Ethics Committee of the Ningbo Medical Center Lihuili Hospital and met the standards of the UKCCCR guidelines (16).

RNA Isolation

TRIzol (Invitrogen, Carlsbad, CA, USA) and the RNeasy mini kit (Qiagen, Valencia, CA, USA) were used to extract total RNA (5 μg) following the manufacturers’ instructions. Thereafter, RNA was eluted in nuclease-free water and then stored at -80°C. In addition, the NanoDrop ND-1000 spectrophotometer (Nano- Drop Technologies, Wilmington, DE, USA) was used to measure RNA concentration.

Microarray Analysis

Five colon cancer tissues and 5 normal colon tissues were randomly selected for miRNA and mRNA array analysis. Tissue samples were prepared following the Affymetrix protocols (Affymetrix, Santa Clara, CA, USA). Total RNA was extracted from tissue homogenates according to the manufacturer’s protocol (Qiagen, Germany). The total RNA concentration and purity were determined using a NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA), and RNA band integrity was evaluated by 1% denaturing agarose gel electrophoresis. Affymetrix miRNA v. 3.0 array and Affymetrix GeneChip Human Gene 1.0 array were carried out for genome-wide miRNA and mRNA expression profiling. Following the manufacturer’s protocol, 1000 ng of total RNA was labeled using the FlashTag Biotin HSR RNA Labeling Kit (Afymetrix, USA). After RNA was labeled, microarray chips were hybridized with GeneChip Hybridization Control Kit (Afymetrix, USA) (16 h, 60 rpm). After washing, the chip arrays were then stained on a Fluidics Station 450 using the AGCC Fluidics Control Software. Thereafter, the arrays were scanned by Afymetrix® GeneChip Scanner 3000. The original probe cell intensity files (*CEL files) from the Afymetrix GeneChip Command Console software were imported into probe-level summarization files (*CHP files) for data extraction. The Expression Console Software and Transcriptome Analysis Console software were used to analyzed the *CHP files. Data obtained after image analysis were processed with the Robust Multi-array Average (RMA) method for perfect match (PM) background adjustment, quantile method for normalization. After that, the normalized signal intensities of arrays were log2 translated and the final processed data were compared. Data comparison were performed using R with the “limma” package and p values from each comparison were adjusted with the False Discovery Rate (FDR). Data were visualized using R with packages of “ggplot2”, “pheatmap” and “GOplot”.

Quantitative Reverse Transcription–Polymerase Chain Reaction Analysis

QRT-PCR reactions were carried out using a qSYBR-green-containing PCR kit (Qiagen, Germantown, MD, USA). The relative change was determined using the method of 2-△△Ct. The U6 small nuclear RNA gene and GAPDH served as the internal controls for the qRT-PCR assays. The Bio-Rad (Hercules, CA, USA) IQTM5 Multicolour Real-Time PCR Detection System (USA) was used to perform RT-PCR assays. Primers used in this study were synthesized from Nanjing Genscript Inc. (Nanjing, China) and the sequences are listed in .
Table 2

Sequences of miR-1236-3p mimic, inhibitor, siRNAs, and primers for qRT-PCR.

NameSequence (5′-3′)
DCLK3
 ForwardCCAGCAGAAATTCAAGCATATGTCC
 ReverseACAATCTGTTTATCCATGCACCA
GAPDH
 ForwardGACCTGACCTGCCGTCTAG
 ReverseAGGAGTGGGTGTCGCTGT
U6
 ForwardGAGAAGATTAGCATGGCCCCT
 ReverseATTTCTCGATTTGTGCGTGTCA
miR-1236-3p
 RT-primerGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTGGAG
 ForwardAACAAGCCTCTTCCCCTTGT
 ReverseGTCGTATCCAGTGCAGGGT
miR-1236-3p mimic
 ForwardCCTCTTCCCCTTGTCTCTCCAG
 ReverseGGAGAAGGGGAACAGAGAGGTC
miR-1236-3p inhibitorCCTCTTCCCCTTGTCTCTCCAG
Si-DCLK3
 ForwardUAAAAAGGGCCAGUUUUGCUG
 ReverseGCAAAACUGGCCCUUUUUAUC

qRT-PCR, quantitative reverse transcription–polymerase chain reaction.

Sequences of miR-1236-3p mimic, inhibitor, siRNAs, and primers for qRT-PCR. qRT-PCR, quantitative reverse transcription–polymerase chain reaction.

Construction of Vectors and the Luciferase Reporter Assay

The Wild-type (WT) or Mutant (Mut) fragment of the 3’-UTR region of the DCLK3 gene containing a putative miR-1236-3p-binding site was inserted into the pmirGLO vector (Promega, Madison, USA). In addition, SW620 or Caco-2 cells were cotransfected with the miR-1236 mimics, mimics control, miR-1236 inhibitor, inhibitor control, and a luciferase reporter plasmid (Applied Biosystems, Foster City, CA, USA) for the luciferase reporter assay. After incubation for 48 h, the cells were washed with PBS, then harvested. Luciferase activities was then determined after 24 h, using a Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). Additionally, Renilla luciferase activity was quantified for data normalization, and all the experiments were performed in triplicate.

Colony Formation Assays

The SW620 and Caco-2 cells stably transfected with the miR-1236-3p mimic or mimic control were suspended in DMEM containing 0.35% agarose and then plated in six-well culture plates containing solidified 0.6% agarose and DMEM at a cell density of 1×105 per dish. The cells were then incubated for 2 weeks at 37°C in an environment containing 5% CO2. Thereafter, they were stained using a 0.1% crystal violet solution then the number of colonies were counted.

