| Literature DB >> 35559027 |
Xue Li1,2, Ning Ding1,2, Zhichao Zhang1,2, Dehong Tian1, Buying Han1,2, Dehui Liu1,2, Sijia Liu1, Fei Tian1, Dejun Fu3, Xiaoliang Song3, Kai Zhao1.
Abstract
The aim of this study was to locate SSTR5 polymorphisms and evaluate their association with growth traits in Hulun Buir sheep. The study followed up 884 Hulun Buir sheep from birth to 16 months of age, which were born in the same pasture and the same year, and a consistent grazing management strategy was maintained. The birth weight (BRW) was recorded at birth, and body weight (BW), body height (BH), body length (BL), chest circumference (ChC), chest depth (ChD), chest width (ChW), hip width (HW), and cannon circumference (CaC) were measured at 4 and 9 months of age. BW, BH, BL, ChD, HW, and CaC were also recorded at 16 months of age. Based on the growth traits, 233 sheep were selected as experimental animals. Sanger sequencing was performed, and seven single-nucleotide polymorphisms (SNPs) were identified. Association analyses of the SNPs and the growth traits were then conducted. Seven SNPs of the SSTR5 exhibited moderate polymorphism (0.25<PIC<0.5) and were consistent with the Hardy-Weinberg equilibrium. SNP7 (T989C, rs601836309) caused a change in amino acid sequences, while others did not cause any change. The genotypes of SNP1 (C186T, s400914340) were significantly associated with BW, ChW, and ChC at 4 months of age and with HW at 9 months of age (p<0.05). These genotypes also showed extremely significant association with CaC at 4 months of age (p<0.01). The genotypes of SNP7 exhibited a significant association with ChW and CaC at 4 and 9 months of age, respectively. Moreover, the genotypes of SNP3 (T384C, rs413380618)) and SNP4 (T537C, rs605867745) were significantly associated with CaC at 9 months of age (p<0.05). Linkage disequilibrium was observed among the seven SNPs with five haplotypes. However, these haplotypes were not associated with growth traits at different ages. In conclusion, SNP1, SNP3, SNP4, and SNP7 may serve as molecular markers for the growth traits of Hulun Buir sheep.Entities:
Keywords: Hulun Buir sheep; SSTR5; association; growth traits; haplotypes
Year: 2022 PMID: 35559027 PMCID: PMC9086292 DOI: 10.3389/fgene.2022.831599
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Primer information of SSTR5 of Hulun Buir sheep.
| Primer name | Primer sequences (5–3′) | Size (bp) | Tm (°C) |
| E1-2 | F: CCTCGGCTCAGTCGCTC | 761 | 60 |
| R: TAGCACAGGCAGATGACCAG | |||
| E3-4 | F: TGGAACACCTGCAACCTCAG | 759 | 60 |
| R: GTCTCCTCTTCTGCTCCAGC |
Correlations between growth traits of Hulun Buir sheep .
| BW | BL | BH | ChW | ChD | ChC | HW | |
|---|---|---|---|---|---|---|---|
| 4 months of age | |||||||
| BL |
| ||||||
| BH | 0.537
| 0.512
| |||||
| ChW |
|
| 0.368
| ||||
| ChD |
|
|
| 0.689
| |||
| ChC | 0.549
| 0.510
| 0.631
| 0.454
| 0.671
| ||
| HW | 0.611
| 0.538
| 0.653
| 0.475
|
| 0.521
| |
| CaC | 0.447
| 0.358
| 0.331
| 0.411
| 0.495
| 0.348
| 0.456
|
| 9 months of age | |||||||
| BL |
| ||||||
| BH |
|
| |||||
| ChW | 0.647
| 0.612
| 0.568
| ||||
| ChD | 0.663
| 0.654
| 0.605
| 0.431
| |||
| ChC |
| 0.672
|
| 0.620
| 0.648
| ||
| HW |
| 0.561
| 0.678
| 0.336
| 0.560
|
| |
| CaC | 0.697
| 0.545
| 0.642
| 0.602
| 0.526
| 0.565
| 0.425
|
| 16 months of age | |||||||
| BL | 0.479
| ||||||
| BH | 0.184
| 0.346
| |||||
| ChD | 0.343
| 0.173
| 0.363
| ||||
| HW | 0.356
| 0.381
| 0.581
| 0.532
| |||
| CaC | 0.498
| 0.046 | −0.424
| 0.310
| −0.136 | ||
BW= body weight; BL= body length; BH= body height; ChW = chest width; ChD = chest depth; ChC = chest circumference; HW= hip width; CaC = cannon circumference.
