| Literature DB >> 35567480 |
Renzo S Adilardi1,2, Abby F Dernburg1,2,3,4.
Abstract
Repetitive DNA sequences are useful targets for chromosomal fluorescence in situ hybridization. We analyzed recent genome assemblies of Caenorhabditis elegans and Pristionchus pacificus to identify tandem repeats with a unique genomic localization. Based on these findings, we designed and validated sets of oligonucleotide probes for each species targeting at least 1 locus per chromosome. These probes yielded reliable fluorescent signals in different tissues and can easily be combined with the immunolocalization of cellular proteins. Synthesis and labeling of these probes are highly cost-effective and require no hands-on labor. The methods presented here can be easily applied in other model and nonmodel organisms with a sequenced genome.Entities:
Keywords: zzm321990 Caenorhabditis eleganszzm321990 ; zzm321990 Pristionchus pacificuszzm321990 ; in situ hybridization; karyotype; tandem repeats
Mesh:
Substances:
Year: 2022 PMID: 35567480 PMCID: PMC9258534 DOI: 10.1093/g3journal/jkac121
Source DB: PubMed Journal: G3 (Bethesda) ISSN: 2160-1836 Impact factor: 3.542
List of locus-specific oligonucleotide FISH probes for C. elegans.
|
|
|
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
| TTTTGGTAAAAGAAAACCATTGTCAACTGAATAGGTTGATTTGTGTTT |
|
|
|
|
|
|
|
|
| TGCCGATTTGCCGGA |
| |
|
|
|
|
|
|
|
|
| CAGTATTTTGGGGTCTCTCCCTAGTTGTTAGGTAACTTTATACTTTTCTTCTTCTATTTCTT |
|
|
|
|
|
|
|
|
|
| AGGATCAACAGCTTCTCCACCAACTGGAACCACCGATGAGCCTGGATCTT |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| |
|
|
|
|
|
|
|
|
|
| |
|
|
|
|
|
|
|
| ATCCTTTGGAGCTGAAGATT |
| |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| GTGGTGCTTGAGGAGCTGGATTCAGTTGAG |
| |
|
|
|
|
|
|
|
|
|
| |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
List of locus-specific oligonucleotide FISH probes for P. pacificus.
|
|
|
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
| GGCCTTCTTCTCTTCTTCA |
|
|
|
|
|
|
|
|
|
|
| |
|
|
|
|
|
|
|
|
| GGGGA |
|
|
|
|
|
|
|
|
|
| TT |
|
|
|
|
|
|
|
|
|
| ATGA |
|
|
|
|
|
|
|
|
| ACTCAAAATGTCAATGAAATTGGCTAAAAAAATGAAAAGTTGAACTTAGATTTCTCACGCAAAGGACATTGCTTTTCATTATTAAATTAATGATTA |
| |
|
|
|
|
|
|
|
|
| TTTTTGATTGATTGTTAGATTGAGAATGTGAGGCCCATGCAGATAACTATAGATCCATGCATGCAGGATCTTACGATGA |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| AAAGAGATACTGAAATAATCAT |
| |
|
|
|
|
|
|
|
| TCATCATGAATGGGATTACGGTA |
|
Fig. 1.Locus-specific repetitive sequences and FISH probes for C. elegans and P. pacificus. Chromosome map of oligonucleotide FISH probes for (a) C. elegans, and (b) P. pacificus; the span of the tandem repeat targeted by each probe is indicated in parentheses. c, d) Meiotic prophase I nuclei at the pachytene stage after FISH with different combinations of probes. Paired homologous chromosomes display adjacent or overlapping signals for each probe. Gray dashed lines outline the position of the nuclei. All images are maximum intensity projections of deconvolved 3D stacks. Scale bar = 5 μm.
Fig. 2.Oligonucleotide FISH probes show robust signals in different tissues and can be combined with immunolocalization. a) Diagram of an adult C. elegans hermaphrodite and detail of mid anterior region of the body after FISH with chromosome I-1 probe. The distal anterior gonad arm (top) and 4 embryos (bottom) show consistent hybridization signals. White dashed lines demarcate the worm body, the gonad arm, and the embryos. Scale bar = 15 μm. Higher magnification of nuclei in the premeiotic region with unpaired chromosomes and 2 distant FISH signals (left), in the transition zone after chromosome pairing (center), and in an embryo (right). Scale bar = 5 μm. b) P. pacificus diakinesis nuclei showing 6 bivalents after FISH with chromosome X-1 probe, which reveals chiasma position proximal (top) and distal (bottom) to the left of the X chromosome end. Scale bar = 5 μm. c) FISH followed by immunolocalization of the synaptonemal complex protein SYP-4 in strains of C. elegans and P. pacificus expressing SYP-4::HA. Scale bar = 5 μm. Worm diagram adapted from Wikimedia Commons C. elegans hermaphrodite adult-en.svg by K. D. Schroeder, CC-BY-SA 3.0. All images are maximum intensity projections of deconvolved 3D stacks.
Fig. 3.Comparison of signal intensities resulting from hybridization with different probe concentrations. a) Maximum intensity projections of raw (not deconvolved) 3D data showing the pachytene region of P. pacificus gonads after FISH with Cy3-labeled X-1 probes at [0.25 ng/μl (36.5 nM), 1.25 ng/μl (182.5 nM), and 6.25 ng/μl (912.3 nM)]. Representative images of Cy3 channel used for image analysis. Scale bar = 10 μm. b) Graph showing the background-corrected FISH signal intensity for each concentration of X-1 probe (mean + SD, ****P < 0.0001 by Welch’s t-test). c) Disaggregated data from the 3 images measured per concentration, showing the interspecimen variability (mean ± SD).