Flow Cytometry

Annexin V-FITC and PI staining were performed to evaluate cell apoptosis according to the manufacturer’s instructions. The percentage of apoptotic cells was quantitatively determined by employing Annexin V-FITC. Those cells with positive Annexin V-FITC and negative PI staining were considered as early apoptotic cells, while cells with positive Annexin V-FITC and PI were considered as late apoptotic cells. In order to quantitate apoptotic cells, the cells were washed with cold PBS and then resuspended in binding buffer (10 mmol l-1HEPES/NaOH, 2.5 mmol l-1 CaCl2 and 140 mmol l-1 NaCl). Thereafter, the obtained cells were stained with Annexin V-FITC (5 μl) and PI (10 μl) and analyzed with EpicsAltra (Beckman Coulter, CA, USA) FCM.

Assessment of Cell Proliferation Through Cell Counting Kit-8 Assay

The SW620 and Caco-2 cells were seeded using 24-well plates overnight and then transfected with the miR-1236-3p mimics and miR-1236-3p inhibitor (200 nM). Thereafter, the transfected cells were trypsinized, counted, and harvested for the cell proliferation assay. Briefly, the harvested cells were seeded in 96-well plates (8 × 103 cells per well) then cultured at 37°C for 24 h. 10 μl of the CCK-8 reagents (KeyGENE, China) were added into each well, at the 24, 48 and 72 h time points, then incubated further at 37°C for 2 h. After removing the medium, the obtained precipitate was then dissolved in DMSO (Sigma). Finally, the absorbance (450 nm) was determined using an ELISA reader.

Transwell Invasion and Migration Assay

The Transwell invasion and migration assays were conducted according to previously published protocols (17). In addition, the 8-μmTranswell chamber (Corning, Tewksbury, MA, USA) was used to perform the invasion assay. Briefly, 2 mg/ml microliters diluted matrigel (BD Biosciences, Bedford, MA, USA) was placed on the inner surface. Additionally, the SW620 and Caco-2 cells were transfected for 24 h, then placed on the top chamber at a concentration of 2× 105 ml. Thereafter, RMPI1640 with 20% fetal calf serum (FBS, Servicebio, Shanghai, China) was added to the bottom chamber. After removing non-invading cells using a cotton-tipped swab, the invading cells were fixed in methanol, then stained with crystal violet. The penetrated cells were then counted using a microscope (200 × magnification) to evaluate the level of invasiveness. Notably, the migration assay was quite similar to the invasion assay although matrigel was not used on the inner surface. The invading or migrating cells were then counted in five random visual fields for each well. Each experiment was performed in triplicate. Additionally, the morphological changes (fibroblast-like phenotype appearance) in the SW620 cells with the miR-1236-3p mimic or control were assessed to test the effect of miR-1236-3p on EMT. Photographs were taken under an inverted microscope (Olympus).

Edu Assay by Cell Immunofluorescence

Cell immunofluorescence analysis was performed as described by previous studies (18). Briefly, the SW620 cells were fixed in 4% paraformaldehyde then permeabilized for 20 min using PBS containing 0.5% Triton X-100. Thereafter, the cells were blocked with 3% BSA containing 0.025% Triton X-100 and 5% FBS (30 min, at room temperature). The cells were then incubated overnight with primary antibodies (anti-E-cad and anti-N-cad, Abcam, Cambridge, UK) at 4°C or using the EdU Proliferation Kit (20 μM EdU for 3 hours, Abcam). After washing three times, the cells were incubated with the appropriate secondary antibodies. They were then washed, after which 4,6-diamidino-2-phenylindole (DAPI; Invitrogen) was used for nuclear counterstaining, for 5 min. Finally, immunofluorescence was visualized using a confocal microscope (LSM710, Carl Zeiss, Shanghai, China).

The Wound-Healing Migration Assay

The SW620 and Caco-2 cells were transfected for 24 h, then plated in 12-well plates at a concentration of 2 × 105 ml-1. When the cells reached 90% confluence, the wound was uniformly scratched using sterile pipette tips. Thereafter, the movement of cells into a scraped wound was measured to assess cell motility. In addition, the distance of the wound from 0 h was measured to monitor the speed of wound closure after 72 h with an observational interval of 6 h. Each assay was performed in triplicate.

Western Blotting

Protein was extracted from colon tissues or colon cancer cell lines with radioimmunoprecipitation assay (RIPA) buffer with a proteinase inhibitor. The Protein BCA Assay Kit (Bio-Rad) was used to measure the protein concentration in the lysate. 20 μg of protein were separated by SDS-PAGE (80 V, 2.5 h) and then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA). After that, the PVDF membranes were treated with a primary antibody (4°C, overnight). Followed by treatment with a peroxidase-conjugated secondary antibody, all the blots were visualized using ECL solutions and quantified. The following antibodies were used: anti-MMP-2 (1:500, Proteintech, Wuhan, Hubei, China), anti-MMP-9 (1:500, Proteintech), anti-CXCR-4 (1:2000, Proteintech), anti-vimentin (1:2000, Proteintech), anti-N-cadherin (1:2000, Proteintech), anti-E-cadherin (1:1000, Cell Signaling Technology), anti-DLCK3 (1:1000, Boster Bio, CA, USA) and anti-GAPDH (1:1000, Abcam, Cambridge, UK).

Statistical Analysis

The SPSS 19.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 8.0 (GraphPad Inc., CA, USA) software were used for statistical analysis. All experiments were repeated three times to ensure appropriate statistical analyses. The Chi-square test and Student’s t-test were used for data analysis accordingly. Additionally, an ANOVA was used for the comparison of more than two groups. On the other hand, the relationship between miR-1236-3p and disease-free survival was evaluated through Kaplan–Meier analysis with the log-rank test. A bilateral p value less than 0.05 was considered statistically significant.

