Epidemiological investigations on microbial infection and crystals causing feline lower urinary tract disease in tomcats in Ismailia, Egypt.

Background: Feline lower urinary tract disease (FLUTD) is a common disorder associated with the dysfunction of the urinary bladder or urethra in tomcats. Aim: A prospective study was carried out on the point prevalence and odds ratio (OR) of the FLUTD in Shirazi and Baladi tomcats at Ismailia Governorate, Egypt, recording the prominent clinical manifestation and identifying the antibiogram, virulence, and antimicrobial resistance genes of the causative microorganisms.
Methods: A total number of 420 tomcats admitted to the veterinary clinics of Ismailia during the period June 2020 to May 2021 were examined for FLUTD. A total of 1,260 urine samples were collected and analyzed.
Results: Hematuria, dysuria, and pollakiuria were the most evident signs recorded in a total of 120 tomcats diagnosed with FLUTD. The diagnosed cases of FLUTD were associated with causes like crystals (35.83%), pyogenic microorganisms (19.16%), and mixed cases (45.00%). The prevalence revealed highly significant (p < 0.01) increases in the cases caused by Escherichia coli, E. coli mixed cases, and calcium oxalate at >4 years; Staphylococcus aureus at ≤ 2 years; amorphous urate and phosphate at 2-4 and >4 years in Shirazi and ≤2 years in Baladi; triple phosphate at ≤2 years in Shirazi and >4 years in Baladi; and S. aureus mixed cases at ≤2 years. The OR of FLUTD revealed higher odds of associations with E. coli, E. coli mixed cases, S. aureus, amorphous urate, and triple phosphate, as well as lower odds with S. aureus, calcium oxalate, amorphous phosphate, and S. aureus mixed cases. Isolated E. coli revealed higher resistance to amoxicillin (AMX, 83.4%), ceftriaxone (83.4%), ceftazidime (CAZ, 75.0%), and cefoxitin (FOX, 50.0%), and S. aureus to oxacillin (100%), FOX (100%), AMX (85.8%), CAZ (76.2%), and FOX (50.0%). S. aureus-detected virulence genes were mecA, coa, spa, and tetK, and E. coli were fimH, iss, iutA, papC, blaTEM, blaCTX-M, and tetA. About 100% of E. coli and 76.1% of S. aureus isolates exhibited multidrug resistance.
Conclusion: FLUTD in tomcats is associated with higher odds in E. coli, E. coli mixed cases, and triple phosphate at older ages (>4 years) with high antimicrobial resistance in the microbial isolates contributing to the disease.

Introduction

Feline lower urinary tract disease (FLUTD) is not a specific disease but rather is a term used to describe the dysfunction of the urinary bladder or urethra of cats and has been commonly reported with a prevalence of up to 8% (Adam and Dean, 2009; Lund ). FLUTD has been revealed in some cases of urethral obstruction associated with oliguria and anuria caused by bacterial cystitis, neoplasia, urolithiasis, anatomical abnormalities, and urethral plugs (Saevik ; Dorsch ; Forrester and Towell, 2015). The prevalence of urinary tract infections (UTI) is associated with the cat’s age and to some extent breed as the prevalence increase with older age (Eggertsdottir ; Martinez-Ruzafa ).

The prevalence has been defined as the proportion of the population affected with a particular disease at a particular time and is usually expressed as a percentage (Bruce ). Prevalence (P) can also be expressed as the multiplication of the incidence by the duration of the study (Rothman, 2012). Point prevalence (PP) is a more specific proportion for the number of cases developed at a particular time to the number of the given population at this time (Viera, 2008; Brink, 2021). Odds ratio (OR) is known by the association of the exposure to a certain predisposing cause to an outcome (Carneiro, 2011; Motulsky, 2018). OR usually measures the strength of the association to the presence and absence of the cause (Noordzij et al., 2017). OR values are expressed as OR > 1 when the exposure is associated with higher odds of outcome and OR < 1 when the exposure is associated with lower odds of outcome (Szklo and Nieto, 2019).

