Literature DB >> 35551205

Comprehensive microRNA-seq transcriptomic profiling across 11 organs, 4 ages, and 2 sexes of Fischer 344 rats.

Xintong Yao1, Shanyue Sun1, Yi Zi1, Yaqing Liu1, Jingcheng Yang1, Luyao Ren1, Guangchun Chen2, Zehui Cao1, Wanwan Hou1, Yueqiang Song1, Jun Shang1, He Jiang1, Zhihui Li1, Haiyan Wang1, Peipei Zhang1, Leming Shi1, Quan-Zhen Li3, Ying Yu4, Yuanting Zheng5.   

Abstract

Rat is one of the most widely-used models in chemical safety evaluation and biomedical research. However, the knowledge about its microRNA (miRNA) expression patterns across multiple organs and various developmental stages is still limited. Here, we constructed a comprehensive rat miRNA expression BodyMap using a diverse collection of 320 RNA samples from 11 organs of both sexes of juvenile, adolescent, adult and aged Fischer 344 rats with four biological replicates per group. Following the Illumina TruSeq Small RNA protocol, an average of 5.1 million 50 bp single-end reads was generated per sample, yielding a total of 1.6 billion reads. The quality of the resulting miRNA-seq data was deemed to be high from raw sequences, mapped sequences, and biological reproducibility. Importantly, aliquots of the same RNA samples have previously been used to construct the mRNA BodyMap. The currently presented miRNA-seq dataset along with the existing mRNA-seq dataset from the same RNA samples provides a unique resource for studying the expression characteristics of existing and novel miRNAs, and for integrative analysis of miRNA-mRNA interactions, thereby facilitating better utilization of rats for biomarker discovery.
© 2022. The Author(s).

Entities:  

Mesh：

Substances：

Year:  2022        PMID： 35551205      PMCID： PMC9098487          DOI： 10.1038/s41597-022-01285-7

Source DB:  PubMed          Journal:  Sci Data        ISSN： 2052-4463            Impact factor:   8.501


Background & Summary

MicroRNAs (miRNAs) are small noncoding RNAs (21–24 nucleotides) that mediate post-transcriptional regulation of gene expression by binding to the 3′ untranslated regions of messenger RNAs (mRNA)[1-5]. miRNAs play pivotal roles in biological processes such as differentiation, development, tissue growth, and tumor initiation and progression[2,4,6]. miRNAs can serve as potential clinical biomarkers for disease diagnosis, prognosis, and treatment selection[7-9], as well as therapeutic targets for human diseases[10-12]. However, the development of miRNA-based biomarkers and therapies is hampered due to incomplete understanding of the characteristics of miRNA profiles across different organs, various developmental stages, or sexes of rat, an extensively used animal model for evaluating drug safety and understanding drug mechanisms of action. Furthermore, the rat miRNA transcriptome is much less well annotated compared to that of mouse and human, with 764, 1915, and 2588 miRNAs annotated in miRBase v.22.1 (http://www.mirbase.org/) for rat, mouse, and human, respectively[13,14]. Therefore, characterizing rat miRNA expression profiles more comprehensively is warranted, especially with the advancement of high-throughput technologies such as microarrays and next-generation sequencing. Several efforts for constructing a catalog of rat miRNA expression have been reported. For example, Minami et al.[15] reported a dataset of microarray-based expression profiles of 424 miRNAs cross 55 different organs and tissues of 10-week-old male Sprague-Dawley rats. Similarly, Bushel et al.[16] developed the RATEmiRs database consisting of miRNA-seq expression data across 14 organs among 12/13-week-old Sprague Dawley rats of both sexes[17], through six sequencing batches. These studies mainly focused on miRNA expression differences among various organs. However, the diversity and number of expressed miRNAs in animals is not only organ-specific[18,19], but also shows age dependence[1,20,21] and sex biases[22,23]. Specifically, the role of miRNAs in the aging process has often been overlooked and is therefore largely unclear. Ideally, studies on rat transcriptome should simultaneously cover multiple organs across different developmental stages for both sexes. Indeed, in a widely cited previous study[24,25] as part of the Sequencing Quality Control (SEQC) consortium[26], we constructed a comprehensive rat transcriptomic BodyMap with RNA-seq of 320 samples from 11 organs of both sexes of juvenile, adolescence, adult, and aged Fischer 344 rats and identified a large number of transcripts showing organ-specific, age-dependent, or sex-specific expression patterns. The unique rat mRNA dataset has already been widely used by scientific communities to advance our understanding of the dynamics of rat transcriptome, including studies on circRNAs[27-29], the development of annotation tools[30,31], and enrichment of database resources[32,33]. Here, as a follow-up and complementary study, we constructed a comprehensive rat miRNA BodyMap by generating miRNA-seq data from the same 320 samples and described the quality and the dynamic characteristics of miRNA expression profiles across 11 organs, between two sexes, and over the life span of the rats (Fig. 1). We quantified 604 out of the 764 miRNAs annotated in miRbase v22.1 (http://www.mirbase.org/). In addition, to explore the potential of novel miRNA discovery with this dataset, we used the miRDeep2 algorithm[34,35] and identified 12 organ-enriched novel miRNA candidates. The miRNA-seq expression data were then analyzed in conjunction with the corresponding mRNA expression profiles. The quality of the miRNA-seq data was found to be high as seen from various aspects such as raw sequences, mapped sequences, and biological replicates.
Fig. 1

Overview of study design. 320 total RNA samples were collected from 16 female rats and 16 male rats of the Fisher 344 strain, including four rats for each sex under each of the four developmental stages, and ten organs (adrenal gland, brain, heart, kidney, liver, lung, muscle, spleen, thymus, testis, or uterus) per rat. Aliquots of the same RNA samples have also been used to construct mRNA dataset previously[24,25] (a), which makes it possible to integrate miRNA data with mRNA data. (b) Schematic overview of the miRNA-seq workflow: miRNA libraries were prepared and sequenced for each of the 320 samples. For miRNA quantification, adapter sequences were removed, followed by a read-quality filter. Reads of high quality were then mapped to miRBase, piRBase, GtRNAdb, and the NCBI rat transcriptome and genome. In addition, reads from all 320 samples were pooled for novel miRNA discovery.

Overview of study design. 320 total RNA samples were collected from 16 female rats and 16 male rats of the Fisher 344 strain, including four rats for each sex under each of the four developmental stages, and ten organs (adrenal gland, brain, heart, kidney, liver, lung, muscle, spleen, thymus, testis, or uterus) per rat. Aliquots of the same RNA samples have also been used to construct mRNA dataset previously[24,25] (a), which makes it possible to integrate miRNA data with mRNA data. (b) Schematic overview of the miRNA-seq workflow: miRNA libraries were prepared and sequenced for each of the 320 samples. For miRNA quantification, adapter sequences were removed, followed by a read-quality filter. Reads of high quality were then mapped to miRBase, piRBase, GtRNAdb, and the NCBI rat transcriptome and genome. In addition, reads from all 320 samples were pooled for novel miRNA discovery. The dataset we present here can help researchers study the characteristics of rat transcriptome and identify novel miRNAs. In addition, along with the mRNA dataset from the same set of samples, this miRNA-seq dataset provides a unique resource for data integration.

Methods

Organ collection and RNA isolation

Female and male Fischer 344 rats (pair-housed under standard conditions) from the National Center for Toxicological Research of the US Food and Drug Administration animal-breeding colony were euthanized by carbon dioxide asphyxiation at 2, 6, 21 and 104 week-of-age as previously described[24,25]. In summary, 320 tissue samples were derived from 16 female and 16 male rats of the Fischer 344 strain, including four rats for each sex under each of the four developmental stages and ten organs (adrenal gland, brain, heart, kidney, liver, lung, muscle, spleen, thymus, and testis or uterus) per rat. That is, four biological replicates per sample group were used in this study. Ground organ tissue was stored at −80 °C. Total RNA was extracted from ground tissue by using the miRNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol, including treatment with DNase. RNAs longer than 18 nucleotides were recovered with this method. The quality of each RNA sample was examined with an Agilent 2100 Bioanalyzer.

Construction and sequencing of miRNA-seq libraries

Small RNA libraries were constructed using Illumina TruSeq Small RNA Library Prep kit (the sequences of adapters and primers are provided in Table 1) by following the manufacturer’s Reference Guide with some modifications. In brief, 1 µg of total RNA (including miRNA) as input was sequentially ligated with 3′ and 5′ adapters, and the ligated RNA fragments were then reverse transcribed to single-stranded cDNAs using Superscript II reverse transcriptase (Invitrogen) and RT primer. The cDNAs were amplified by PCR with 13 cycles, and the resulting products were further purified with 2× Agencourt AMPure XP beads (Beckman), followed by size selection using the Pippin Prep Size Selection System (Sage Science). The final libraries were validated using Agilent High Sensitivity DNA assay, and subjected to 50 bp single-end sequencing (SE50) on an Illumina HiSeq. 2500. No spike-in controls or negative controls were used in the construction of this dataset.
Table 1

Sequence information of the Truseq-small RNA kit.

NameSequence
3′adapter5′TGGAATTCTCGGGTGCCAAGG
5′adapter5′GUUCAGAGUUCUACAGUCCGACGAUC
PCR primer (RP1)5'AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA
PCR index primer5′ CAAGCAGAAGACGGCATACGAGAT[6 bases]GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
Sequence information of the Truseq-small RNA kit.

Pre-processing and processing of the reads

The adapter sequences were removed with fastp 0.23.2 software (http://opengene.org/fastp/fastp.0.23.2), followed by a quality filter and a length filter. Reads with more than 2 “N” bases were discarded. The clipped reads with length between 16 and 35 nt were retained for alignment to various transcript types, including miRNA (miRbase v22.1, http://www.mirbase.org/), piRNA (piRBase, http://www.regulatoryrna.org/database/piRNA/download.html), tRNA (GtRNAdb, http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Rnorv7/Rnorv7-seq.html), other RNA (NCBI transcriptome, https://www.ncbi.nlm.nih.gov/genome/73), and the rat genome (Rn7, https://hgdownload.soe.ucsc.edu/downloads.html#mammals). The alignment was performed with Bowtie 1.3.1 (http://bowtie-bio.sourceforge.net/manual.shtml) with less than 2 mismatched bases allowed.

Filtering of miRNAs and samples

The following strategies were used to filter miRNAs and samples of questionable quality: (1) the low-expressed miRNAs less than one count per library on average, were discarded. (2) a sample was removed if it failed to cluster with other samples from the same organ type in a hierarchical clustering analysis. Spl_F_104_4 and Brn_M_006_3 samples were removed, as they clustered to uterus samples instead of spleen and brain, respectively. Ultimately, a miRNA expression matrix with 604 miRNAs and 318 samples was obtained for further analysis.