Results

MiRNAs Screening and Identification of miR-1236-3p

A flow chart of this study is shown in . First, the study screened for miRNAs through microarray analysis using 10 colon tissue samples (discovery set, 5 colon cancer vs 5 normal colon tissues). Based on a logFC > 1 or <−1 and an adjusted p value <0.05, 30 differently expressed miRNAs were identified, including 19 upregulated and 11 downregulated miRNAs (see volcano plot in and heatmap in ). Thereafter, the 30 differently expressed miRNAs were further subjected to one-stage validation (training set, n=70, 40 tumor vs 30 normal) through qRT-PCR analysis and 6 differently expressed miRNAs were identified. After that, the 6 differently expressed miRNAs were then subjected to two-stage validation (validation set, n=70, 40 tumor vs 30 normal) through qRT-PCR analysis. Herein, hsa-miR-1236-3p was finally selected as the unique candidate miRNA, using the following criteria; FC >2 and p < 0.05 (see ). A previous study by Chen et al. {Chen, 2017 #1258} also indicated the different miRNA expressions in breast cancer patients between training and validation sets by qRT-PCR analysis. We consider that the patient heterogeneity with tumor heterogeneity is the major explanation for the differences between the training and validation sets. Thereafter, the study focused on the candidate miR-1236-3p for further analysis and it was validated in the evaluation set (n=100, 60 tumor vs 40 normal) through qRT-PCR. The results in show that the levels of miR-1236-3p in colon cancer tissues were significantly lower than those in normal controls (p<0.01). Moreover, the study assessed the correlations between the relative levels of miR-1236-3p expression and clinicopathologic features including, the TNM stage, status of distant metastasis and lymph node metastasis, as shown in . Among the patients with colon cancer, those with a higher TNM stage, distant metastasis and lymph node metastasis, were associated with a lower level of miR-1236-3p expression (p < 0.01). Moreover, the findings showed that miR-1236-3p was a prognostic factor for 5-year Disease-free Survival (DFS) of colon cancer patients (log-rank p = 0.003, see ). Furthermore, the expression levels of miR-1236-3p were compared between normal colon cell lines (FHC) and colon cancer cell lines (including Caco-2, SW620, SW480, HT29 and HCT116). The findings in show that the relative expression levels of miR-1236-3p in the SW620, Caco-2, SW480, HCT 116 and HT29 cell lines were significantly lower than those in the FHC cell lines (p<0.05), consistent with the tissue results. Among these cell lines, the miR-1236-3p expression were the lowest expressed in SW620 and Caco-2 cell lines (see ). Thus, we choose the SW620 and Caco-2 cell lines for further in vitro studies.
Figure 1

MiR-1236-3p was significantly downregulated in colon cancer tissues. (A) Flow chart of this study. (B) Volcano plot of the miRNAs. The red and green points represent differently expressed miRNAs (logFC > 1 or <−1 and adjust P value < 0.05). (C) Heatmap of differently expressed miRNAs (including 19 upregulated and 11 downregulated miRNAs). (D) Relative miR-1236-3p expression in normal colon and colon cancer tissues by qRT-PCR with U6 RNA as normal control. Relative miR-1236-3p expression and TNM stage (E), distant metastasis (F), and lymph node metastasis (G) to U6 by qRT-PCR in the evaluation set. A lower miR-1236-3p expression was significantly associated with a higher TNM stage, a presence of distant metastasis, and lymph node metastasis. (H) Relative miR-1236-3p expression and 5-year disease-free survival. (I) Relative miR-1236-3p expressions in cell lines to FHC by qRT-PCR (six replicates per group). The relative miR-1236-3p expressions in SW620, Caco-2, HT29, SW480, and HCT116 cell lines were significantly lower than FHC. FC, fold change; qRT-PCR, quantitative reverse transcription–polymerase chain reaction; hsa, human; N, normal; T, tumor; Error bars represent the mean ± s.e.m; *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test. The relationship between miR-1236-3p and disease-free survival was evaluated by Kaplan–Meier analysis with log-rank test.

Table 3

Differently expressed miRNA expressions in colon cancer and normal colon tissues in discovery, training and validation sets.

miRNAsDiscovery set (n = 10)Training set (n = 70)Validation set (n = 70)
logFCadj. P valueFCP valueFCP value
Up-regulated
 hsa-miR-4800-3p1.010.00016*2.210.013*1.60.22
 hsa-miR-44491.980.00035*2.520.008*2.10.15
 hsa-miR-6521.220.00040*2.010.42
 hsa-miR-3679-5p1.030.00052*2.330.009*1.80.087
 hsa-miR-1821.030.00188*1.630.16
 hsa-miR-181d1.010.00201*1.810.38
 hsa-miR-43221.060.00236*1.420.73
 hsa-miR-7081.150.00295*1.330.33
 hsa-miR-44981.070.00452*2.140.35
 hsa-miR-324-5p1.060.00583*1.550.18
 hsa-miR-92a1.400.00664*1.360. 22
 hsa-miR-36871.480.01109*2.210.07
 hsa-miR-3162-5p1.010.01309*1.530.69
 hsa-miR-36511.250.01363*1.430.43
 hsa-miR-31951.060.01500*1.220.76
 hsa-miR-2031.140.01565*1.610.09
 hsa-miR-46341.120.01811*1.420.61
 hsa-miR-31751.190.02238*2.130.09
 hsa-miR-1071.150.03508*1.440.54
Down-regulated
 hsa-miR-4727-5p-1.150.00001*0.650.25
 hsa-miR-1236-3p-1.020.00004*0.310.004*0.330.002*
 hsa-let-7f-2-1.030.00008*0.340.028*0.550.08
 hsa-miR-4304-1.000.00009*0.280.011*0.480.09
 hsa-miR-126-1.120.00012*0.670.33
 hsa-miR-539-1.010.00016*0.880.31
 hsa-miR-139-5p-1.320.00441*0.850.45
 hsa-miR-320e-1.150.00597*0.660.15
 hsa-miR-378-1.120.01855*0.590.11
 hsa-miR-451-1.110.02517*0.710.21
 hsa-miR-320a-1.180.04261*0.630.09

FC, fold change; *P < 0.05.