Escherichia coli (E. coli) is the principal etiologic agent of UTI causing up to 90% (Loh and Sivalingam, 2007), and is recognized as uropathogenic E. coli (UPEC) (Schwartz ). UPEC have various virulence factors, such as fimbriae for bacterial adhesion and invasion, iron-acquisition systems for surviving in the iron-deficient environment, flagella, and toxins for bacterial dissemination. Virulence genes are found on transmissible genes (plasmid) and/or the chromosome (Farshad ). Extraintestinal disease E. coli (ExPEC) has numerous virulence factors that cannot be established by traditional diagnostics and is a prominent cause of UTIs. Urinary E. coli isolated from cats have shared similarities with ExPEC isolated from humans (Johnson ). ExPEC isolates have unique virulence factors which enable them to invade host surfaces, damage host tissues, and prevent or reverse host defenses (Johnson and Stell, 2000). Staphylococci are nonmotile, nonspore-forming, and opportunistic cocci widely found on mammalian skin, producing various illnesses ranging from mild, soft tissue infections to life-threatening conditions, such as bacteremia and endocarditis (Chang ). Staphylococcus aureus and S. schleifer are the most prevalent pathogenic species (Yamashita ). Staphylococcus aureus is a common cause of UTIs in the general population (Siegman-Igra, 2005). Cats can play a part in S. aureus transmission and recurring human methicillin-resistant S. aureus (MRSA) infections (Litster ).

The current study aims to conduct a prospective epidemiological study on the PP and OR associated with the FLUTD, as well as the associated antibiogram, virulence, and the antimicrobial resistance genes of E. coli and S. aureus in Ismailia Governorate, Egypt, regarding breed and age during the period from June 2020 to May 2021.

Material and Methods

Study area and design

The study was carried out in small animal clinics in Ismailia Governorate which is located in the northeastern part of Egypt with coordinates of 30°36ʹ15.37″N and 32°16ʹ20.1″E. A prospective epidemiological study was designed to investigate the PP and OR of predisposing risk factors associated with FLUTD of tomcats in Ismailia Governorate, Egypt, considering tomcat’s breed and age during the period from June 2020 to May 2021.

Sampling

A total number of 420 tomcats were admitted to the clinics during the study period. Out of them, 120 tomcats (28.57%) were suffering from urine retention. All the cats were recorded for the breed, age, and some other environmental influences, such as feeding habits, housing system, housing pattern, vaccination history, deworming actions, and disease and medication history. The cats were all fed on commercial dry feed and housed individually with the owners in their houses. The clinical examinations had been carried out according to the procedures described by Cote et al. (2010).

A total of 1,260 urine samples (three urine samples per case) were collected from all admitted cats via cystocentesis to run a complete urine analysis and detect the predisposing causes for the development of FLUTD (pyogenic organisms, crystals, or both).

Urine analysis

The urine samples (1,260 samples) were examined in a clinicopathological laboratory in Ismailia Governorate, Egypt. The recorded major causes, like crystals and pyogenic causes, were surveyed for calculating the frequencies. The result reports were categorized in a Microsoft Excel sheet (Microsoft Excel 365) for statistical analysis.

Epidemiological measures

The epidemiological measures included PP and OR and they were calculated as recommended by Thrusfield and Christley’s (2018) modifications. PP rates of the diseased-specific tomcats admitted to clinics were calculated as follows:

PP rate = (α / µ) × 100

where α is the number of cats admitted with the FLUTD during the study period and µ is the number of susceptible cats admitted considering breed and age during the same period. OR investigated the risk of contracting FLUTD in the exposed cats’ population concerning breed and age as follows:

OR = [(a / b) / (c / d)]

where (a / b) is the odds of exposure among the cases (in presence of dependent b) and (c / d) is the odds of exposure among the controls (in absence of dependent b).

Isolation of E. coli and S. aureus

Escherichia coli and S. aureus strains were categorized into strains related to pyogenic infection and strains related to mixed infection. Standard bacteriological and biochemical investigations were carried out to isolate and identify E. coli and S. aureus strains.

Escherichia coli strains were streaked onto MacConkey and eosine methylene blue agar medium (Oxoid) and incubated at 37°C for 24 hours. Blood agar was used to detect the hemolytic activity related to the pathogenicity of E. coli. The purified colonies were placed into a nutrient agar slant, incubated at 37°C for 24 hours, and maintained for further identification at −80°C in 10% glycerol (v/v). Isolated colonies have been purified and biochemically tested to validate their identity as E. coli according to Quinn .

Staphylococcus aureus was streaked onto blood agar, nutrient agar, and mannitol salt agar plates (Oxoid, Hampshire, UK). The streaked plates were then incubated at 37°C for 24–48 hours. Staphylococcus aureus circular, convex, and golden yellow colonies were collected and maintained for further examination at −80°C in 10% glycerol (v/v). Isolated colonies were purified and biochemical tests were conducted to confirm their identity as S. aureus according to Quinn .