Correlations with |r| > 0.7 are in bold, *p < 0.05, **p < 0.01.
Data represent means ± SEM (n = 233).
FIGURE 1Sequencing peak map of the SSTR5 and the mutated SNP1–7 site of Hulun Buir sheep. The sequences were analyzed using DNAMAN software. (A) The site marked by the red arrow was the SNP1 mutation, which was found and identified in exon 2 of SSTR5, C186T (rs400944340). (B) The site marked by the red arrow was the SNP2 mutation, which was found and identified in exon 2 of SSTR5, C351T (rs404123088). (C)The site marked by the red arrow was the SNP3 mutation, which was found and identified in exon 2 of SSTR5, T384C (rs413380618). (D) The site marked by the red arrow was the SNP4 mutation, which was found and identified in exon 2 of SSTR5, T537C (rs605867745). (E) The site marked by the red arrow was the SNP5 mutation, which was found and identified in exon 3 of SSTR5, C576T (rs593868112). (F) The site marked by the red arrow was the SNP6 mutation, which was found and identified in exon 3 of SSTR5, G768A (rs403055255). (G) The site marked by the red arrow was the SNP7 mutation, which was found and identified in exon 4 of SSTR5, T989C (rs601836309).
Physicochemical properties of protein between wild type and mutant type in SNP7.
| Characteristic | Wild type | Mutant type |
| Number of amino acids | 347 | 347 |
| Molecular weight (kDa) | 37828.63 | 37858.71 |
| Theoretical isoelectric point | 9.44 | 9.44 |
| Instability index | 47.68 | 47.60 |
| Aliphatic index | 107.55 | 107.55 |
| Grand average of hydropathicity | 0.532 | 0.539 |
| Signal peptide | 0.2088 | 0.2088 |
| O-glycosylation site | 2 | 1 |
| N-glycosylation site | 3 | 3 |
| Phosphorylation site | 46 | 46 |
Population genetics analyses of SSTR5 of in Hulun Buir sheep
| SNP | Gene frequency | Ho | He | PIC | Ne | HW | |
| A | B | ||||||
| SNP1 (C/T) | 0.2756 | 0.7244 | 0.3993 | 0.3991 | 0.3196 | 1.6648 | 0.5888 |
| SNP2 (C/T) | 0.6197 | 0.3803 | 0.4714 | 0.4807 | 0.3603 | 1.8917 | 0.6642 |
| SNP3 (T/C) | 0.2035 | 0.7965 | 0.3241 | 0.3391 | 0.2716 | 1.4796 | 0.5052 |
| SNP4 (T/C) | 0.2137 | 0.7863 | 0.3360 | 0.3519 | 0.2796 | 1.5061 | 0.5188 |
| SNP5 (C/T) | 0.2756 | 0.7244 | 0.3993 | 0.3991 | 0.3196 | 1.6648 | 0.5888 |
| SNP6 (G/A) | 0.6923 | 0.3077 | 0.4260 | 0.4893 | 0.3353 | 1.7423 | 0.6172 |
| SNP7 (T/C) | 0.2158 | 0.7842 | 0.3385 | 0.3562 | 0.2812 | 1.5117 | 0.5216 |
He = heterozygosity; Ho = homozygosity; PIC= polymorphism information content; Ne = effective allele numbers; HW= Hardy–Weinberg equilibrium.
Group size of population genetics analyses was n = 233.
FIGURE 2Linkage disequilibrium plot of SNPs in SSTR5 of in Hulun Buir sheep. The linkage disequilibrium (LD) was estimated among SSTR5 variations in Hulun Buir sheep. The R 2 values indicated the group of the SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, and SNP7.
FIGURE 3Association analyses of SNPs in SSTR5 with growth traits of Hulun Buir sheep1. (A) Association analyses of SNP1 in SSTR5 with growth traits of Hulun Buir sheep; 4ChW = chest width at 4 months of age; 4ChC = chest circumference at 4 months of age; 4CaC = cannon circumference at 4 months of age; 4HW = hip width at 4 months of age; 4BW = body weight at 4 months of age. (B) Association analyses of SNP7 in SSTR5 with growth traits of Hulun Buir sheep; 4ChW = chest width at 4 months of age; 9CaC = cannon circumference at 9 months of age. (C) Association analyses of SNP3 and SNP4 in SSTR5 with cannon circumference at 9 months of age of Hulun Buir sheep. a,b means with different superscript letters are significantly different (p < 0.05). A,B means with different superscript letters are very significantly different (p < 0.01). 1A group size of Population genetics analyses was n = 233.