MiR-1236-3p was significantly downregulated in colon cancer tissues. (A) Flow chart of this study. (B) Volcano plot of the miRNAs. The red and green points represent differently expressed miRNAs (logFC > 1 or <−1 and adjust P value < 0.05). (C) Heatmap of differently expressed miRNAs (including 19 upregulated and 11 downregulated miRNAs). (D) Relative miR-1236-3p expression in normal colon and colon cancer tissues by qRT-PCR with U6 RNA as normal control. Relative miR-1236-3p expression and TNM stage (E), distant metastasis (F), and lymph node metastasis (G) to U6 by qRT-PCR in the evaluation set. A lower miR-1236-3p expression was significantly associated with a higher TNM stage, a presence of distant metastasis, and lymph node metastasis. (H) Relative miR-1236-3p expression and 5-year disease-free survival. (I) Relative miR-1236-3p expressions in cell lines to FHC by qRT-PCR (six replicates per group). The relative miR-1236-3p expressions in SW620, Caco-2, HT29, SW480, and HCT116 cell lines were significantly lower than FHC. FC, fold change; qRT-PCR, quantitative reverse transcription–polymerase chain reaction; hsa, human; N, normal; T, tumor; Error bars represent the mean ± s.e.m; *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test. The relationship between miR-1236-3p and disease-free survival was evaluated by Kaplan–Meier analysis with log-rank test. Differently expressed miRNA expressions in colon cancer and normal colon tissues in discovery, training and validation sets. FC, fold change; *P < 0.05.

The Effect of miR-1236-3p on Cell Proliferation and Apoptosis, In Vitro

In order to investigate the function of miR-1236-3p in colon cancer, miR-1236-3p was overexpressed in the SW620 and Caco-2 cell lines by transfecting the miR-1236-3p mimic and then assessing it through qRT-PCR, as illustrated in . In addition, the effect of miR-1236-3p on cell proliferation was evaluated through the colony formation assay (), CCK-8 assay () and the EdU assay through immunofluorescence (). The results revealed that miR-1236-3p significantly suppressed the proliferation of the SW620 and Caco-2 cells. Additionally, the apoptosis assay conducted through FCM (AnnexinV staining positive) showed that miR-1236-3p significantly induced cell apoptosis, in vitro (see ).
Figure 2

MiR-1236-3p inhibited colon cancer proliferation and promoted apoptosis in vitro. (A) Relative miR-1236-3p expression by qRT-PCR after transfecting with miR-1236-3p mimic and mimic control in SW620 and Caco-2 cell lines for 48h. (B) Colony formation assays. (C) Cell proliferation by the CCK-8 assay at 450 nm at 24, 48, and 72 h after cell seeding. (D) EdU assay by immunofluorescence analysis. (E) Cell apoptosis evaluation by FCM analysis. FCM, flow cytometry; CCK-8, Cell proliferation by Cell Counting Kpit-8; qRT-PCR, quantitative reverse transcription–polymerase chain reaction; Error bars represent the mean ± s.e.m.; **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group for each experiment.

MiR-1236-3p inhibited colon cancer proliferation and promoted apoptosis in vitro. (A) Relative miR-1236-3p expression by qRT-PCR after transfecting with miR-1236-3p mimic and mimic control in SW620 and Caco-2 cell lines for 48h. (B) Colony formation assays. (C) Cell proliferation by the CCK-8 assay at 450 nm at 24, 48, and 72 h after cell seeding. (D) EdU assay by immunofluorescence analysis. (E) Cell apoptosis evaluation by FCM analysis. FCM, flow cytometry; CCK-8, Cell proliferation by Cell Counting Kpit-8; qRT-PCR, quantitative reverse transcription–polymerase chain reaction; Error bars represent the mean ± s.e.m.; **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group for each experiment.

The Effect of miR-1236-3p on Cell Invasion, Migration, and EMT

The study further performed the Transwell and wound-healing assays to investigate the effect of miR-1236-3p on the invasion and migration of cancer cells. In addition, morphological changes and immunofluorescence staining of the main EMT markers were used to evaluate the effect of miR-1236-3p on EMT. The results revealed that miR-1236-3p significantly inhibited cell migration () and invasion () in both the SW620 and Caco-2 cell lines. Moreover, the wound-healing assay was used to evaluate whether miR-1236-3p affected cell migration. The findings of wound-healing assays showed that miR-1236-3p significantly inhibited the migration of the SW620 and Caco-2 cells (). Additionally, the effect of miR-1236-3p on the EMT process was assessed by evaluating the expression of EMT-associated proteins, including mesenchymal markers (N-cadherin and vimentin) and an epithelial marker (E-cadherin) in both the SW620 and Caco-2 cell lines. After transfection with the miR-1236-3p mimic, expression of E-cadherin was significantly upregulated while N-cadherin and vimentin were downregulated in the SW620 and Caco-2 cell lines (). Consistently, miR-1236-3p significantly downregulated the expressions of Matrix Metalloproteinase-2 (MMP-2), Matrix Metalloproteinase-9 (MMP-9) and the C-X-C Motif Chemokine Receptor 4 (CXCR-4) (). Furthermore, the mimics control in the SW620 cells showed morphological changes with a fibroblastic appearance, indicating obvious EMT (). However, significantly decreased morphological changes were observed in cells with the miR-1236-3p mimic (). These results therefore showed that miR-1236-3p could significantly inhibit the invasion, migration and EMT properties of colorectal cancer cells, in vitro.
Figure 3