Antibiotic susceptibility

Twenty-four isolates of E. coli and 21 isolates of S. aureus (one sample-one strain) were analyzed for their antibiotic susceptibility using the Kirby–Bauer disk diffusion method, and zone diameters were interpreted according to the Clinical and Laboratory Standards Institute (CLSI). The antibiotics used in the presented study were as follows: amoxicillin (AMX, 30 μg), AMX and clavulanic acid (AMC, 10 μg), oxacillin (OXA, 25 μg), ceftazidime (CAZ, 30 μg), ceftriaxone (CTR, 30 μg), cefoxitin (FOX, 30 μg), meropenem (MEM, 10 μg), Nitrofurntin (NIT, 25 μg), gentamicin (GEN, 10 μg), norfloxacin (NOR, 10 μg), amikacin (AK, 30 μg), doxycycline (DOX, 10 μg), trimethoprim-sulfamethoxazole (SXT, 25 μg), and aztreonam (ATM, 30 μg) (Oxoid, Basingstoke, UK). The diameter of the inhibition zone was estimated as described by CLSI 27. The phenotypic resistance patterns are classified into PDR, extensive drug-resistant (XDR), and multidrug resistance (MDR).

Bacterial extraction and PCR amplification

Escherichia coli and S. aureus genomic DNAs were extracted following QIAamp DNA Mini Kit instructions from the manufacturer (Qiagen, Germany, GmbH). Specific primers were employed to amplify fimH, papC, iutA, and iss operons by PCR. Primers’ details and predicted sizes of the amplified products and specific annealing temperatures are shown in Table 1. Amplification of bacterial DNA was carried out in a total volume of 50 μl containing 5 μl of 10x PCR reaction buffer, 1 μl 200 μM (of each dNTP) of dNTP mix (10 mM), 10 μl of bacterial DNA, 0.4 μl 2 U of Taq DNA polymerase (5 U/μl), 30 pmol of each used primer (0.1–0.6 μM), and then sterile ddH2O was added (up to 50 μl).

Table 1.

Primers and amplicon sizes of the amplified products and specific annealing temperatures.

M.Os	Target gene	Primers sequences	Amplicon size (bp)	Amplification (35 cycles)
				Denaturation	Annealing	Extension
E. coli	fimH	TGCAGAACGGATAAGCCGTGGGCAGTCACCTGCCCTCCGGTA	508	94°C30 seconds	50°C45 seconds	72°C45 seconds
	papC	TGATATCACGCACTCAGTAGCCCGGCCATATTCACATAA	501	94°C30 seconds	58°C40 seconds	72°C45 seconds
	iss	ATGTTATTTTCTGCCGCTCTGCTATTGTGAGCAATATACCC	226	94°C30 seconds	54°C30 seconds	72°C30 seconds
	iutA	GGCTGGACATGGGAACTGGCGTCGGGAACGGGTAGAATCG	300	94°C30 seconds	63°C30 seconds	72°C30 seconds
	blaCTX-M	ATG TGC AGY ACC AGT AAR GTK ATG GCTGG GTR AAR TAR GTS ACC AGA AYC AGC GG	593	94°C30 seconds	54°C40 seconds	72°C45 seconds
	bla TEM	ATCAGCAATAAACCAGCCCCCGAAGAACGTTTTC	516	94°C30 seconds	54°C40 seconds	72°C45 seconds
	tetA	GGTTCACTCGAACGACGTCACTGTCCGACAAGTTGCATGA	576	94°C30 seconds	50°C40 seconds	72°C45 seconds
S. aureus	mecA	GTA GAA ATG ACT GAA CGT CCG ATA ACCA ATT CCA CAT TGT TTC GGT CTA A	310	94°C30 seconds	50°C30 seconds	72°C40 seconds
	coa	ATA GAG ATG CTG GTA CAG GGCT TCC GAT TGT TCG ATG C	630	94°C30 seconds	55°C40 seconds	72°C40 seconds
	spa	TCA ACA AAG AAC AAC AAA ATG CGCT TTC GGT GCT TGA GAT TC	226	94°C30 seconds	50°C30 seconds	72°C40 seconds
	tetK	GTAGCGACAATAGGTAATAGTGTAGTGACAATAAACCTCCTA	364	94°C30 seconds	54°C40 seconds	72°C40 seconds

The amplification was carried out in thermal protocols. Initial denaturation at 94°C for 10 min was required, followed by 35 cycles at a specific temperature (Table 1), and extension at 72°C for 1 min. A 10-μl aliquot of PCR was subjected to a 2% agarose gel electrophoresis, then stained with an ethidium bromide solution. Amplified DNA fragments of specific sizes were detected by UV-induced fluorescence.

Statistical analysis

Statistical analysis was carried out using the Statistical Package for the Social Sciences (SPSS) version 20.0 software (SPSS, 2016). The data were analyzed using multifactorial analysis of variance (two-tailed analysis of variance) to determine the influence of breed and age on the urine analysis pictures in the examined tomcats. The statistical model empathized as follows:

Y = µ + α + β + (αβ) + Ɛ

where Y is the measurement of dependent variables, µ is the overall mean, αi is the fixed effect of the breed, β is the fixed effect of age, (αβ) is the interactions of the breeds by tomcats’ age, and Ɛ is the random error.