Identification of novel miRNA candidates

First, reads from all 320 samples were pooled for identification of novel miRNA candidates. Using the mapper module provided within miRDeep2.0.1.3, raw reads of the merged samples were subjected to a series of stringent filters (discarding low-quality reads and reads with fewer than 18 nt after clipping the 3′ adapter), and the remaining sequences were then mapped to the rat genome reference (Rn7). Next, the mapped reads were submitted to the miRDeep2 module to detect novel miRNAs with default parameters. Novel miRNAs that have passed the stringent filters (miRDeep2 score ≥10, significant Ranfold P-value and no rfam alert of the possibility of being a rRNA) were selected as the potential novel miRNA candidates. To validate the organ-specificity of the novel miRNA candidates, we quantified the novel miRNA expressions across 320 samples and performed differential expression analysis between any two organs at each developmental stage. A miRNA is considered ‘organ-specific’ if it is over-expressed by at least 1.5 fold (fold-change > 1.5 and adjusted P-value < 0.05) in one organ over all other organs and across all four developmental stages. Finally, the 12 organ-specific sequences were reported as novel miRNA candidates in Online-only Table 1.
Online Only Table 1

Novel miRNA candidates.

miRNA_IDmiRDeep2_scoremature_seqstar_seqpre_seqpositionpiRNA_alertOrgan_enrichedAdr_F_002_1Adr_F_002_2Adr_F_002_3Adr_F_002_4Adr_F_006_1Adr_F_006_2Adr_F_006_3Adr_F_006_4Adr_F_021_1Adr_F_021_2Adr_F_021_3Adr_F_021_4Adr_F_104_1Adr_F_104_2Adr_F_104_3Adr_F_104_4Adr_M_002_1Adr_M_002_2Adr_M_002_3Adr_M_002_4Adr_M_006_1Adr_M_006_2Adr_M_006_3Adr_M_006_4Adr_M_021_1Adr_M_021_2Adr_M_021_3Adr_M_021_4Adr_M_104_1Adr_M_104_2Adr_M_104_3Adr_M_104_4Brn_F_002_1Brn_F_002_2Brn_F_002_3Brn_F_002_4Brn_F_006_1Brn_F_006_2Brn_F_006_3Brn_F_006_4Brn_F_021_1Brn_F_021_2Brn_F_021_3Brn_F_021_4Brn_F_104_1Brn_F_104_2Brn_F_104_3Brn_F_104_4Brn_M_002_1Brn_M_002_2Brn_M_002_3Brn_M_002_4Brn_M_006_1Brn_M_006_2Brn_M_006_3Brn_M_006_4 Brn_M_021_1 Brn_M_021_2 Brn_M_021_3 Brn_M_021_4 Brn_M_104_1 Brn_M_104_2 Brn_M_104_3 Brn_M_104_4 Hrt_F_002_1 Hrt_F_002_2 Hrt_F_002_3 Hrt_F_002_4 Hrt_F_006_1 Hrt_F_006_2 Hrt_F_006_3 Hrt_F_006_4 Hrt_F_021_1 Hrt_F_021_2 Hrt_F_021_3 Hrt_F_021_4 Hrt_F_104_1 Hrt_F_104_2 Hrt_F_104_3 Hrt_F_104_4 Hrt_M_002_1 Hrt_M_002_2 Hrt_M_002_3 Hrt_M_002_4 Hrt_M_006_1 Hrt_M_006_2 Hrt_M_006_3 Hrt_M_006_4 Hrt_M_021_1 Hrt_M_021_2 Hrt_M_021_3 Hrt_M_021_4 Hrt_M_104_1 Hrt_M_104_2 Hrt_M_104_3 Hrt_M_104_4 Kdn_F_002_1 Kdn_F_002_2 Kdn_F_002_3 Kdn_F_002_4 Kdn_F_006_1 Kdn_F_006_2 Kdn_F_006_3 Kdn_F_006_4 Kdn_F_021_1 Kdn_F_021_2 Kdn_F_021_3 Kdn_F_021_4 Kdn_F_104_1 Kdn_F_104_2 Kdn_F_104_3 Kdn_F_104_4 Kdn_M_002_1 Kdn_M_002_2 Kdn_M_002_3 Kdn_M_002_4 Kdn_M_006_1 Kdn_M_006_2 Kdn_M_006_3 Kdn_M_006_4 Kdn_M_021_1 Kdn_M_021_2 Kdn_M_021_3 Kdn_M_021_4 Kdn_M_104_1 Kdn_M_104_2 Kdn_M_104_3 Kdn_M_104_4 Lng_F_002_1 Lng_F_002_2 Lng_F_002_3 Lng_F_002_4 Lng_F_006_1 Lng_F_006_2 Lng_F_006_3 Lng_F_006_4 Lng_F_021_1 Lng_F_021_2 Lng_F_021_3 Lng_F_021_4 Lng_F_104_1 Lng_F_104_2 Lng_F_104_3 Lng_F_104_4 Lng_M_002_1 Lng_M_002_2 Lng_M_002_3 Lng_M_002_4 Lng_M_006_1 Lng_M_006_2 Lng_M_006_3 Lng_M_006_4 Lng_M_021_1 Lng_M_021_2 Lng_M_021_3 Lng_M_021_4 Lng_M_104_1 Lng_M_104_2 Lng_M_104_3 Lng_M_104_4 Lvr_F_002_1 Lvr_F_002_2 Lvr_F_002_3 Lvr_F_002_4 Lvr_F_006_1 Lvr_F_006_2 Lvr_F_006_3 Lvr_F_006_4 Lvr_F_021_1 Lvr_F_021_2 Lvr_F_021_3 Lvr_F_021_4 Lvr_F_104_1 Lvr_F_104_2 Lvr_F_104_3 Lvr_F_104_4 Lvr_M_002_1 Lvr_M_002_2 Lvr_M_002_3 Lvr_M_002_4 Lvr_M_006_1 Lvr_M_006_2 Lvr_M_006_3 Lvr_M_006_4 Lvr_M_021_1 Lvr_M_021_2 Lvr_M_021_3 Lvr_M_021_4 Lvr_M_104_1 Lvr_M_104_2 Lvr_M_104_3 Lvr_M_104_4 Msc_F_002_1 Msc_F_002_2 Msc_F_002_3 Msc_F_002_4 Msc_F_006_1 Msc_F_006_2 Msc_F_006_3 Msc_F_006_4 Msc_F_021_1 Msc_F_021_2 Msc_F_021_3 Msc_F_021_4 Msc_F_104_1 Msc_F_104_2 Msc_F_104_3 Msc_F_104_4 Msc_M_002_1 Msc_M_002_2 Msc_M_002_3 Msc_M_002_4 Msc_M_006_1 Msc_M_006_2 Msc_M_006_3 Msc_M_006_4 Msc_M_021_1 Msc_M_021_2 Msc_M_021_3 Msc_M_021_4 Msc_M_104_1 Msc_M_104_2 Msc_M_104_3 Msc_M_104_4 Spl_F_002_1 Spl_F_002_2 Spl_F_002_3 Spl_F_002_4 Spl_F_006_1 Spl_F_006_2 Spl_F_006_3 Spl_F_006_4 Spl_F_021_1 Spl_F_021_2 Spl_F_021_3 Spl_F_021_4 Spl_F_104_1 Spl_F_104_2 Spl_F_104_3 Spl_F_104_4 Spl_M_002_1 Spl_M_002_2 Spl_M_002_3 Spl_M_002_4 Spl_M_006_1 Spl_M_006_2 Spl_M_006_3 Spl_M_006_4 Spl_M_021_1 Spl_M_021_2 Spl_M_021_3 Spl_M_021_4 Spl_M_104_1 Spl_M_104_2 Spl_M_104_3 Spl_M_104_4 Thm_F_002_1 Thm_F_002_2 Thm_F_002_3 Thm_F_002_4 Thm_F_006_1 Thm_F_006_2 Thm_F_006_3 Thm_F_006_4 Thm_F_021_1 Thm_F_021_2 Thm_F_021_3 Thm_F_021_4 Thm_F_104_1 Thm_F_104_2 Thm_F_104_3 Thm_F_104_4 Thm_M_002_1 Thm_M_002_2 Thm_M_002_3 Thm_M_002_4 Thm_M_006_1 Thm_M_006_2 Thm_M_006_3 Thm_M_006_4 Thm_M_021_1 Thm_M_021_2 Thm_M_021_3 Thm_M_021_4 Thm_M_104_1 Thm_M_104_2 Thm_M_104_3 Thm_M_104_4 Tst_M_002_1 Tst_M_002_2 Tst_M_002_3 Tst_M_002_4 Tst_M_006_1 Tst_M_006_2 Tst_M_006_3 Tst_M_006_4 Tst_M_021_1 Tst_M_021_2 Tst_M_021_3 Tst_M_021_4 Tst_M_104_1 Tst_M_104_2 Tst_M_104_3 Tst_M_104_4 Utr_F_002_1 Utr_F_002_2 Utr_F_002_3 Utr_F_002_4 Utr_F_006_1 Utr_F_006_2 Utr_F_006_3 Utr_F_006_4 Utr_F_021_1 Utr_F_021_2 Utr_F_021_3 Utr_F_021_4 Utr_F_104_1 Utr_F_104_2 Utr_F_104_3 Utr_F_104_4
rno_miR_chr10_8434210UCAUGUGGAAGCCUUGCUAAGCGAGGCAAGGCUGCCGCAUGGCUAGAGGCAAGGCUGCCGCAUGGCUAUGAAGCGGAAGGUCAUGUGGAAGCCUUGCUAAGCCHR10:92664597..92664654:-NAMsc00000000000000000000000000000000000000000000000100000040 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 1 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 11 9 2 10 11 5 17 6 7 7 14 24 21 11 37 17 17 6 8 2 8 7 11 8 19 7 5 22 28 12 9 18 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 3 0 0 0 0 1 0 0 0 0 0 0
rno_miR_chr12_11512600UGGGCACUUAUUUCCUGACAGAAGUCAGGACAUUGUGACCAGGAAGUCAGGACAUUGUGACCAGGAAGUACUUUGCAUGGUUCUGGGCACUUAUUUCCUGACAGACHR12:38528049..38528110:-NAHrt232030010221210021021110110012011530540592412247211014592 1 5 1 7 9 3 5 0 14 9 7 14 6 12 18 11 23 19 26 16 20 28 50 21 5 8 13 14 5 29 20 15 23 20 31 12 13 31 11 32 1 2 3 4 6 3 4 7 3 4 3 4 1 7 1 1 3 1 2 5 6 3 4 4 3 3 0 4 1 3 5 3 1 2 1 0 1 0 0 1 5 3 1 2 0 4 1 2 0 0 0 3 1 1 2 0 2 1 0 2 3 3 4 2 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 1 0 1 1 1 0 0 1 1 2 1 0 0 8 0 0 1 0 3 1 1 1 0 0 2 1 1 0 1 0 1 2 0 1 1 0 3 2 0 0 0 2 0 1 1 0 1 0 0 0 1 1 2 0 2 1 1 0 1 0 0 2 0 0 3 2 0 0 0 2 0 0 0 2 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 1 0 0
rno_miR_chr19_20934310UCUCUCUUCCUCCUCACUGUGGACACGGAUAGGAGGAAGUGAGCUCACGGAUAGGAGGAAGUGAGCUGAGUACCAUGUUCAUCUCUCUCUUCCUCCUCACUGUGGACHR19:53760883..53760944:-piR-rno-676178Brn0000000001000010000020010000000017974949317180373566681261 9 5 4 8 2 3 6 9 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 0 1 0 0 0 1 1 0 0 0 1 0 0 1 1 1 0 2 0 1 0 2 0 1 0 1 0 0 0 1 4 0 2 1 2 1 5 0 0 0 2 1 1 1 1 1 2 2 0 1 5 3 4 0 1 2 3 0 1 0 3 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 5 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 1 0 0 0 1 0 0 0 1 0 0 1 1 0 1 0 1 0 0 1 1 0 1 0 0 0 0 0 2 0 0 1 0 2 1 4 1 1 1 1 1 0 3 0 0 0 0 0 0 0 1 1 1 0 1 0 2 0 2 2 1 1 0 0 0