MiR-1236-3p inhibited colon cancer invasion and migration in vitro. Transwell migration (A) and invasion (B) assays in SW620 and Caco-2 cells transfected with miR-1236-3p mimic or mimic control. Scale bar: 100μm (C) Wound-healing assay at 0, 24, and 48 h in SW620 and Caco-2 cells transfected with miR-1236-3p mimic or mimic control. (D) Western blotting analysis of E-cadherin, N-cadherin, and vimentin in SW620 cells transfected with miR-1236-3p mimic or mimic control. (E) Western blotting analysis of MMP-2, MMP-9, and CXCR-4 in SW620 cells transfected with miR-1236-3p mimic or mimic control. (F) Morphologic changes in SW620 cells transfected with miR-1236-3p mimic or mimic control by inverted microscope. Scale bar: 100μm. MMP-2, matrix metalloproteinase-2; MMP-9,matrix metalloproteinase-9; CXCR-4, C-X-C Motif Chemokine Receptor 4. Error bars represent the mean ± s.e.m. ***P < 0.001 by Student’s t-test, six replicates per group for each experiment.

MiR-1236-3p inhibited colon cancer invasion and migration in vitro. Transwell migration (A) and invasion (B) assays in SW620 and Caco-2 cells transfected with miR-1236-3p mimic or mimic control. Scale bar: 100μm (C) Wound-healing assay at 0, 24, and 48 h in SW620 and Caco-2 cells transfected with miR-1236-3p mimic or mimic control. (D) Western blotting analysis of E-cadherin, N-cadherin, and vimentin in SW620 cells transfected with miR-1236-3p mimic or mimic control. (E) Western blotting analysis of MMP-2, MMP-9, and CXCR-4 in SW620 cells transfected with miR-1236-3p mimic or mimic control. (F) Morphologic changes in SW620 cells transfected with miR-1236-3p mimic or mimic control by inverted microscope. Scale bar: 100μm. MMP-2, matrix metalloproteinase-2; MMP-9,matrix metalloproteinase-9; CXCR-4, C-X-C Motif Chemokine Receptor 4. Error bars represent the mean ± s.e.m. ***P < 0.001 by Student’s t-test, six replicates per group for each experiment.

The Effect of miR-1236-3p on Tumorigenesis in a Xenograft Model

The effect of miR-1236-3p on the formation and progression of colon cancer was further verified, in vivo. Briefly, SW620 cells stably transfected with a miR-1236-3p or control plasmid were subcutaneously injected into each flank of nude mice. The tumor volume was then monitored every 5 days and the growth curves were plotted accordingly. Thereafter, all the mice were sacrificed on the 35th day then the xenografts were harvested. Results from the xenograft model showed that miR-1236-3p significantly reduced the volume and weight of the tumor (), highlighting the suppressive effect of miR-236-3p on tumor growth.
Figure 4

MiR-1236-3p inhibited colon cancer growth in vivo. Nude mice were subcutaneously injected with SW620 cells stably transfected with miR-1236-3p mimic or control. (A) Changes in tumor volume, (B) representative xenografts, and (C) tumor weight were evaluated in nude mice. Error bars represent the mean ± s.e.m.; *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group for each experiment.

MiR-1236-3p inhibited colon cancer growth in vivo. Nude mice were subcutaneously injected with SW620 cells stably transfected with miR-1236-3p mimic or control. (A) Changes in tumor volume, (B) representative xenografts, and (C) tumor weight were evaluated in nude mice. Error bars represent the mean ± s.e.m.; *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group for each experiment.

Validation of DCLK3 as the Target for miR-1236-3p

In order to understand the molecular mechanism of miR-1236-3p in the development of colon cancer, the study evaluated its target genes. Microarray assays revealed 134 dysregulated genes (including 99 upregulated and 35 downregulated genes), based on a logFC > 2 or <−2 and an adjusted p value <0.05. The volcano plot and heatmap of the dysregulated mRNAs (top 50) are shown in . Moreover, Gene Ontology (GO) analysis was performed on the dysregulated genes, which were then visualized using the barplot, bubble, circle and cluster figures. The GO terms with the most significant p values for Biological Process (BP), Molecular Function (MF) and Cellular Component (CC) were ribonucleoprotein complex biogenesis, catalytic step 2 spliceosome and cell adhesion molecule binding, respectively (). Furthermore, the target genes for miR-1236-3p were predicted using online target-predicting algorithms, including TargetScan (http://www.targetscan.org/), miRDB (http://www.mirdb.org), miRWalk (http://www.mirwalk.umm.uni-heidelberg.de), and miRTarBase (http://www.mirtarbase.mbc.nctu.edu.tw/php/index.php). The vein results from the target-prediction algorithms and upregulated genes indicated that DCLK3 was the direct target for miR-1236-3p (see ). The binding sites for DCLK3 and hsa-miR-1236-3p were also revealed using TargetScan (http://www.targetscan.org/) and are illustrated in . In addition, luciferase reporter assays were performed in order to further confirm the functional interaction between miR-1236-3p and DCLK3. Notably, overexpression of miR-1236-3p was achieved by transfecting cells with the miR-1236-3p mimic while its knockdown was achieved by transfecting cells with the miR-1236-3p inhibitor. The results showed that overexpression of miR-1236-3p significantly reduced the luciferase activity of the reporter gene in the WT but not the Mut (), suggesting that miR-1236-3p directly targets the 3’UTR of DCLK3. Furthermore, the miR-1236-3p mimic significantly decreased the expression of DCLK3, which was demonstrated by results from qRT-PCR () and western blotting () in both the SW620 and Caco-2 cell lines. On the other hand, the miR-1236-3p inhibitor increased the levels of DCLK3. The results therefore confirmed that DCLK3 was the direct target gene for miR-1236-3p.
Figure 5

Dysregulated mRNAs by microarray analysis using colon tissues and GO analysis. (A) Volcano plot of the mRNAs. The red and green points represent differently expressed mRNAs (logFC > 2 or <−2 and adjust P value < 0.05). (B) Heatmap of differently expressed mRNAs (top 50). (C) Bubble and (D) circle plots by GO analysis with all the dysregulated genes. FC, fold change; GO, gene ontology; BP, biological processes; MF, molecular function; CC, cellular component.