Ethical approval

The materials, protocol, and study design were approved by the Scientific Research Ethics Committee on Animal and Poultry Researches at the Faculty of Veterinary Medicine, Suez Canal University, Egypt, with approval number (2021050).

The examined tomcats were subjected to the examination humanly and carefully, taking all the necessary precautions to minimize the pain during sample collection. Some of the owners witnessed the examinations and sampling for more clarity and obvious consent for sampling of the animal for research purposes.

Results

Clinical examinations

The clinical examinations of the tomcats admitted to the clinics revealed a prevalence of 28.57% for FLUTD-infected animals (a total of 120 diseased animals out of the 420 examined animals). The prominent recorded clinical signs in the diseased animals were hematuria, dysuria, stranguria, pollakiuria, periuria, vocalization when trying to urinate, urinating in unusual places, excessive licking of the genital area, aggression associated with a large, and distended bladder on abdominal palpation. All of the previous symptoms were concurrent with a history of anuria or oliguria and in some cases passage of a few drops of blood-stained urine for more than 2 days was noted.

The FLUTD in the infected 120 tomcats out of the examined 420 animals was related to some predisposing factors that were revealed in the urine analysis, such as crystals (n = 43, PPTotal = 35.83%), pyogenic microorganisms (n = 23, PPTotal = 19.16%), and mixed cases (n = 54, PPTotal = 45%). The total recorded crystals were amorphous urate (n = 36, PPTotal = 30.00%, PPSpecific = 83.72%), calcium oxalate (n = 8, PPTotal = 6.66%, PPSpecific = 18.60%), amorphous phosphate (n = 15, PPTotal = 12.50%, PPSpecific = 34.88%), and triple phosphate (n = 38, PPTotal = 31.66%, PPSpecific = 88.37%). The isolated pyogenic microorganisms were E. coli (n = 61, PPTotal = 50.83%) and S. aureus (n = 16, PPTotal = 13.33%).

Epidemiological investigations

The prevalence reveals in Table 2 highly significant (p < 0.01) increases of E. coli, E. coli mixed cases, and calcium oxalate crystals in tomcats older than 4 years in both breeds with no significant differences between the breeds. Highly significant (p < 0.01) increases of prevalence were recorded in S. aureus in ≤2 and 2–4 years Shirazi with no significant differences between the two ages and in ≤2 years Baladi tomcats. Amorphous urate and phosphate reveal highly significant (p < 0.01) increases in 2–4 and >4 years in Shirazi with no significant differences between the two ages and in ≤2 years in Baladi tomcats. Triple phosphate crystals revealed highly significant (p < 0.01) increases in ≤2 years in Shirazi and >4 years in Baladi tomcats. Staphylococcus aureus mixed cases revealed highly significant (p < 0.01) increases in ≤2 years in both breeds with no significant differences between the breeds.

Table 2.

Prevalence and odds ratio of FLUTD’s contributing causes (pyogenic, crystals, and mixed cases) in Shirazi and Baladi tomcats.

Causes	Measures	Breeds by age						p-value
		Shirazi Tomcat			Baladi Tomcat
		≤2	2: 4	>4	≤2	2: 4	>4
Pyogenic causes
E. coli	n	9	9	12	9	9	13	---
	PP	12.86b	12.86b	17.14a	12.86b	12.86b	18.57a	0.012
	OR	5.36b	6.52b	27.27a	2.65c	10.71b	21.67a	0.001
S. aureus	n	4	4	0	5	2	1	---
	PP	5.71a	5.71a	0.00b	7.14a	2.86b	1.43c	0.001
	OR	1.06a	0.72b	0.19c	0.82a	0.53b	0.13c	0.000
Urine crystals
Amorphous urate	n	3	5	5	12	7	4	---
	PP	4.29b	7.14a	7.14a	17.14a	10.00b	5.71c	0.005
	OR	0.68c	1.19b	1.32a	2.68a	2.57a	0.55b	0.001
Calcium oxalate	n	0	0	2	1	1	4	---
	PP	0.00b	0.00b	2.86a	1.43b	1.43b	5.71a	0.002
	OR	0.00b	0.00b	0.40a	0.09c	0.21b	0.55a	0.000
Amorphous phosphate	n	1	3	3	3	2	3	---
	PP	1.43b	4.29a	4.29a	4.29a	2.86b	4.29a	0.007
	OR	0.19c	0.60b	0.66a	0.32c	0.45a	0.38b	0.001
Triple phosphate	n	10	7	5	4	5	7	---
	PP	14.29a	10.00b	7.14c	5.71c	7.14b	10.00a	0.002
	OR	6.25a	2.08b	1.32c	0.45c	1.47a	1.22b	0.000
Mixed causes
E. coli and crystals	n	4	6	7	9	6	11	---
	PP	5.71c	8.57b	10.00a	12.86b	8.57c	15.71a	0.001
	OR	1.06c	1.34b	1.85a	0.95c	1.92a	1.43b	0.000
S. aureus and crystals	n	3	2	0	5	0	1	---
	PP	4.29a	2.86b	0.00b	7.14a	0.00c	1.43b	0.000
	OR	0.79a	0.45b	0.00c	0.53a	0.00c	0.13b	0.000