rno_miR_chr1_3858940CCUCCCUGUCUCCUCCCUGCAGCUCAGGGAGGGGACACGGAGUGCCUCAGGGAGGGGACACGGAGUGCAGGCACUCACCACUGGCCCUCCCUGUCUCCUCCCUGCAGCHR1:84368875..84368937:-piR-rno-2470659Msc00000000000000000002000001000000010063010001001000010050 0 1 0 1 2 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 1 2 1 0 0 0 1 0 0 0 0 0 1 0 0 1 0 1 0 0 0 1 0 0 1 0 1 1 0 1 3 0 0 1 3 0 2 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 11 19 7 28 11 26 14 10 20 18 11 19 31 25 45 35 19 13 16 6 18 13 23 10 26 20 6 34 42 23 28 43 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 11 0 0 2 0 0 2 0 0 0 0 0 0 0 0 2 0 0 0 1 0 0 1 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 1 0 0 0 0 0 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
rno_miR_chr20_236112400UGUGCCCUGUUCCCCCUCCCUGCUGGGGGGUGGGAGGGGCAUCAGCUGGGGGGUGGGAGGGGCAUCAGCUCCUAUUCACCGGUGCUGUGCCCUGUUCCCCCUCCCUGCCHR20:4028583..4028645:+NAAdr8011078911067415122712420911016817411880123137105711212449614116312710944145116168215730101100000010013010000220 1 0 0 1 1 0 1 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 1 2 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 2 0 0 0 0 0 0 18 0 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 1 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 1 0 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 0 1 0 0 0
rno_miR_chr3_28394310AUAUAGAGGAUAAUAUAAAUGUAUUUAUAUUAUCCUCUAUAUGUAUUUAUAUUAUCCUCUAUAUGUAUAUAUAUGUAUAAUAUAGAGGAUAAUAUAAAUGUCHR3:36690295..36690352:-NAMsc00000000000100000000000000000000000000000000000000000000 0 0 0 0 0 0 1 0 0 1 0 0 0 0 1 0 1 0 1 0 0 0 1 1 0 0 0 0 0 0 0 0 0 1 2 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 0 0 1 7 1 2 0 3 1 2 0 0 2 0 0 0 0 0 2 1 2 1 0 1 1 5 4 2 2 5 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 8 3 1 10 13 11 9 11 19 9 7 14 23 10 39 23 6 5 8 4 18 14 21 13 25 5 3 28 27 13 36 22 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0
rno_miR_chr5_341261800CACAGCGGAGCUGGGCACUGGCGUCCACCCCUGGCUCUGCUGGAUCACAGCGGAGCUGGGCACUGGCGUCACGCAGUCCUUGUUGCCACCCCUGGCUCUGCUGGAUCHR5:149874651..149874712:+NABrn1212113011122130214110010410030082128921291321128613287106669737829314841251328574928891 77 89 72 105 123 94 73 81 2 1 0 0 0 0 1 1 0 2 0 0 4 1 4 5 1 1 1 2 0 3 1 0 1 0 2 2 0 2 4 0 1 5 4 3 2 1 3 6 2 1 2 0 4 1 2 2 3 1 5 3 2 2 0 3 1 2 1 2 1 1 1 4 1 1 0 0 0 0 0 1 1 0 0 1 2 1 0 0 0 2 1 2 0 2 0 0 1 2 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 1 0 1 0 0 0 1 0 0 0 2 1 0 0 0 0 1 0 1 0 0 0 0 0 1 3 0 1 1 1 0 1 0 0 1 0 0 0 20 0 1 0 2 0 1 0 0 1 0 1 1 1 2 0 0 0 0 0 1 0 0 0 0 0 1 1 2 0 0 1 0 0 0 1 0 0 2 0 0 1 1 0 1 0 0 0 1 1 0 3 2 0 0 0 1 0 0 0 0 1 1 2 0 3 7 0 3 3 0 1 0 6 1 2 3 2 0 4 0
rno_miR_chr7_385408000UUUCCUCUCUGCCCCAUAGGGUGCCUCUAGGGAAGAGAAGGUUGGUUUCCUCUCUGCCCCAUAGGGUGUAGCUCUAACUACCCUCUAGGGAAGAGAAGGUUGGCHR7:36786031..36786089:+NABrn12024133120100012221001000000100516785774720484499327660357418224561134223394776191033536545493579391262 324 388 232 372 440 333 365 216 0 2 0 0 2 0 5 0 1 0 1 0 0 1 0 1 2 1 2 0 0 1 1 0 0 0 1 0 0 0 0 0 1 1 2 4 2 0 0 1 0 0 0 0 0 0 0 0 8 10 7 3 1 0 0 0 0 0 0 0 0 0 0 0 3 4 1 2 1 0 0 1 1 0 0 0 0 1 2 1 3 1 0 4 0 2 0 0 0 0 2 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 7 0 1 3 1 0 1 0 1 0 1 0 0 1 0 0 5 3 2 4 0 0 1 0 0 1 1 1 0 0 0 1 31 11 22 26 9 4 1 4 1 1 0 1 0 0 0 116 25 35 34 13 6 6 8 3 0 0 1 1 0 1 0 0 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 2 1 0 3 3 0 0 0 0 1 0 1 0 0 0 0 0 8 5 7 6 1 1 0 1 0 2 1 0 0 0 0 1 10 10 6 5 3 2 0 1 1 1 1 2 0 0 1 0
rno_miR_chr7_400351300ACUCUAGCUGCCAAAGGCGCUCGCUUUGCUCAGCCAGUGUAGAACUCUAGCUGCCAAAGGCGCUUCUCCUUCUGAACAGAGCGCUUUGCUCAGCCAGUGUAGACHR7:26676114..26676174:-piR-rno-2374001Brn1212110211320011000110111100110012614413112367624983741105178264358141611628895781108036 40 53 58 46 51 47 51 25 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 4 1 0 0 0 0 0 0 0 0 0 0 0 0 5 4 3 2 0 0 2 0 1 1 0 0 0 2 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 1 2 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 16 1 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 1 15 2 25 9 1 0 0 1 0 1 0 0 1 0 0 0 5 14 1 5 2 0 1 2 3 4 1 3 0 1 1 0
rno_miR_chrX_481591100CAAAUCUUAUUUGAGCACCUGUAGGUCCUCAGUAAGUAUUUGUUAGGUCCUCAGUAAGUAUUUGUUGAAAAAAUAAAUGAACCAACAAAUCUUAUUUGAGCACCUGUCHRX:110687149..110687212:+NABrn00000000000000000000000000000010356125467754289343532959181539133633202854465131 31 65 43 54 49 42 48 32 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 2 3 0 1 1 1 0 1 1 2 1 0 0 2 0 0 1 4 1 2 0 0 1 1 1 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 1 0 0 1 0 0 0 1 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
rno_miR_chrX_484683900UGACUUUCCAGAGAACCCUUGAAAGGGUUCUCUGGAAAGUCGGUAAGGGUUCUCUGGAAAGUCGGUUGUGUUGGAUGGUGUUUUGCUGACUUUCCAGAGAACCCUUGACHRX:35090149..35090213:-NAThm147212636753489105386711075355246572663361361365102384487911469 4 9 5 7 13 6 5 9 7 6 3 2 2 3 7 2 8 4 3 5 4 4 18 9 4 10 7 9 5 4 5 3 5 3 8 3 3 1 7 3 8 8 11 13 3 5 3 8 3 6 2 2 1 5 15 10 8 7 9 9 6 5 3 1 3 1 5 7 2 18 7 12 23 16 6 9 19 10 9 19 25 4 0 11 0 25 5 8 9 25 7 16 27 16 14 2 18 9 10 6 23 24 20 20 2 2 0 1 2 0 0 0 0 0 1 2 0 0 0 2 0 0 2 1 0 2 1 1 0 0 0 0 0 3 1 3 6 5 0 4 5 0 0 0 0 1 0 1 0 2 2 0 4 5 5 4 3 0 3 1 0 0 1 0 0 2 3 0 32 31 56 28 43 33 42 69 27 66 32 26 25 29 39 132 18 13 35 8 49 61 22 27 59 88 61 79 65 79 33 27 122 140 117 106 151 64 115 302 122 194 74 115 27 144 54 151 51 160 60 49 105 126 129 61 56 190 36 142 16 73 27 67 2 1 2 7 2 9 1 1 5 5 8 2 0 2 2 2 9 14 6 10 9 13 9 6 23 25 12 9 15 8 7 6
rno_miR_chrX_488785500GUUGGCACUUUCUUGAGUGAGGCACUCCAAAAGUGCCAAUCAGCACUCCAAAAGUGCCAAUCAGGAUAACUAAAAUAUGGUUGGCACUUUCUUGAGUGAGGCHRX:146675517..146675575:-piR-rno-317792Tst2104011031001000000101131013000010020100120101000200011710 0 12 3 4 0 1 1 0 15 21 4 9 3 15 15 6 20 2 11 9 9 7 33 7 10 3 5 17 13 18 11 10 11 13 17 5 8 5 30 11 8 10 18 13 21 24 12 12 2 11 4 7 5 6 11 9 13 9 7 11 15 3 4 12 4 1 3 24 3 10 7 4 20 7 5 10 17 2 9 16 20 10 6 24 9 13 4 5 8 11 2 11 20 5 16 5 13 10 6 9 1 7 7 2 1 1 5 4 4 1 0 2 0 0 2 0 0 0 0 1 5 8 7 2 2 0 0 1 0 0 0 0 1 1 0 0 0 1 0 2 1 0 1 0 0 0 0 0 0 0 0 0 2 2 2 0 0 2 1 1 0 1 0 1 0 1 1 0 2 0 1 0 1 0 0 0 1 0 1 1 1 0 5 324 0 0 1 0 0 1 0 0 0 1 0 3 1 1 0 0 1 1 0 0 0 0 3 0 0 0 0 0 1 0 1 1 0 0 0 0 0 1 1 0 0 0 0 0 0 1 0 1 739 320 930 1329 603 701 136 249 2222 1352 391 363 177 245 39 56 4 5 6 10 3 0 0 1 2 2 4 3 0 0 3 0

Data Records

The miRNA-seq dataset generated in study is available in the NCBI Gene Expression Omnibus (GEO) with series accession number GSE172269[36]. This accession contains both the raw sequence data files (fq.gz format) and the processed data files (raw counts of mapped sequencing reads) used in this report. All data can be used without restrictions.