Figure 6

Identification of DCLK3 as the target gene of miR-1236-3p. (A) Identification of DCLK3 as the target gene by vein result using upregulated genes and four online target-predicting algorithms (TargetScan, miRDB, miRWalk, and miRTarBase). (B) The binding sites of DCLK3 and hsa-miR-1236-3p by TargetScan. (C) Luciferase reporter activity after transfections (mimic control, miR-1236-3p mimic, inhibitor control, and miR-1236-3p inhibitor) in SW620 and Caco-2 cell lines. The results of qRT-PCR (D) and western blotting (E) indicated that miR-1236-3p mimic decreased the DCLK3 expression, while miR-1236-3p inhibitor increased the DCLK3 expression in both SW620 and Caco-2 cell lines. qRT-PCR, quantitative reverse transcription–polymerase chain reaction; Error bars represent the mean ± s.e.m. **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group.

Dysregulated mRNAs by microarray analysis using colon tissues and GO analysis. (A) Volcano plot of the mRNAs. The red and green points represent differently expressed mRNAs (logFC > 2 or <−2 and adjust P value < 0.05). (B) Heatmap of differently expressed mRNAs (top 50). (C) Bubble and (D) circle plots by GO analysis with all the dysregulated genes. FC, fold change; GO, gene ontology; BP, biological processes; MF, molecular function; CC, cellular component. Identification of DCLK3 as the target gene of miR-1236-3p. (A) Identification of DCLK3 as the target gene by vein result using upregulated genes and four online target-predicting algorithms (TargetScan, miRDB, miRWalk, and miRTarBase). (B) The binding sites of DCLK3 and hsa-miR-1236-3p by TargetScan. (C) Luciferase reporter activity after transfections (mimic control, miR-1236-3p mimic, inhibitor control, and miR-1236-3p inhibitor) in SW620 and Caco-2 cell lines. The results of qRT-PCR (D) and western blotting (E) indicated that miR-1236-3p mimic decreased the DCLK3 expression, while miR-1236-3p inhibitor increased the DCLK3 expression in both SW620 and Caco-2 cell lines. qRT-PCR, quantitative reverse transcription–polymerase chain reaction; Error bars represent the mean ± s.e.m. **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group.

DCLK3 Mediated the Biological Functions of miR-1236-3p in Colon Cancer Cells

In order to evaluate the effect of DCLK3 on the biological functions of miR-1236-3p in colon cancer cells, the SW620 cells were co-transfected with the miR-1236-3p mimic, mimic control, miR-1236-3p inhibitor and inhibitor control, after overexpression or knockdown of DCLK3. Western blot analysis showed that the miR-1236-3p mimic significantly inhibited the expression of DCLK3 and the inhibitory effect was effectively restored after co-transfection with pcDNA3.1-DCLK3 (). In addition, the miR-1236-3p inhibitor significantly upregulated the expression of DCLK3 and si-DCLK3 was able to counteract this effect. Similar results were obtained from qRT-PCR (see ). Moreover, the CCK-8 analyses showed that the effect of the miR-1236-3p mimic (or inhibitor) on cell proliferation could remarkably be reversed by the overexpression (or knockdown) of DCLK3 (). Furthermore, the impact of miR-1236-3p on tumor migration () and invasion () was restored by regulating the expression of DCLK3. These results therefore indicated that DCLK3 could effectively mediate the biological functions of miR-1236-3p in colon cancer cells.
Figure 7

DCLK3 mediated biological functions of miR-1236-3p in colon cancer cells. SW620 cells were co-transfected with miR-1236-3p mimic, mimic control, inhibitor, inhibitor control, overexpression (pcDNA3.1-DCLK3) and knockdown (si-DCLK3) of DCLK3. DCLK3 expressions were determined by western blotting (A) and qRT-PCR (B). The CCK-8 at 450 nm (C), transwell migration (D), and invasion (E) assays were performed in SW620 cells. Error bars represent the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group.

DCLK3 mediated biological functions of miR-1236-3p in colon cancer cells. SW620 cells were co-transfected with miR-1236-3p mimic, mimic control, inhibitor, inhibitor control, overexpression (pcDNA3.1-DCLK3) and knockdown (si-DCLK3) of DCLK3. DCLK3 expressions were determined by western blotting (A) and qRT-PCR (B). The CCK-8 at 450 nm (C), transwell migration (D), and invasion (E) assays were performed in SW620 cells. Error bars represent the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001 by Student’s t-test, six replicates per group.