Means with different superscripts in the same row are significantly different at p ≤ 0.05 or highly significantly different at p < 0.01. Means with the same superscripts in the same row are nonsignificantly different at p< 0.05. Total number of cases caused by crystals = 43; pyogenic microorganisms = 23; and mixed cases = 54. The recorded crystals were amorphous urate = 36; calcium oxalate = 8; amorphous phosphate = 15; and triple phosphate = 38. PP: Point prevalence; OR: Odds ratio; E. coli: Escherichia coli, S. aureus: Staphylococcus aureus; SE: Standard error.

The OR of FLUTD reveals in Table 2 higher odds of associations with E. coli, mixed cases of E. coli, S. aureus (≤2 years in Shirazi), amorphous urate crystals (2–4 and >4 years in Shirazi and ≤2 and 2–4 years Baladi), and triple phosphate crystals (≤2, 2–4, and >4 years in Shirazi and 2–4, and >4 years in Baladi), while OR reveals lower odds of associations with S. aureus (2–4 and >4 years in Shirazi, and <2, 2–4, and >4 years in Baladi), amorphous urate (<2 years in Shirazi and >4 years in Baladi), calcium oxalate, amorphous phosphate, triple phosphate (<2 years in Baladi), mixed cases of S. aureus.

Antimicrobial susceptibility of the recovered isolates

The antimicrobial susceptibility testing revealed (Table 3) a high resistance pattern of the E. coli isolates to AMX (83.4%), CTR (83.4%), CAZ (75.0%), and FOX (50.0%). The examined strains were highly susceptible to MEM (87.5%), nitrofurantoin (83.4%), and gentamycin (75.0%) as described in Table 4 and Figure 1. Statistically, the resistance of retrieved isolates to various tested antimicrobial agents was significantly different (p < 0.05).

Table 3.

Antimicrobial susceptibility of the recovered isolates.

Antibiotic class	Antibiotic	E. coli (n=24)			S. aureus (n=21)
		S (%)	I (%)	R (%)	S (%)	I (%)	R (%)
Penicillin	AMX	2 (8.3)	2 (8.3)	20 (83.4)	3 (14.2)	0 (0)	18 (85.8)
	AMC	3 (12.5)	6 (25.0)	15 (62.5)	3 (14.2)	3 (14.2)	14 (66.6)
	OXA	6 (25.0)	5 (20.8)	13 (54.1)	2 (9.6)	0 (0)	21 (100)
Cephalosporin	CAZ	0 (0)	6 (25.0)	18 (75.0)	5 (23.8)	0 (0)	16 (76.2)
	CTR	4 (16.6)	0 (0)	20 (83.4)	9 (42.9)	3 (14.2)	9 (42.9)
	FOX	6 (25.0)	6 (25.0)	12 (50.0)	2 (9.6)	0 (0)	21 (100)
Fluroquinolones	NOR	12 (50.0)	7 (29.2)	5 (20.8)	14 (66.6)	0 (0)	7 (33.4)
Monobactam	ATM	14 (58.4)	6 (25.0)	4 (16.6)	13 (62.0)	3 (14.2)	5 (32.8)
Aminoglycoside	AK	16 (41.6)	8 (33.4)	0 (0)	19 (90.4)	1 (4.7)	1 (4.7)
	GEN	18 (75.0)	0 (0)	6 (25.0)	10 (47.6)	6 (28.6)	5 (32.8)
Carbapenem	MEM	21 (87.5)	3 (12.5)	0 (0)	21 (100)	0 (0)	0 (0)
Nitrofuran	NIT	20 (83.4)	3 (12.5)	1 (4.1)	15 (71.4)	3 (14.2)	0 (0)
Tetracycline	DOX	8 (33.4)	6 (25.0)	10 (41.6)	9 (42.9)	3 (14.2)	9 (42.9)
Sulfonamide	SXT	12 (50.0)	0 (0)	12 (50.0)	10 (47.6)	0 (0)	11 (52.4)
Mean ± SE		10.14a±1.860	4.143a±0.7402	9.714a±1.908	9.643a±1.663	1.571a±0.5105	9.786a±1.962