Technical Validation

Quality of RNA samples

The quality of RNA samples was assessed with an Agilent Bioanalyzer. Most samples showed good RNA Integrity Number (RIN 9.08 ± 1.08, mean ± sd), except for the eight week-2 spleen samples with RIN bellow 5.2. The RNA integrity numbers of all the 320 samples were listed in Online-only Table 2.
Online Only Table 2

Metadata.

Sample_IDColnames.miRNARNA_Sample_IDRNA_A260.A280_RatioRNA_RINOrganOrgan_Abbr_2charsOrgan_Abbr_3charsSexAgeBioRepGroupTotal_forAlignTotal_sequencemRNAmiRNAmiscRNAother_RNAother_from_GenomepiRNArRNAtRNAtotal_genomeunmappedGEO_AccessionSRA_ID
Adr_F_002_1lane3_Adr_F_2_1_11301.979.3AdrenalAdAdrF21Adr-F-2450038657566314123431160391806115281658069823849778235361440007544693GSM5251160SRR14265264
Adr_F_002_2lane4_Adr_F_2_2_11381.999.1AdrenalAdAdrF22Adr-F-24940517624677171007340198826128522110331210782668215855825481625360128GSM5251161SRR14265265
Adr_F_002_3lane5_Adr_F_2_3_114629.5AdrenalAdAdrF23Adr-F-2342602137582231963125676061013111177436065586367780715298336402031247GSM5251162SRR14265266
Adr_F_002_4lane2_Adr_F_2_4_11541.998.5AdrenalAdAdrF24Adr-F-24562277638069017676624459246058154689171538130168016506971648443430268905GSM5251163SRR14265267
Adr_F_006_1lane8_Adr_F_6_1_11321.999.4AdrenalAdAdrF61Adr-F-6662326279324844549849702202170241994112203901747115692137584645691796154GSM5251164SRR14265268
Adr_F_006_2lane2_Adr_F_6_2_11402.029.3AdrenalAdAdrF62Adr-F-623541392778635172981710772742102783353933681344595150830230990322236GSM5251165SRR14265269
Adr_F_006_3lane3_Adr_F_6_3_11482.029.5AdrenalAdAdrF63Adr-F-642895635074118412253100241184689294640208292587786344780420861341036GSM5251166SRR14265270
Adr_F_006_4lane8_Adr_F_6_4_11562.028.9AdrenalAdAdrF64Adr-F-6654471675831216996545540363011171235114796132015916148863175638430586851GSM5251167SRR14265271
Adr_F_021_1lane7_Adr_F_21_1_11341.899.5AdrenalAdAdrF211Adr-F-21712664177121352487461509831158109445801016052264657948064701570360211GSM5251168SRR14265272
Adr_F_021_2lane6_Adr_F_21_2_11421.939.5AdrenalAdAdrF212Adr-F-21702144675402562827257483421275244438997687112676235645520688063980208GSM5251169SRR14265273
Adr_F_021_3lane2_Adr_F_21_3_11501.899.5AdrenalAdAdrF213Adr-F-2139643504668361181093018220920255300737144533544463644857387622155240GSM5251170SRR14265274
Adr_F_021_4lane6_Adr_F_21_4_11581.899AdrenalAdAdrF214Adr-F-216886896747034139012562554916552074041057417249245268046547673730883384GSM5251171SRR14265275
Adr_F_104_1lane6_Adr_F_100_1_11362.019.5AdrenalAdAdrF1041Adr-F-104620777769177683542748725131693211221783078295758665025920607509066471GSM5251172SRR14265276
Adr_F_104_2lane3_Adr_F_100_2_114429.2AdrenalAdAdrF1042Adr-F-104361375240667032154427284781056145623593815384226327812868353968843102GSM5251173SRR14265277
Adr_F_104_3lane4_Adr_F_100_3_11521.998.9AdrenalAdAdrF1043Adr-F-10432221823697435163192458946796200831468354006375008013473316321934265GSM5251174SRR14265278
Adr_F_104_4lane5_Adr_F_100_4_11601.998.8AdrenalAdAdrF1044Adr-F-104576454162613003225146972331450213978641256358586381812057568895943771GSM5251175SRR14265279
Adr_M_002_1lane6_Adr_M_2_1_11291.959.2AdrenalAdAdrM21Adr-M-25850008666037548145410411121998637476416122249317716772915570439160188GSM5251176SRR14265280
Adr_M_002_2lane7_Adr_M_2_2_11372.049.4AdrenalAdAdrM22Adr-M-244867385289630433542909460200613961970375103093617216564024437608954799GSM5251177SRR14265281
Adr_M_002_3lane7_Adr_M_2_3_11451.989.1AdrenalAdAdrM23Adr-M-2424629549462414060428338311922712456936195400314053685913414317948880GSM5251178SRR14265282
Adr_M_002_4lane3_Adr_M_2_4_11532.028.9AdrenalAdAdrM24Adr-M-24548261606211770430284741628116963785899127753112745519609445029047473GSM5251179SRR14265283
Adr_M_006_1lane8_Adr_M_6_1_113129.4AdrenalAdAdrM61Adr-M-6643606677582725566145789092508174244105009122719012393589456628836479154GSM5251180SRR14265284
Adr_M_006_2lane7_Adr_M_6_2_11391.999.3AdrenalAdAdrM62Adr-M-642078994749416518252966133220395703742357944869159066970410136164754GSM5251181SRR14265285
Adr_M_006_3lane5_Adr_M_6_3_11472.019.5AdrenalAdAdrM63Adr-M-64592103501735438684345690615891618267362064330310291866939450853046318GSM5251182SRR14265286
Adr_M_006_4lane8_Adr_M_6_4_115529AdrenalAdAdrM64Adr-M-64900977622705859294341724125071968909525085197912361378376476819775827GSM5251183SRR14265287
Adr_M_021_1lane1_Adr_M_21_1_11331.958.6AdrenalAdAdrM211Adr-M-215596506623820419685477299087431542722085427732230558850546592675279GSM5251184SRR14265288
Adr_M_021_2lane4_Adr_M_21_2_11411.969.5AdrenalAdAdrM212Adr-M-216948367748935629297582445613321672547043859857754390137145681729565478GSM5251185SRR14265289
Adr_M_021_3lane5_Adr_M_21_3_11491.999.2AdrenalAdAdrM213Adr-M-21391674342157741867130892948331098454728142926245666137756383381638135GSM5251186SRR14265290
Adr_M_021_4lane1_Adr_M_21_4_11571.949AdrenalAdAdrM214Adr-M-21600750667172362863648969661233199531948905773285329061500584690094132GSM5251187SRR14265291
Adr_M_104_1lane2_Adr_M_100_1_11351.999.5AdrenalAdAdrM1041Adr-M-104455964653035922235534470291153217230606766240416268977338446969547135GSM5251188SRR14265292
Adr_M_104_2lane1_Adr_M_100_2_11431.999.4AdrenalAdAdrM1042Adr-M-1047407930805323328105599742413233521859744667756684435545787218182114868GSM5251189SRR14265293
Adr_M_104_3lane4_Adr_M_100_3_11512.028.8AdrenalAdAdrM1043Adr-M-104747413781992203783559150691841299737916378983899962750052731655579950GSM5251190SRR14265294
Adr_M_104_4lane1_Adr_M_100_4_11591.998.9AdrenalAdAdrM1044Adr-M-104636426971054823204452071321387199259874656059605380979934619999397279GSM5251191SRR14265295
Brn_F_002_1lane2_Brn_F_2_1_1662.059.9BrainBrBrnF21Brn-F-227610123407799361292044053143365695556674425073864248907269450727979GSM5251192SRR14265296
Brn_F_002_2lane6_Brn_F_2_2_1742.049.6BrainBrBrnF22Brn-F-241554164606393324153315225136351014561265729843847543164404226944650GSM5251193SRR14265297
Brn_F_002_3lane4_Brn_F_2_3_1822.049.1BrainBrBrnF23Brn-F-235286483919174308892760031130760266498655033334221747819344576932921GSM5251194SRR14265298
Brn_F_002_4lane6_Brn_F_2_4_1902.0610BrainBrBrnF24Brn-F-235450613978819346832750156150445704578635334134069844107344795636933GSM5251195SRR14265299
Brn_F_006_1lane8_Brn_F_6_1_1682.059.1BrainBrBrnF61Brn-F-650996116015114390844056823167283257812266402234303579328493194374963GSM5251196SRR14265300
Brn_F_006_2lane8_Msc_F_6_2_11082.049.3BrainBrBrnF62Brn-F-641345394607510308303321993124443363587095549303243440529401553350507GSM5251197SRR14265301
Brn_F_006_3lane7_Brn_F_6_3_1842.069BrainBrBrnF63Brn-F-637190644077991485972867311190836180716975411453456779715362652337944GSM5251198SRR14265302
Brn_F_006_4lane8_Brn_F_6_4_1922.059.7BrainBrBrnF64Brn-F-653789975980697472884246273196757386814607653894951564862522396964857GSM5251199SRR14265303
Brn_F_021_1lane2_Brn_F_21_1_1702.029.5BrainBrBrnF211Brn-F-2144159825069706362283527950142569053639545817253636756135431767143145GSM5251200SRR14265304
Brn_F_021_2lane5_Brn_F_21_2_1781.879.1BrainBrBrnF212Brn-F-21528960363973033931642586171616112035585346468863768292156517096542761GSM5251201SRR14265305
Brn_F_021_3lane4_Brn_F_21_3_1861.99.1BrainBrBrnF213Brn-F-2133462983879400436652583531171763198666524457062618278854325750336793GSM5251202SRR14265306
Brn_F_021_4lane4_Brn_F_21_4_1941.879.6BrainBrBrnF214Brn-F-2159303676662147426524958127181146246642236999993111736061579932450131GSM5251203SRR14265307
Brn_F_104_1lane3_Brn_F_100_1_1722.049.3BrainBrBrnF1041Brn-F-1042172847247627215249178218566821501222842946671104110394213207314858GSM5251204SRR14265308
Brn_F_104_2lane7_Brn_F_100_2_1801.919.2BrainBrBrnF1042Brn-F-10437993524327576640692883735246563061964035503943392361614370052643688GSM5251205SRR14265309
Brn_F_104_3lane6_Brn_F_100_3_1881.969.7BrainBrBrnF1043Brn-F-10452307875651671354714258441153266046691296563144010246844510135356908GSM5251206SRR14265310
Brn_F_104_4lane5_Brn_F_100_4_1961.979.6BrainBrBrnF1044Brn-F-104807360310171422491226116453827396143823103245639714497445493841417865317114025GSM5251207SRR14265311