Discussion

The present study used microarray analysis to show that miR-1236-3p is associated with colon cancer. The results revealed that miR-1236-3p functions as a tumor suppressor in colon cancer, and may therefore be a promising therapeutic target for colon cancer. Significant differences are observed in the results of microarray analysis by different study groups. Gungormez et al. (19) identified 32 dysregulated miRNAs in tumor and normal colorectal mucosa tissues from Turkey Caucasian patients with stage II colon cancer via microarray analysis. Additionally, Schepeler et al. {Schepeler, 2008 #1254} also reported 60 dysregulated miRNAs from Denmark Caucasian patients with stage II colon cancer. Moreover, Li et al. {Li, 2014 #1255} identified 9 differently expressed miRNAs in colon cancer between African and Caucasian Americans. Our data were not quite in accordance with the other reports. In our minds, the different patient characteristics (especially the racial/ethnic disparities), therapeutic strategies, and threshold values for bioinformatics analysis might be possible explanations for the different conclusions. Recent studies showed the association between miR-1236 and human cancer. In addition, accumulating evidence suggests that miR-1236-3p may serve as a tumor suppressor, given that decreased expression of miR-1236-3p has been reported in some cancers. It was also reported that miR-1236-3p is closely associated with cancerogenesis in hepatoma cancer cell lines by inhibiting the PI3K/Akt pathway and causing the accumulation of PTEN (20). Moreover, miR-1236-3p was dysregulated in the human digestive and excretory system cancer cells and was closely associated with the regulation of the tumor process (21). Previous research also showed that miR-1236-3p can inhibit the invasion and migration of cells in high-grade serous ovarian carcinoma by targeting ZEB1 (22). Additionally, miR-1236 was shown to inhibit cell proliferation by targeting p21 and was associated with favorable survival in renal cell carcinoma (23). A recent study by An et al. also suggested that miR-1236-3p inhibits the invasion and metastasis of gastric cancer by targeting MTA2 (24). Another study by Zhang et al. also indicated the close association between miR-1236 and gastrointestinal cancer (25). Moreover, Butkytė et al. reported that miR-1236-3p was extensively downregulated in colorectal tumors when compared with healthy controls (21), which was quite in accordance with our results. Furthermore, Zhu et al. reported that decreased expression of miR-1236-3p was closely associated with the clinical progression and unfavorable prognosis of gastric cancer (26). In addition, downregulated expression of miR-1236-3p was observed in breast cancer, lung cancer, and bladder cancer (27). However, the potential biological role of miR-1236-3p in colon cancer remains unclear. The present study showed that miR-1236-3p can induce apoptosis of colon cancer cells, inhibit the proliferation, invasion and migration of tumor cells and also block EMT both, in vivo and in vitro, suggesting the critical role of miR-1236-3p in colon cancer. A recent report by Feng et al. showed that circIFT80, a circular RNA, was crucial in the progression of colorectal cancer via the miR-1236-3p/HOXB7 axis (28). The present study similarly highlighted the critical role of miR-1236-3p in colon cancer. A separate study by Chen et al. also showed that miR-1236 not only regulates cell invasion and migration but also mediates hypoxia-induced EMT by repressing HDAC3 and SENP1 (29), consistent with the findings herein. Moreover, a previous study using the lung adenocarcinoma A549 cells revealed that miR-1236-3p inhibits cell invasion and migration by targeting KLF8 (30). Additionally, miRNA-1236-3p was reported to inhibit the proliferation and invasion of breast cancer cells by targeting ZEB1 (31). Interestingly, similar trends in the expression and function of miR-1236-3p have been observed in common gastrointestinal cancers, including gastric and colorectal cancers. These results therefore strongly suggest that miR-1236-3p plays a protective role in the progression of cancer (29). Additionally, Liu et al. reported that the non-coding variant, rs1800734 promotes the progression of colorectal cancer by targeting DCLK3, suggesting the important role of overexpressing DCLK3 in the progression of cancer via epithelial-to-mesenchymal transition (32). Notably, the expression of DCLK 3 was reported to be significantly elevated in colon cancer tissues, compared to the healthy controls The study also revealed that DCLK3 was significantly co-expressed with common EMT markers (such as CALD1 and FN1), strongly suggesting that DCLK3 is a potential oncogene that is associated with EMT and tumor progression (32). The present study similarly showed that miR-1236-3p exerted some biological functions in colon cancer by targeting DCLK3. Furthermore, the gain- and loss- of function experiments validated the association between miR-1236-3p and the expression of DCLK3. The findings showed that miR-1236-3p effectively inhibited the proliferation of colon cancer cells and EMT by targeting DCLK3. On the other hand, the biological function of miR-1236-3p could be impaired by overexpressing DCLK3. These mechanistic and functional experiments therefore gave a better understanding of the functional role of DCLK3 in human colon cancer. In addition, DCLK3, which was shown to be a direct functional target for miR-1236-3p in colon cancer, may be a promising therapeutic target given that it can be targeted precisely by a specific antibody. Studies on the role of DCLK3 in colon cancer are largely scarce. The present study therefore highlights the important role of DCLK3, as the target gene for miR-1236-3p, in the progression of colon cancer. Despite the insightful findings, this study had a few limitations. First, the sample size for colon cancer patients was relatively small. Second, the signaling pathway through which miR-1236-3p exerts it effects in colon cancer by targeting DCLK3, was not identified. Third, whether miR-1236-3p can exert its biological functions in colon cancer by targeting other genes remains unknown. In addition, the differences between cell lines used for extended experiments is not considered, importantly shape, origin and invasiveness of these lines are different with implications on the results. Although this study verified the biological functions of miR-1236-3p in SW620 and Caco-2 cells, its biological functions in other cell lines remain unclear. Finally, the effects of miR-1236-3p on the metastasis of colon cancer was not elucidated in this study. Further studies involving a larger sample size, in multi-center institutions are therefore needed to give a comprehensive understanding of the role of miR-1236-3p in colon cancer and other common gastrointestinal malignancies. Considering the different mutation status, shape, origin, invasion, and metastasis potential in different cell lines {de Both, 1999 #1256}, the biological functions of miR-1236-3p in other colon cancer cell lines require to be further verified. In conclusion, the study showed that miR-1236-3p inhibits the proliferation of colon cancer cells, tumor progression and EMT, in vitro by targeting DCLK3. The results also showed that miR-1236-3p inhibits tumor growth in vivo. These findings therefore suggest that miR-1236-3p is a potential therapeutic target for colon cancer.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics Statement

The studies involving human participants were reviewed and approved by Medical Institutional Ethics Committee of Ningbo Medical Center, Lihuili Hospital. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by Medical Institutional Ethics Committee of Ningbo Medical Center, Lihuili Hospital.