Asignificant difference at p < 0.0001; AMX: Amoxicillin; AMC: Amoxicillin and clavulanic acid; OXA: Oxacillin; CAZ: Ceftazidime; CTR: Ceftriaxone; FOX: Cefoxitin; NOR: Norfloxacin; ATM: Aztreonam; AK: Amikacin; GEN: Gentamicin; MEM: Meropenem; NIT: Nitrofurntin; DOX: Doxycycline; SXT: Trimethoprim-sulfamethoxazole.

Table 4.

The distribution of the virulence genes and antibiotic resistance genes among the recovered strains of E. coli and S. aureus.

M.Os	Type of genes	Genes of E. coli	No.	%	Chi-square P-value
E. coli	Virulence genes	fimH	21	87.5	9.1009NS
		iss	18	75.0
		iutA	13	54.2
		papC	9	37.5
	Antibiotic resistance genes	bla TEM	20	83.4
		bla CTX-M	18	75.0
		tetA	10	41.6
S. aureus	Virulence genes	coa	21	100	0.34177NS
		mecA	21	100
	Antibiotic resistance genes	spa	18	85.7
		tetK	9	42.9

Fig. 1.

Antibiotics’ sensitivity patterns in the isolated E. coli and S. aureus.

The antimicrobial susceptibility testing revealed that the S. aureus-recovered isolates exhibited a high resistance pattern to penicillins: OXA (100%), cephalosporins: FOX (100%), AMX (85.8%), CAZ (76.2%), and FOX (50.0%). In addition, the examined strains were highly susceptible to MEM (100%), AK (90.4%), nitrofurantoin (71.4%), and NOR (66.6%) as described in Table 3 and Figure 1. Statistically, the resistance of retrieved isolates to various tested antimicrobial agents was significantly different (p < 0.05). MAR index values, in this study, showed multiple-resistant patterns, indicating recovered isolates originated from high-risk contamination.

The distribution of the virulence genes and antibiotic-resistance genes among the recovered strains

Virulence genes and antibiotic resistance genes (Table 4) were detected successfully in 21 S. aureus isolates. The most frequent S. aureus virulence genes were mecA (100%), coa (100%), spa (85.7%), and tetK (42.9%) (Fig. 2). The distribution of virulence genes and antibiotic-resistant genes among the examined strains was statistically not significantly different.

Fig. 2.

(A) PCR amplification of the specific gene of S. aureus (coa) at 630 bp. (B) PCR amplification of the specific gene of S. aureus (spa) at 226 bp. (C) PCR amplification of the specific gene of S. aureus (mecA) at 310 bp. (D) PCR amplification of the specific gene of S. aureus (tetK) at 364 bp.

Virulence genes and antibiotic resistance genes (Table 4) were detected successfully in 24 E. coli isolates. The most frequent E. coli virulence genes were fimH (100%), iss (75%), iutA (54.2%), papC (37.5%), blaTEM (83.4%), blaCTX-M (75%), and tetA (41.6%) (Figs. 3 and 4). The distribution of virulence-determinant genes and antibiotic-resistant genes among the examined strains is statistically not significantly different.

Fig. 3.

(A) PCR amplification of the specific gene of E. coli (iutA) at 300 bp. (B) PCR amplification of the specific gene of E. coli (iss) at 226 bp. (C) PCR amplification of the specific gene of E. coli (papC) at 501 bp. (D) PCR amplification of the specific gene of E. coli (fimH) at 508 bp.

Fig. 4.

(A) PCR amplification of the specific gene of E. coli (blaCTX-M) at 593 bp. (B) PCR amplification of the specific gene of E. coli (blaTEM) at 516 bp. (C) PCR amplification of the specific gene of E. coli (tetA) at 576 bp.

A combination between phenotypic multidrug resistance and AMR genes

About 100% of E. coli isolates were multidrug-resistant (MDR, Table 5) to various antimicrobial agents and 32.8% of S. aureus were XDR to seven antimicrobial agents, and 76.1% of S. aureus were multidrug resistance (MDR) to various antimicrobial agents.

Table 5.

The frequency of the phenotypic multidrug resistance and the antibiotic resistance genes among the retrieved strains of E. coli and S. aureus.