Brn_M_002_1lane1_Brn_M_2_1_1652.0610BrainBrBrnM21Brn-M-22274091264496422703174282999349501457283147793421925512219516537827GSM5251208SRR14265312
Brn_M_002_2lane1_Brn_M_2_2_1732.049.9BrainBrBrnM22Brn-M-234606143837464307502628208122294080686644517495187773683333512460381GSM5251209SRR14265313
Brn_M_002_3lane7_Brn_M_2_3_1812.069.6BrainBrBrnM23Brn-M-224592112809048272071826961120635742426834092814097050420239725624741GSM5251210SRR14265314
Brn_M_002_4lane3_Brn_M_2_4_1892.039.9BrainBrBrnM24Brn-M-221528862508362389401625754146827958550563366492631719736210335621008GSM5251211SRR14265315
Brn_M_006_1lane8_Brn_M_6_1_1672.059.6BrainBrBrnM61Brn-M-6485086056706083637538054511501877187485660180843717131245469465668189GSM5251212SRR14265316
Brn_M_006_2lane8_Brn_M_6_2_1751.939.3BrainBrBrnM62Brn-M-648974915661683392473868768171752915621337145023988465398476928752927GSM5251213SRR14265317
Brn_M_006_3lane3_Brn_M_6_3_1832.089.1BrainBrBrnM63Brn-M-69415750107946639360565708334952101421247153211792297791105057923287977016GSM5251214SRR14265318
Brn_M_006_4lane7_Brn_M_6_4_1912.039.4BrainBrBrnM64Brn-M-63030237335193624358240729495936433375994374302700133441296179125722GSM5251215SRR14265319
Brn_M_021_1lane5_Brn_M_21_1_1692.039.6BrainBrBrnM211Brn-M-2140953214409322291853271606128756583570735505493452862766401366231744GSM5251216SRR14265320
Brn_M_021_2lane3_Brn_M_21_2_1771.988.9BrainBrBrnM212Brn-M-2145916975319210368013699507173243127645126325003336442263449670737891GSM5251217SRR14265321
Brn_M_021_3lane2_Brn_M_21_3_1852.059.2BrainBrBrnM213Brn-M-2134958924020069288742767837124154873520314789073047251285342186330372GSM5251218SRR14265322
Brn_M_021_4lane4_Brn_M_21_4_1932.049.2BrainBrBrnM214Brn-M-21593740264894124279847779511776875767885774115848743102076579162056467GSM5251219SRR14265323
Brn_M_104_1lane6_Brn_M_100_1_1711.939.5BrainBrBrnM1041Brn-M-10451151435689156373404151315147051804654956215374051286224496390459446GSM5251220SRR14265324
Brn_M_104_2lane2_Brn_M_100_2_1791.929.3BrainBrBrnM1042Brn-M-10436902494268520260582967320108365183498224781843601335314361195931272GSM5251221SRR14265325
Brn_M_104_3lane1_Brn_M_100_3_1871.969.5BrainBrBrnM1043Brn-M-10447398265301027362993761065156977717792046025055065255155458950175660GSM5251222SRR14265326
Brn_M_104_4lane5_Brn_M_100_4_1952.059.3BrainBrBrnM1044Brn-M-10438410274172736277063084909113263041526134842193912154382375895433904GSM5251223SRR14265327
Hrt_F_002_1lane3_Hrt_F_2_1_11621.969.4HeartHeHrtF21Hrt-F-24001639466061843511325524813819909467165696074044311911394315122913GSM5251224SRR14265328
Hrt_F_002_2lane2_Hrt_F_2_2_11701.919.5HeartHeHrtF22Hrt-F-236174024345074582112744112175516547689326078776502421455354865033489GSM5251225SRR14265329
Hrt_F_002_3lane5_Hrt_F_2_3_11781.849.3HeartHeHrtF23Hrt-F-230848423402660503132337243153113598565805070077438819145302951425037GSM5251226SRR14265330
Hrt_F_002_4lane1_Hrt_F_2_4_11861.919.1HeartHeHrtF24Hrt-F-238839074582120557712893566176316444764516758998573021099377620757184GSM5251227SRR14265331
Hrt_F_006_1lane5_Hrt_F_6_1_11642.049.3HeartHeHrtF61Hrt-F-6183927520211113175814794418334655282352433642702710789180889213173GSM5251228SRR14265332
Hrt_F_006_2lane2_Hrt_F_6_2_11722.049.3HeartHeHrtF62Hrt-F-63045779376611248852233727813549319566394719035691929904298210433611GSM5251229SRR14265333
Hrt_F_006_3lane6_Hrt_F_6_3_11801.959HeartHeHrtF63Hrt-F-6608877767752807806346734602575136879865210461109537620775596618460079GSM5251230SRR14265334
Hrt_F_006_4lane7_Hrt_F_6_4_11882.068.9HeartHeHrtF64Hrt-F-6390120446669587253225511922553130859220999420310208418050380603755296GSM5251231SRR14265335
Hrt_F_021_1lane2_Hrt_F_21_1_11662.019HeartHeHrtF211Hrt-F-2144573725701188837422848789257413867104138115606415662527944435007263629GSM5251232SRR14265336
Hrt_F_021_2lane7_Hrt_F_21_2_11742.018.8HeartHeHrtF212Hrt-F-214229132513655185322270033626121287796511108187916860624625412688456364GSM5251233SRR14265337
Hrt_F_021_3lane1_Hrt_F_21_3_118228.8HeartHeHrtF213Hrt-F-21399617148054306385128168001990112119644580931710634619440387657670771GSM5251234SRR14265338
Hrt_F_021_4lane8_Hrt_F_21_4_11901.988.7HeartHeHrtF214Hrt-F-2146311926080314945043029223282513879116766109991715284831684448397489546GSM5251235SRR14265339
Hrt_F_104_1lane8_Hrt_F_100_1_11682.019.1HeartHeHrtF1041Hrt-F-1044345320563523173892298199923951333010743788451411049387193418944284067GSM5251236SRR14265340
Hrt_F_104_2lane2_Hrt_F_100_2_11762.028.7HeartHeHrtF1042Hrt-F-10442289715146149486233150333158910749898717397467910850150412317858802GSM5251237SRR14265341
Hrt_F_104_3lane3_Hrt_F_100_3_11842.048.8HeartHeHrtF1043Hrt-F-1044327592497694640060341976312218398729526547683827448392423035643764GSM5251238SRR14265342
Hrt_F_104_4lane4_Hrt_F_100_4_119228.7HeartHeHrtF1044Hrt-F-10452355536030346121209351153532771697313222812006759097488650507913470032GSM5251239SRR14265343
Hrt_M_002_1lane8_Hrt_M_2_1_11612.069.7HeartHeHrtM21Hrt-M-246951655362180730963462099238917720817608980449218821627459099246242GSM5251240SRR14265344
Hrt_M_002_2lane6_Hrt_M_2_2_11692.049.5HeartHeHrtM22Hrt-M-243619844994616669293232588224015014709568212049486318044427220740146GSM5251241SRR14265345
Hrt_M_002_3lane5_Hrt_M_2_3_11772.079.5HeartHeHrtM23Hrt-M-234467773837306531172603448164313426529216186016638315177339362822061GSM5251242SRR14265346
Hrt_M_002_4lane6_Hrt_M_2_4_11852.069.2HeartHeHrtM24Hrt-M-251291495771681922003788343292318541898059821738498822714502865547462GSM5251243SRR14265347
Hrt_M_006_1lane7_Hrt_M_6_1_11632.059HeartHeHrtM61Hrt-M-646392915069500652523706515190711117789676500046647220132454519038925GSM5251244SRR14265348
Hrt_M_006_2lane4_Hrt_M_6_2_11712.049.1HeartHeHrtM62Hrt-M-64902817555147060659398985318829127645346742344893813222481461540368GSM5251245SRR14265349
Hrt_M_006_3lane4_Hrt_M_6_3_11792.039.2HeartHeHrtM63Hrt-M-646160975112506529463734466161610351708786221935782219444452170546381GSM5251246SRR14265350
Hrt_M_006_4lane1_Hrt_M_6_4_11872.048.7HeartHeHrtM64Hrt-M-646978645372437835313524231234313193972347850647623244954456466171082GSM5251247SRR14265351
Hrt_M_021_1lane1_Hrt_M_21_1_11652.028.7HeartHeHrtM211Hrt-M-2146355035298234637273154429201513549129015951265170298462644462386104941GSM5251248SRR14265352
Hrt_M_021_2lane3_Hrt_M_21_2_11732.028.7HeartHeHrtM212Hrt-M-213754766443384171185265990520178409778527940978255017052367598441699GSM5251249SRR14265353
Hrt_M_021_3lane6_Hrt_M_21_3_118128.7HeartHeHrtM213Hrt-M-214636124531538272756328733521771027710057196643711121021744451847063617GSM5251250SRR14265354
Hrt_M_021_4lane7_Hrt_M_21_4_11892.028.5HeartHeHrtM214Hrt-M-213276534380687961428229243417878723798176783217940728721318868845896GSM5251251SRR14265355
Hrt_M_104_1lane5_Hrt_M_100_1_11671.948.7HeartHeHrtM1041Hrt-M-1043750972429466918126425703044419137241509976399676656165562364137358174GSM5251252SRR14265356
Hrt_M_104_2lane4_Hrt_M_100_2_11752.038.9HeartHeHrtM1042Hrt-M-1042907554348643944416214629214268995698345082085130236096282895840985GSM5251253SRR14265357
Hrt_M_104_3lane3_Hrt_M_100_3_11831.968.6HeartHeHrtM1043Hrt-M-1043605471420129511629525714972913115091121226543814371044090350248148954GSM5251254SRR14265358
Hrt_M_104_4lane8_Hrt_M_100_4_11912.018.6HeartHeHrtM1044Hrt-M-1045454066661180993085385971228771298611377311341669203370632529868874802GSM5251255SRR14265359
Kdn_F_002_1lane8_Kdn_F_2_1_11942.049.3KidneyKiKdnF21Kdn-F-2730562182224675094062968792285166618294161632968867107154718033863565GSM5251256SRR14265360
Kdn_F_002_2lane2_Kdn_F_2_2_12022.018KidneyKiKdnF22Kdn-F-2664011178288637398942728062859220741744601372921111751547109645792262142GSM5251257SRR14265361
Kdn_F_002_3lane2_Kdn_F_2_3_12102.028.5KidneyKiKdnF23Kdn-F-2567840867471325352444317932372186566825692388711099431459560677437467GSM5251258SRR14265362
Kdn_F_002_4lane6_Kdn_F_2_4_121828.8KidneyKiKdnF24Kdn-F-2652303271754934796253353082162146757104284182712247930688641985156889GSM5251259SRR14265363
Kdn_F_006_1lane6_Kdn_F_6_1_11962.048.8KidneyKiKdnF61Kdn-F-668624837600319510095547836203713727844359492235784793717672018562652GSM5251260SRR14265364
Kdn_F_006_2lane8_Kdn_F_6_2_12041.958.5KidneyKiKdnF62Kdn-F-6673288574718324818953788212140151428979093689610002791042659191970838GSM5251261SRR14265365