Author Contributions

YZ and HZ participated in the conception and design, data collection. JS and SY participated in the statistical analysis and wrote the manuscript. KD, QL, and WC participated in the conception and design and data collection. All authors contributed to the article and approved the submitted version.

Funding

Ningbo Natural Science Foundation (No. 2015A610223 and No. 2019A610334)

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Publisher’s Note

All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
  31 in total

1.  Effects of miR-1236-3p and miR-370-5p on activation of p21 in various tumors and its inhibition on the growth of lung cancer cells.

Authors:  Chuanchang Li; Qiangqiang Ge; Jiaxuan Liu; Qingsong Zhang; Chenghe Wang; Kai Cui; Zhong Chen
Journal:  Tumour Biol       Date:  2017-06

2.  Down-regulation of miR-1236-3p is correlated with clinical progression and unfavorable prognosis in gastric cancer.

Authors:  X-P Zhu; X-L Wang; J Ma; Y-F Fang; H-J Zhang; C Zhang; M-C Feng
Journal:  Eur Rev Med Pharmacol Sci       Date:  2018-09       Impact factor: 3.507

3.  Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers.

Authors:  George Adrian Calin; Cinzia Sevignani; Calin Dan Dumitru; Terry Hyslop; Evan Noch; Sai Yendamuri; Masayoshi Shimizu; Sashi Rattan; Florencia Bullrich; Massimo Negrini; Carlo M Croce
Journal:  Proc Natl Acad Sci U S A       Date:  2004-02-18       Impact factor: 11.205

4.  miR-130a-3p, a Preclinical Therapeutic Target for Crohn's Disease.

Authors:  Jie Zhao; Honggang Wang; Jin Zhou; Jun Qian; Haojun Yang; Yan Zhou; Hao Ding; Yu Gong; Xiaoyang Qi; Yuwen Jiao; Pu Ying; Liming Tang; Ye Sun; Weiming Zhu
Journal:  J Crohns Colitis       Date:  2021-04-06       Impact factor: 9.071

5.  MicroRNA-1236-3p inhibits proliferation and invasion of breast cancer cells by targeting ZEB1.

Authors:  T-C Liang; W-G Fu; Y-S Zhong
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-11       Impact factor: 3.507

6.  Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2.

Authors:  Z Wang; B Wang; Y Shi; C Xu; H L Xiao; L N Ma; S L Xu; L Yang; Q L Wang; W Q Dang; W Cui; S C Yu; Y F Ping; Y H Cui; H F Kung; C Qian; X Zhang; X W Bian
Journal:  Oncogene       Date:  2014-04-07       Impact factor: 9.867

7.  miR-1236 down-regulates alpha-fetoprotein, thus causing PTEN accumulation, which inhibits the PI3K/Akt pathway and malignant phenotype in hepatoma cells.

Authors:  Rui Gao; Chunli Cai; Jiancheng Gan; Xi Yang; Zeyu Shuang; Min Liu; Shengping Li; Hua Tang
Journal:  Oncotarget       Date:  2015-03-20

8.  MiR-661 promotes tumor invasion and metastasis by directly inhibiting RB1 in non small cell lung cancer.

Authors:  Feiye Liu; Yanjun Cai; Xiaoxiang Rong; Jinzhang Chen; Dayong Zheng; Lu Chen; Junyi Zhang; Rongcheng Luo; Peng Zhao; Jian Ruan
Journal:  Mol Cancer       Date:  2017-07-17       Impact factor: 27.401

9.  MicroRNA-211-5p suppresses tumour cell proliferation, invasion, migration and metastasis in triple-negative breast cancer by directly targeting SETBP1.

Authors:  Liang-Liang Chen; Zhou-Jing Zhang; Zhan-Bo Yi; Jian-Jun Li
Journal:  Br J Cancer       Date:  2017-06-01       Impact factor: 7.640

10.  miR-1236-3p inhibits invasion and metastasis in gastric cancer by targeting MTA2.

Authors:  Jia-Xiang An; Ming-Hui Ma; Chun-Dong Zhang; Shuai Shao; Nuo-Ming Zhou; Dong-Qiu Dai
Journal:  Cancer Cell Int       Date:  2018-05-01       Impact factor: 5.722

View more
  3 in total

1.  Potential Prognostic Biomarkers of NIMA (Never in Mitosis, Gene A)-Related Kinase (NEK) Family Members in Breast Cancer.

Authors:  Gangga Anuraga; Wei-Jan Wang; Nam Nhut Phan; Nu Thuy An Ton; Hoang Dang Khoa Ta; Fidelia Berenice Prayugo; Do Thi Minh Xuan; Su-Chi Ku; Yung-Fu Wu; Vivin Andriani; Muhammad Athoillah; Kuen-Haur Lee; Chih-Yang Wang
Journal:  J Pers Med       Date:  2021-10-26

2.  Circular RNA_0001187 participates in the regulation of ulcerative colitis development via upregulating myeloid differentiation factor 88.

Authors:  Wei Ouyang; Min Wu; Anshan Wu; Heng Xiao
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

3.  MicroRNA-889-3p restrains the proliferation and epithelial-mesenchymal transformation of lung cancer cells via down-regulation of Homeodomain-interacting protein kinase 1.

Authors:  Qiang Zhu; Yun Li; Lina Li; Mingxue Guo; Chenxi Zou; Yi Xu; Zhen Yang
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.