Type of bacteria	No. of strains	%	Type of resistance	Phenotypic multidrug resistance	MAR	Antimicrobial resistance genes
E. coli	12	50.0	MDR	Penicillins: AMX, AMC, OXACephalosporins: CTR, CAZ, FOXSulfonamides: SXT	0.29	blaTEM and blaCTX-M
	6	25.0	MDR	Penicillins: AMXCephalosporins: CTR, CAZTetracycline: DOXAminoglycoside: CN	0.20	blaTEM blaCTX-Mand tetA
	3	12.5	MDR	Penicillins: AMC Tetracycline: DOXFluroquinolones: NORMonobactam: ATM	0.16	tetA
	2	8.3	MDR	Penicillins: AMXCephalosporins: CTRFluoroquinolones: NOR	0.12	bla TEM
	1	4.1	MDR	Penicillins: OXATetracycline: DOXMonobactam: ATMAminoglycoside: CNNitrofuran	0.20	tetA
S. aureus	11	52.4	MDR	Penicillins: AMX, AMC, OXACephalosporins: CAZ, FOXSulfonamides: SXT	0.28	bla TEM
	5	32.8	XDR	Penicillins: OXACephalosporins: CAZ, CTR, FOXAminoglycoside: CNTetracycline: DOXMonobactam: ATMFluoroquinolones: NOR	0.38	tetA
	2	9.6	MDR	Penicillins: AMX, OXACephalosporins: CTR, FOXTetracycline: DOXFluoroquinolones: NOR	0.28	tetA
	2	9.6	MDR	Penicillins: AMC, OXACephalosporins: CRO, FOXTetracycline: DOX	0.23	tetA
	1	4.7	MDR	Penicillins: AMC, OXACephalosporins: FOXAminoglycoside: AK	0.19

MDR: multidrug resistance; XDR: extensively drug-resistance; AMX: Amoxicillin; AMC: Amoxicillin and clavulanic acid; OXA: Oxacillin; CAZ: Ceftazidime; CTR: Ceftriaxone; FOX: Cefoxitin; NOR: Norfloxacin; ATM: Aztreonam; AK: Amikacin; GEN: Gentamicin; MEM: Meropenem; NIT: Nitrofurntin; DOX: Doxycycline; SXT: Trimethoprim-sulfamethoxazole.

Discussion

FLUTD can be considered a term to describe the affections of the urinary bladder and/or urethra of tomcats rather than to be considered a disease. The clinical manifestations are similar to other diseases and affections of the lower urinary tract, which is why further investigations should be carried out to differentiate as reported by Lund et al. (2016). The most common and reported clinical manifestations of the FLUTD in tomcats are dysuria (painful urination), pollakiuria (increased urination frequencies), hematuria (blood in urine), periuria (urination outside the litter), self-over-grooming around the perineum, and behavioral vices, like aggression, irritation, and stranguria (blockage of the urethra), following Kim .

The current study reveals that FLUTD prevailed as 28.57% (a total of 120 diseased animals out of the 420 examined animals). These infected cases were correlated to the main causes that were detected through the urine analysis as follow: crystals (n = 43, PPTotal = 35.83%), pyogenic microorganisms (n = 23, PPTotal = 19.16%), and mixed cases (n = 54, PPTotal = 45.00%). The most predominant recorded crystals were amorphous urate (n = 36, PPTotal = 30.00%, PPSpecific = 83.72%), calcium oxalate (n = 8, PPTotal = 6.66%, PPSpecific = 18.60%), amorphous phosphate (n = 15, PPTotal = 12.50%, PPSpecific = 34.88%), and triple phosphate (n = 38, PPTotal = 31.66%, PPSpecific = 88.37%). The isolated pyogenic microorganisms were E. coli (n = 61, PPTotal = 50.83%) and S. aureus (n = 16, PPTotal = 13.33%).

On the other hand, FLUTD was reported by Lew-Kojrys with a prevalence up to 51.9% higher than the recorded prevalence in the current study, and they attributed the high prevalence to idiopathic cystitis in Polish feline populations. They also recorded that FLUTD is associated with numerous factors such as animal factors including breed, sex, age, and neutering conditions, as well as environmental factors including housing and living standards, and diet formulation. Kovarikova reported a higher prevalence compared to the current study of up to 51.9% of 214 examined males and female cats for FLUTD. They attributed the disease to a urethral obstruction in 23 cases and 100 cases were nonobstructive. Lund and Eggertsdottir (2019) reported studied the occurrence of FLUTD in Norwegian cats during the period 2003–2009. They attributed these cases to nonobstructive feline idiopathic cystitis and urolithiasis. They suggested the application of multimodal environmental modifications and enrichment of cats. Kaul conducted a questionnaire survey on the incidence of FLUTD in 101 cats from 2010 to 2013. They recorded nearly close numbers to the current study and associated them with pathogenic causes such as 52 cats diagnosed with idiopathic cystitis, 21 with urolithiasis, and 13 with bacterial urinary tract infection.