Kdn_F_006_3lane3_Kdn_F_6_3_12121.978.5KidneyKiKdnF63Kdn-F-648774695548147371423871383162810212530317675546651438463480461531542GSM5251262SRR14265366
Kdn_F_006_4lane6_Kdn_F_6_4_12202.059KidneyKiKdnF64Kdn-F-665074537019471496955380203215213992807737681996930289451640440753686GSM5251263SRR14265367
Kdn_F_021_1lane5_Kdn_F_21_1_11981.968.6KidneyKiKdnF211Kdn-F-216170901666252439529489111517361712571379785214104726214171606016245906GSM5251264SRR14265368
Kdn_F_021_2lane8_Kdn_F_21_2_12062.038.3KidneyKiKdnF212Kdn-F-2175083108525495524086267251222816172884278916927441747063738678868652GSM5251265SRR14265369
Kdn_F_021_3lane5_Kdn_F_21_3_12142.028.5KidneyKiKdnF213Kdn-F-2135639713855026240632930118106111251489014156806378141113351528328003GSM5251266SRR14265370
Kdn_F_021_4lane7_Kdn_F_21_4_12221.998.7KidneyKiKdnF214Kdn-F-2144743784977954303943579686133111721525946631148301718467441602634054GSM5251267SRR14265371
Kdn_F_104_1lane2_Kdn_F_100_1_12001.948.8KidneyKiKdnF1041Kdn-F-10446810925447814330713732760147414045605107026297940622866462343534331GSM5251268SRR14265372
Kdn_F_104_2lane4_Kdn_F_100_2_12081.998.2KidneyKiKdnF1042Kdn-F-10461550946665759378535197158162114638707976831867219028421607193849230GSM5251269SRR14265373
Kdn_F_104_3lane6_Kdn_F_100_3_12161.988.6KidneyKiKdnF1043Kdn-F-10455747296145903396974461699175212749639018125279244340065548594549896GSM5251270SRR14265374
Kdn_F_104_4lane5_Kdn_F_100_4_12241.989.6KidneyKiKdnF1044Kdn-F-10458170446287911328874853867142713118574477249208647814406575995532494GSM5251271SRR14265375
Kdn_M_002_1lane3_Kdn_M_2_1_11932.018.6KidneyKiKdnM21Kdn-M-26167080730299266927462634128551657369048116045611105475465607933538361GSM5251272SRR14265376
Kdn_M_002_2lane7_Kdn_M_2_2_12011.999KidneyKiKdnM22Kdn-M-2585878264996594469147101062091139456165981057611766158217577961139836GSM5251273SRR14265377
Kdn_M_002_3lane1_Kdn_M_2_3_12091.999.3KidneyKiKdnM23Kdn-M-2858425194458416594469627672848219631172651041639186891743748399814110560GSM5251274SRR14265378
Kdn_M_002_4lane7_Kdn_M_2_4_12171.969.3KidneyKiKdnM24Kdn-M-258993836548999479204886374210516027666166993979516347694582101838087GSM5251275SRR14265379
Kdn_M_006_1lane4_Kdn_M_6_1_11952.038.8KidneyKiKdnM61Kdn-M-665672027350426492525395381207112567749078478556517168138646649551860GSM5251276SRR14265380
Kdn_M_006_2lane4_Kdn_M_6_2_12032.048.5KidneyKiKdnM62Kdn-M-6573030962987285291445271512122149157704479404293337122538563392046246GSM5251277SRR14265381
Kdn_M_006_3lane5_Kdn_M_6_3_12112.058.2KidneyKiKdnM63Kdn-M-64856411518197424377426793110229395436754150273214239128480641123714GSM5251278SRR14265382
Kdn_M_006_4lane1_Kdn_M_6_4_12192.039KidneyKiKdnM64Kdn-M-652685565983886376354363689158613483796156020317000332664515777567850GSM5251279SRR14265383
Kdn_M_021_1lane7_Kdn_M_21_1_11972.058.5KidneyKiKdnM211Kdn-M-2166679527121549285695773234133512043609296105945318085254657995542814GSM5251280SRR14265384
Kdn_M_021_2lane1_Kdn_M_21_2_12051.888.3KidneyKiKdnM212Kdn-M-2150171535525851276814235736123911705707075261305035229831491514263772GSM5251281SRR14265385
Kdn_M_021_3lane1_Kdn_M_21_3_12132.048.1KidneyKiKdnM213Kdn-M-21229709526034551610219197296996864389052341762591521011224372533694GSM5251282SRR14265386
Kdn_M_021_4lane3_Kdn_M_21_4_12211.898.9KidneyKiKdnM214Kdn-M-2139068934347623269863215322116110942530124833535282829744384679833545GSM5251283SRR14265387
Kdn_M_104_1lane8_Kdn_M_100_1_11991.928.3KidneyKiKdnM1041Kdn-M-10438378154471207242173212905102010726492314106154923739692376649240172GSM5251284SRR14265388
Kdn_M_104_2lane3_Kdn_M_100_2_1207//KidneyKiKdnM1042Kdn-M-1044077110472522031601334102014089100384415569275948015369403147523764GSM5251285SRR14265389
Kdn_M_104_3lane2_Kdn_M_100_3_1215//KidneyKiKdnM1043Kdn-M-1044140469507120432066310550414061214548246665891104138139831406451831242GSM5251286SRR14265390
Kdn_M_104_4lane4_Kdn_M_100_4_12231.958.9KidneyKiKdnM1044Kdn-M-10442181584819804295543405567135813740560555725316652136895415475635937GSM5251287SRR14265391
Lng_F_002_1lane1_Lng_F_2_1_12902.059.5LungLuLngF21Lng-F-280976939016357527796821529221739099991308499727283475349790870884784GSM5251288SRR14265392
Lng_F_002_2lane7_Lng_F_2_2_12982.049.3LungLuLngF22Lng-F-248220975299969301074101055137420026454705193075518022350474953127228GSM5251289SRR14265393
Lng_F_002_3lane5_Lng_F_2_3_13062.059.7LungLuLngF23Lng-F-24132154440565723719350459993317874375544402764854334366407079924290GSM5251290SRR14265394
Lng_F_002_4lane7_Lng_F_2_4_13142.059.6LungLuLngF24Lng-F-255582546018649377274777661150120119570805579264648925741547086334010GSM5251291SRR14265395
Lng_F_006_1lane6_Lng_F_6_1_12922.059.3LungLuLngF61Lng-F-664875947017061523405495104182814630764446999635700646244637968144035GSM5251292SRR14265396
Lng_F_006_2lane5_Lng_F_6_2_13002.019.4LungLuLngF62Lng-F-639317794230601281553250597108014155428624572205495963241387577719510GSM5251293SRR14265397
Lng_F_006_3lane4_Lng_F_6_3_13082.039.3LungLuLngF63Lng-F-641467004639157284143442381115814790425745195044810825719408526224052GSM5251294SRR14265398
Lng_F_006_4lane6_Lng_F_6_4_13162.069.5LungLuLngF64Lng-F-660740276489650423205100845159714349668157016276149444164597778140816GSM5251295SRR14265399
Lng_F_021_1lane4_Lng_F_21_1_12942.039.4LungLuLngF211Lng-F-2173341447876863377276348047153018364709946988314274970611721836145291GSM5251296SRR14265400
Lng_F_021_2lane2_Lng_F_21_2_13022.029.4LungLuLngF212Lng-F-2157944616409164338544989623141919009556555636035274453254573141425300GSM5251297SRR14265401
Lng_F_021_3lane8_Lng_F_21_3_13101.979.4LungLuLngF213Lng-F-2154087156051883292564660996122919369642925173184616729287532224440801GSM5251298SRR14265402
Lng_F_021_4lane3_Lng_F_21_4_13182.049.8LungLuLngF214Lng-F-213895285420023119676341397578111585364813488982942515432384747819032GSM5251299SRR14265403
Lng_F_104_1lane8_Lng_F_100_1_12962.039.5LungLuLngF1041Lng-F-10446698735286025472313849694229817425613915848145419919300459242733521GSM5251300SRR14265404
Lng_F_104_2lane3_Lng_F_100_2_130429.3LungLuLngF1042Lng-F-10455017336168401418024608342188317655564266890805254210475543667123528GSM5251301SRR14265405
Lng_F_104_3lane7_Lng_F_100_3_13121.929.6LungLuLngF1043Lng-F-10466466757126002357725711261163818093675886939416181624165656401832401GSM5251302SRR14265406
Lng_F_104_4lane1_Lng_F_100_4_13201.929.6LungLuLngF1044Lng-F-10453225475864113386424423116178419425778426333145640917512521509154503GSM5251303SRR14265407
Lng_M_002_1lane8_Lng_M_2_1_12892.029.6LungLuLngM21Lng-M-271038808088214508755956391218336933811397945118562941832696501354387GSM5251304SRR14265408
Lng_M_002_2lane3_Lng_M_2_2_12972.049.7LungLuLngM22Lng-M-255306016149600384974739634170615359489886062443866317949545958723561GSM5251305SRR14265409
Lng_M_002_3lane5_Lng_M_2_3_13052.059.7LungLuLngM23Lng-M-245536914862504276803879963113517829399254810514187743341448917820890GSM5251306SRR14265410
Lng_M_002_4lane1_Lng_M_2_4_13132.049.5LungLuLngM24Lng-M-26517180714382464503534440325543007711263975478410097427956635954179290GSM5251307SRR14265411
Lng_M_006_1lane2_Lng_M_6_1_12911.949.4LungLuLngM61Lng-M-652171965868231321864306647134919546519326820166946529939515312824116GSM5251308SRR14265412
Lng_M_006_2lane4_Lng_M_6_2_12992.069.4LungLuLngM62Lng-M-656183816076380401844740752167417866587936390386702223048553995330004GSM5251309SRR14265413
Lng_M_006_3lane8_Lng_M_6_3_13072.049.5LungLuLngM63Lng-M-669594637574204394485961932156416908659197379956052531607684733943565GSM5251310SRR14265414
Lng_M_006_4lane5_Lng_M_6_4_13152.069.5LungLuLngM64Lng-M-64512834482774126630390019499512123420054391373360037948445796020202GSM5251311SRR14265415
Lng_M_021_1lane3_Lng_M_21_1_12931.939.2LungLuLngM211Lng-M-2161512076731612317705160093144714335535357475394655970255605666625674GSM5251312SRR14265416
Lng_M_021_2lane1_Lng_M_21_2_13012.049.1LungLuLngM212Lng-M-2151811705741540281374392375119717180822495441403275031386507404751756GSM5251313SRR14265417
Lng_M_021_3lane6_Lng_M_21_3_13092.029.2LungLuLngM213Lng-M-213769121417266026946315010710709814423864179663605056120369406328662GSM5251314SRR14265418
Lng_M_021_4lane2_Lng_M_21_4_13171.989.6LungLuLngM214Lng-M-213965451454084324835324247198614335415454848654312194042390588319251GSM5251315SRR14265419
Lng_M_104_1lane6_Lng_M_100_1_12951.979.3LungLuLngM1041Lng-M-10463679776899536447285422815197416162870106461535916035439625334454536GSM5251316SRR14265420
Lng_M_104_2lane2_Lng_M_100_2_13031.979.4LungLuLngM1042Lng-M-10439689444516475256453174123110819838515935926586090920218391507422852GSM5251317SRR14265421
Lng_M_104_3lane4_Lng_M_100_3_13112.059.2LungLuLngM1043Lng-M-10472763417887080444696295820195016430741127377524043126383717479138994GSM5251318SRR14265422
Lng_M_104_4lane7_Lng_M_100_4_13191.979.5LungLuLngM1044Lng-M-10445609065008451345313731878150916330538236052117023221960449653125432GSM5251319SRR14265423
Lvr_F_002_1lane7_Lvr_F_2_1_1342.029.2LiverLiLvrF21Lvr-F-2165836919500382383711547079282913435271342661441597134160796320538GSM5251320SRR14265424
Lvr_F_002_2lane6_Lvr_F_2_2_1422.029.3LiverLiLvrF22Lvr-F-2153537417880842155610752497892126131304312627424416878147865323269GSM5251321SRR14265425
Lvr_F_002_3lane6_Lvr_F_2_3_1502.059LiverLiLvrF23Lvr-F-22137589244046127907149212410662716739873473498382658737206605028952GSM5251322SRR14265426
Lvr_F_002_4lane1_Lvr_F_2_4_1581.988.8LiverLiLvrF24Lvr-F-2169552020437812508311646959683096743696347885407279520163445331979GSM5251323SRR14265427
Lvr_F_006_1lane3_Lvr_F_6_1_1361.949.5LiverLiLvrF61Lvr-F-6453764548898817931555128127749827912721538826874404547805GSM5251324SRR14265428
Lvr_F_006_2lane1_Lvr_F_6_2_1442.029.3LiverLiLvrF62Lvr-F-686474610661841261361210645455992004316704026122402083634316749GSM5251325SRR14265429
Lvr_F_006_3lane5_Lvr_F_6_3_1522.059.2LiverLiLvrF63Lvr-F-61205591138261817844852789639870224267244582326198502117585515647GSM5251326SRR14265430
Lvr_F_006_4lane4_Lvr_F_6_4_1602.019.6LiverLiLvrF64Lvr-F-614405061666293216751034426779869731716282051365387111140714317513GSM5251327SRR14265431
Lvr_F_021_1lane2_Lvr_F_21_1_1381.918.7LiverLiLvrF211Lvr-F-21902873118362713460614572510561821619188667260822099787934511348GSM5251328SRR14265432
Lvr_F_021_2lane8_Lvr_F_21_2_1462.038.8LiverLiLvrF212Lvr-F-2116903792001461181771304083679634425084283777230409882164973319313GSM5251329SRR14265433
Lvr_F_021_3lane4_Lvr_F_21_3_1542.048.8LiverLiLvrF213Lvr-F-211977816225443425966142960997410398320593970064384716502193109221455GSM5251330SRR14265434
Lvr_F_021_4lane1_Lvr_F_21_4_1621.879.4LiverLiLvrF214Lvr-F-21158091318414441992511556687838447377702763093969312693152998829625GSM5251331SRR14265435
Lvr_F_104_1lane8_Lvr_F_100_1_1402.049.3LiverLiLvrF1041Lvr-F-10420127292536087318831448340122311707358363825696379213467196722823912GSM5251332SRR14265436
Lvr_F_104_2lane5_Lvr_F_100_2_1481.889LiverLiLvrF1042Lvr-F-1041379159159387923803953878789713321982309403422625554135104314355GSM5251333SRR14265437
Lvr_F_104_3lane5_Lvr_F_100_3_1562.039.2LiverLiLvrF1043Lvr-F-10498853211110081165767824339157091577423427426460446096585811564GSM5251334SRR14265438
Lvr_F_104_4lane3_Lvr_F_100_4_1642.029.3LiverLiLvrF1044Lvr-F-10415326101789574178691118522655642919536311824379236962150317612890GSM5251335SRR14265439
Lvr_M_002_1lane7_Lvr_M_2_1_13329LiverLiLvrM21Lvr-M-2156350117279841852911693657582674929384265258300995355150682418004GSM5251336SRR14265440
Lvr_M_002_2lane6_Lvr_M_2_2_1412.039.2LiverLiLvrM22Lvr-M-22546157291949628548169215310995674942361607947770786195245453034027GSM5251337SRR14265441
Lvr_M_002_3lane8_Lvr_M_2_3_1492.048.8LiverLiLvrM23Lvr-M-21991512238133629744129892910444013741178483644574178931191101230488GSM5251338SRR14265442
Lvr_M_002_4lane6_Lvr_M_2_4_1572.039.8LiverLiLvrM24Lvr-M-2149274617996031874611146717282971424812255888234774632142977320078GSM5251339SRR14265443
Lvr_M_006_1lane2_Lvr_M_6_1_13529.4LiverLiLvrM61Lvr-M-61260079160243218831891219771870427445259666331896165123502814089GSM5251340SRR14265444
Lvr_M_006_2lane2_Lvr_M_6_2_1432.019.6LiverLiLvrM62Lvr-M-6101750613167231642367759159873462223624137533290540499403713243GSM5251341SRR14265445
Lvr_M_006_3lane4_Lvr_M_6_3_1512.029.2LiverLiLvrM63Lvr-M-698352912611521669167245159273781936821849528398678795897913369GSM5251342SRR14265446
Lvr_M_006_4lane3_Lvr_M_6_4_15929.8LiverLiLvrM64Lvr-M-6759929993648107245467274063468135131558111600447787439378498GSM5251343SRR14265447
Lvr_M_021_1lane7_Lvr_M_21_1_1371.959.3LiverLiLvrM211Lvr-M-2112315921407589166748959446005509183342243702781828546120180813797GSM5251344SRR14265448
Lvr_M_021_2lane8_Lvr_M_21_2_1452.018.8LiverLiLvrM212Lvr-M-21993767130377114768687400537556819614196788272862281395975318993GSM5251345SRR14265449
Lvr_M_021_3lane4_Lvr_M_21_3_1532.028.5LiverLiLvrM213Lvr-M-211244360150100517304931373622439618605229141218977499121867913523GSM5251346SRR14265450
Lvr_M_021_4lane7_Lvr_M_21_4_1611.979.3LiverLiLvrM214Lvr-M-2110473361202342143287536455154179167801950552801421622102025313198GSM5251347SRR14265451
Lvr_M_104_1lane2_Lvr_M_100_1_1392.049.1LiverLiLvrM1041Lvr-M-10497139412416552074763369069482021832723779833389766694865310881GSM5251348SRR14265452
Lvr_M_104_2lane3_Lvr_M_100_2_1472.058.8LiverLiLvrM1042Lvr-M-104172280220819802834312132199787976240233878203121113879168444615353GSM5251349SRR14265453
Lvr_M_104_3lane1_Lvr_M_100_3_1552.029.3LiverLiLvrM1043Lvr-M-1041840947209659628071124344810261507141540408947589558334177655735555GSM5251350SRR14265454
Lvr_M_104_4lane5_Lvr_M_100_4_1632.029.5LiverLiLvrM1044Lvr-M-104150851416784892468810475648971019123894326208518059688147925113579GSM5251351SRR14265455
Msc_F_002_1lane1_Msc_F_2_1_1982.039.4MuscleMuMscF21Msc-F-2439039649266547203932319971624112989617686837598861773180424998864423GSM5251352SRR14265456
Msc_F_002_2lane3_Msc_F_2_2_11061.969.3MuscleMuMscF22Msc-F-238370674435018456753001103120236516341816116914969228278375066828729GSM5251353SRR14265457
Msc_F_002_3lane7_Msc_F_2_3_11141.969.3MuscleMuMscF23Msc-F-22290484258401728413174976084622538220893761305295719283223551218468GSM5251354SRR14265458
Msc_F_002_4lane1_Msc_F_2_4_11221.979.4MuscleMuMscF24Msc-F-243699805038405458573282327135183332562837051848807541114422772766457GSM5251355SRR14265459
Msc_F_006_1lane2_Msc_F_6_1_11001.979.3MuscleMuMscF61Msc-F-625692823206245422371774924108720775331495097467560789940251080221817GSM5251356SRR14265460
Msc_F_006_2lane1_Brn_F_6_2_1761.989.6MuscleMuMscF62Msc-F-6297092534350694420721764361034180834251147640059956103392286883148906GSM5251357SRR14265461
Msc_F_006_3lane1_Msc_F_6_3_111629MuscleMuMscF63Msc-F-627818023167831518101976389137215682465714819399719165297269176945551GSM5251358SRR14265462
Msc_F_006_4lane5_Msc_F_6_4_11241.999MuscleMuMscF64Msc-F-61823863200806326138138130467714780232352810304736832527178439116804GSM5251359SRR14265463
Msc_F_021_1lane7_Msc_F_21_1_11011.998.6MuscleMuMscF211Msc-F-21250486628593682891219482958406192333703914625499316315245920324487GSM5251360SRR14265464
Msc_F_021_2lane6_Msc_F_21_2_11102.079.1MuscleMuMscF212Msc-F-21233400625408092527019335576844178269062673453513815434229014325494GSM5251361SRR14265465
Msc_F_021_3lane2_Msc_F_21_3_11182.038.9MuscleMuMscF213Msc-F-21180395321473362381913946306574564224012716804379525159177252617248GSM5251362SRR14265466
Msc_F_021_4lane5_Msc_F_21_4_11262.019.1MuscleMuMscF214Msc-F-21292196331955972865824332927676587292843269003639339241288194720841GSM5251363SRR14265467
Msc_F_104_1lane4_Msc_F_100_1_11041.988.8MuscleMuMscF1041Msc-F-104344617639456733084428451239979412425494048464868131014338630332710GSM5251364SRR14265468
Msc_F_104_2lane3_Msc_F_100_2_11122.059MuscleMuMscF1042Msc-F-104189129821415341593115861694372768164062035672308127316185958415623GSM5251365SRR14265469
Msc_F_104_3lane6_Msc_F_100_3_11202.058.8MuscleMuMscF1043Msc-F-10445319724977181354743762126101576964929847246838535114773442281950587GSM5251366SRR14265470
Msc_F_104_4lane1_Msc_F_100_4_11282.028.8MuscleMuMscF1044Msc-F-1043563637408451436433280404210639104603654566225751475171345850663323GSM5251367SRR14265471
Msc_M_002_1lane8_Msc_M_2_1_1971.879.6MuscleMuMscM21Msc-M-2462429953283994967735767571359155328544175840097159975318447757255835GSM5251368SRR14265472