The most often isolated bacterium in dogs and cats with UTI was E. coli. In general, Enterobacteriaceae were responsible for more than half of UTIs in dogs and cats; Simultaneously, Staphylococcus spp. were the second most often detected bacteria; however, the Staphylococcus species found varied greatly across dogs and cats (Hall ). Enterobacteriaceae along with Staphylococcus spp. causes approximately 79% of UTIs in dogs and cats (Marques ).

UTI are the most commonly diagnosed diseases of cats that are inappropriately treated with empirical antibiotics without microbiological testing (De Briyne ). The cats are assumed to be potential reservoirs for antimicrobial resistance (AMR) transfer to humans due to the large-scale use of antimicrobial agents and close interaction with humans being extensively treated by broad-spectrum antimicrobial agents (Guardabassi ; Lloyd, 2007). The risk of antimicrobial treatment failure could be increased in both animals and humans (Algammal ; Li ).

The current findings regarding the bacteriological identification of characteristic colonies on eosine methylene blue agar and the biochemical reaction are similar to those of Edwads and Ewing (1972). The in vitro antimicrobial resistance pattern of the recovered E. coli strains exhibited a high resistance pattern to AMX (83.4%), CTR (83.4%), CAZ (75.0%), and FOX (50.0%). In addition, the examined strains were highly susceptible to MEM (87.5%) was consistent with those detected by Prescott and Patel .

In the present study, the PCR proved that the tested strains harbored the virulence-determinant genes (fimH). Adhesion gene was the most common and present in 87.5% UPEC isolates, which is in agreement with studies carried out in Romania (86%) (Vargová ) and Mongolia (89.9%) (Munkhdelger, 2017) on UTI. The present study shows the presence of virulence genes characteristic of ExPEC strains in bacterial isolates from nondiarrheic cats, as well as cats with UTI (iss, iutA, and papC), with an incidence of 75.0, 54.2, and 37.5%, respectively. Gregova and Kmet (2020) revealed that the most commonly discovered virulence genes in E. coli strains isolated from animals were iutA, iss, and papC. The presence of these genes has also been confirmed in ExPEC strains derived from UPEC. Pets are natural reservoirs for various pathogens, including ExPEC strains, that are capable of infecting humans, which is a reason for concern (Johnson ).

The large increase in the discovery of multidrug-resistant and methicillin-resistant S. aureus (MDR MRSA) over time has been a finding because it poses serious therapeutic constraints, which is in agreement with Jay-Russell who isolated MDR MRSA in cats. The rapid emergence and spread of resistant Staphylococci in cats is a worrying development. Resistant Staphylococci in cats are similar to human Staphylococci that are highly resistant to penicillin, ampicillin, and tetracycline. Notably, the mecA gene was mostly found in Staphylococcus spp. isolated from cats. Nonetheless, MRSA identification in cats with UTIs is a public health hazard because companion animals will be responsible for spreading these bacteria to the household and public surroundings. Tetracyclines were extensively employed for therapy and prevention of bacterial infections in humans, animals, and plants (Malik ). The genes tetK and tetL are most often plasmid-borne (Schwarz and Noble, 1999). Staphylococcal virulence factors are generally divided into four categories: exoenzymes, exotoxins, adhesins, and others (Kuroda ; Zhang ). The coa gene was 100% abundant in the MRSA strains tested. These findings are comparable to those of Akineden . This gene showed no polymorphisms of any size (Algammal ). However, in other investigations, amplification of the coagulase gene led to various amplicons, demonstrating the variability of coagulase gene size. The spa gene showed notable gene polymorphisms with various amplicons (140, 270, and 290 bp). The X region of the spa gene is usually replaced variable (up to 24 times) in various strains (Algammal ).

Conclusion

FLUTD is a common disease affecting tomcats and was detected with high prevalence in older ages >4 and 2–4 years. The OR epidemiological investigations reveal higher odds of associations with E. coli, mixed cases of E. coli and S. aureus, amorphous urate crystals, and triple phosphate crystals, while OR reveals lower odds of associations with S. aureus, amorphous urate, calcium oxalate, amorphous phosphate, triple phosphate, and mixed cases of S. aureus.

The antimicrobial susceptibility reveals a high resistance of E. coli and S. aureus to a large number of the tested antibiotic disks. The most frequently detected S. aureus virulence genes were mecA, coa, spa, and tetK, and E. coli were fimH, iss, iutA, papC, blaTEM, blaCTX-M, and tetA. About 100% of E. coli and 76.1% of S. aureus isolates exhibited multidrug resistance and 32.8% of S. aureus were extensively drug-resistant to 7 antimicrobial agents.