Msc_M_002_2lane8_Msc_M_2_2_11052.049.9MuscleMuMscM22Msc-M-2363810642544673820927844841207116299411855132065817639859352177045481GSM5251369SRR14265473
Msc_M_002_3lane2_Msc_M_2_3_11131.919.3MuscleMuMscM23Msc-M-244358735422211538022891792182211790361474107100814303454217432752840821GSM5251370SRR14265474
Msc_M_002_4lane2_Msc_M_2_4_11211.969.1MuscleMuMscM24Msc-M-239376095103824101246242581624859602521889086208173062110452382908447552GSM5251371SRR14265475
Msc_M_006_1lane6_Msc_M_6_1_1991.968.9MuscleMuMscM61Msc-M-6383250742360385689027806141394171554508867112268530150164370163741550GSM5251372SRR14265476
Msc_M_006_2lane7_Msc_M_6_2_11071.949.2MuscleMuMscM62Msc-M-629586473230885461212191832149913494496455402985897228855289547327931GSM5251373SRR14265477
Msc_M_006_3lane6_Msc_M_6_3_11151.978.7MuscleMuMscM63Msc-M-631053643459211445682307377126711645463505641256206534260303097533707GSM5251374SRR14265478
Msc_M_006_4lane7_Msc_M_6_4_11231.959.1MuscleMuMscM64Msc-M-62134568238050332191163803080610905271533393864039828213209114617486GSM5251375SRR14265479
Msc_M_021_1lane5_Msc_M_21_1_11022.017.6MuscleMuMscM211Msc-M-213906794424959749894307713014179129485245679128489738320385023429571GSM5251376SRR14265480
Msc_M_021_2lane4_Msc_M_21_2_11092.098.7MuscleMuMscM212Msc-M-2119259542223628223351546232599361724643271545292757589188972620119GSM5251377SRR14265481
Msc_M_021_3lane5_Msc_M_21_3_11172.099.6MuscleMuMscM213Msc-M-211099844120964310951913347304243713013122280229383052108033311522GSM5251378SRR14265482
Msc_M_021_4lane4_Msc_M_21_4_11252.038.9MuscleMuMscM214Msc-M-214007658444270846891316112912089686527535402756026789321391769146128GSM5251379SRR14265483
Msc_M_104_1lane4_Msc_M_100_1_11031.988.9MuscleMuMscM1041Msc-M-10443183104761888486623355330137698705681160274563975133313421841146228GSM5251380SRR14265484
Msc_M_104_2lane3_Msc_M_100_2_111128.7MuscleMuMscM1042Msc-M-104226868227450122882417562908604143251163718524438215750223052021465GSM5251381SRR14265485
Msc_M_104_3lane3_Msc_M_100_3_11192.038.6MuscleMuMscM1043Msc-M-10439653784379535397712645389120385675179187606944291255762379577542535GSM5251382SRR14265486
Msc_M_104_4lane8_Msc_M_100_4_11272.059.2MuscleMuMscM1044Msc-M-1044225480477308740351345735711526743494124977884067683237413563548764GSM5251383SRR14265487
Spl_F_002_1lane3_Spl_F_2_1_122.053.7SpleenSpSplF21Spl-F-227064043351073490471807761220917377547176790305180826137265716518318GSM5251384SRR14265488
Spl_F_002_2lane7_Spl_F_2_2_1102.063.6SpleenSpSplF22Spl-F-222807282656928348311578584162016181495824860054672050982223502516223GSM5251385SRR14265489
Spl_F_002_3lane4_Spl_F_2_3_1182.042.4SpleenSpSplF23Spl-F-232133033970419508752235291226516793634127560814559318590315444624403GSM5251386SRR14265490
Spl_F_002_4lane8_Spl_F_2_4_1262.062.6SpleenSpSplF24Spl-F-235346144103416425252545702189320366660547223505377545306345536536643GSM5251387SRR14265491
Spl_F_006_1lane8_Spl_F_6_1_142.059.1SpleenSpSplF61Spl-F-640999035096127550633027416256436255837967299708212446824401670335891GSM5251388SRR14265492
Spl_F_006_2lane1_Spl_F_6_2_1122.039.5SpleenSpSplF62Spl-F-619728802347560307761444317151819257493663461154366112113192456525757GSM5251389SRR14265493
Spl_F_006_3lane7_Spl_F_6_3_1202.058.9SpleenSpSplF63Spl-F-620169972287635291661447999124014859404314054573819224111197980615542GSM5251390SRR14265494
Spl_F_006_4lane2_Spl_F_6_4_1282.079.1SpleenSpSplF64Spl-F-620211212473388323281404392153719276416404519754475313862199386111358GSM5251391SRR14265495
Spl_F_021_1lane8_Spl_F_21_1_162.037.8SpleenSpSplF211Spl-F-212760791347977330890185070115372624253343726781372239399271166324675GSM5251392SRR14265496
Spl_F_021_2lane5_Spl_F_21_2_1142.049SpleenSpSplF212Spl-F-21337701337659473106718051151513459557743512955665940639403332966221553GSM5251393SRR14265497
Spl_F_021_3lane2_Spl_F_21_3_1222.039.4SpleenSpSplF213Spl-F-2128237043482627294181689892146037018670599122864737323235278923615963GSM5251394SRR14265498
Spl_F_021_4lane7_Spl_F_21_4_1302.037.8SpleenSpSplF214Spl-F-2126736663003777294151885218134827061510585968254312119922262948919698GSM5251395SRR14265499
Spl_F_104_1lane6_Spl_F_100_1_182.0510SpleenSpSplF1041Spl-F-1043756239417706567579249578531292339010053587705610142151727368090435617GSM5251396SRR14265500
Spl_F_104_2lane2_Spl_F_100_2_1161.998.7SpleenSpSplF1042Spl-F-1044498497572752036785148251017613423978605271244510470419922444719627526GSM5251397SRR14265501
Spl_F_104_3lane2_Spl_F_100_3_1242.017.5SpleenSpSplF1043Spl-F-10435651494631831359131506271161228442893351776143957599888352284321786GSM5251398SRR14265502
Spl_F_104_4lane3_Spl_F_100_4_1322.038.1SpleenSpSplF1044Spl-F-10414682338171387441669978601224955913936646843949086181822039029214433835115640GSM5251399SRR14265503
Spl_M_002_1lane5_Spl_M_2_1_112.042.2SpleenSpSplM21Spl-M-2290095035145823226917139941445155564555891609612595827448285188922626GSM5251400SRR14265504
Spl_M_002_2lane1_Spl_M_2_2_192.045.1SpleenSpSplM22Spl-M-227232973358962268731921417131214850483785656755319654128264457937468GSM5251401SRR14265505
Spl_M_002_3lane6_Spl_M_2_3_1172.042.6SpleenSpSplM23Spl-M-2295096737300943078517872461397106934398691635410156829615288765729323GSM5251402SRR14265506
Spl_M_002_4lane5_Spl_M_2_4_1252.042.4SpleenSpSplM24Spl-M-21862990218105922918114711699410811333215102059380028086182737215739GSM5251403SRR14265507
Spl_M_006_1lane1_Spl_M_6_1_132.029.5SpleenSpSplM61Spl-M-630589213524526434392182654199125502780125847927063730827298283741067GSM5251404SRR14265508
Spl_M_006_2lane4_Spl_M_6_2_1112.039.5SpleenSpSplM62Spl-M-635525544064021500292722979238824601693915787415143123270348723229724GSM5251405SRR14265509
Spl_M_006_3lane8_Spl_M_6_3_1192.069.6SpleenSpSplM63Spl-M-628072853377734346962133649163424073555514366885305643460275018724478GSM5251406SRR14265510
Spl_M_006_4lane5_Spl_M_6_4_1272.059SpleenSpSplM64Spl-M-622427072442713285901674003132517799432573692373728158200220569013015GSM5251407SRR14265511
Spl_M_021_1lane3_Spl_M_21_1_152.058.5SpleenSpSplM211Spl-M-2118306712126299226521160347108624867391485269443016513130180152712332GSM5251408SRR14265512
Spl_M_021_2lane4_Spl_M_21_2_1132.049.9SpleenSpSplM212Spl-M-21371579642114364610822534042206470447971511661806766029598365837323881GSM5251409SRR14265513
Spl_M_021_3lane1_Spl_M_21_3_1212.049.4SpleenSpSplM213Spl-M-2129687253379822300151745952138636145776529380845663443632289421939225GSM5251410SRR14265514
Spl_M_021_4lane6_Spl_M_21_4_1292.048.6SpleenSpSplM214Spl-M-2136610664089843388132482831188727776625609625874291515720360488025977GSM5251411SRR14265515
Spl_M_104_1lane3_Spl_M_100_1_172.059.3SpleenSpSplM1041Spl-M-1042610138316650428719156863114252046446335892992298087389257732714375GSM5251412SRR14265516
Spl_M_104_2lane6_Spl_M_100_2_1152.049.8SpleenSpSplM1042Spl-M-10432101383649831336382396574156121747701035764136742316247315342926432GSM5251413SRR14265517
Spl_M_104_3lane4_Spl_M_100_3_1232.038.8SpleenSpSplM1043Spl-M-1042152214262098629778132335515222328848215661041411759466212076614374GSM5251414SRR14265518
Spl_M_104_4lane7_Spl_M_100_4_131NA9.3SpleenSpSplM1044Spl-M-1042459279280418520385132655889820077544379580953951622875242193416438GSM5251415SRR14265519
Thm_F_002_1lane5_Thm_F_2_1_12582.0610ThymusThThmF21Thm-F-2330581636740405903124456712823224156475857266011235410523326679815581GSM5251416SRR14265520
Thm_F_002_2lane6_Thm_F_2_2_12662.0510ThymusThThmF22Thm-F-236002573951841553942726079274517173610916114199024311166353836424947GSM5251417SRR14265521
Thm_F_002_3lane7_Thm_F_2_3_12742.0510ThymusThThmF23Thm-F-22440617282985538956184793720071542745207405215637307575240374814563GSM5251418SRR14265522
Thm_F_002_4lane4_Thm_F_2_4_12822.0610ThymusThThmF24Thm-F-22407857283606233980188188917131437639107359074520639076236722216579GSM5251419SRR14265523
Thm_F_006_1lane3_Thm_F_6_1_12602.0510ThymusThThmF61Thm-F-62749078313994642659220101821781453941118381625463069202271843210433GSM5251420SRR14265524
Thm_F_006_2lane1_Thm_F_6_2_12682.0510ThymusThThmF62Thm-F-624785542915932419651929897218314964513563554474357111593242225327578GSM5251421SRR14265525
Thm_F_006_3lane4_Thm_F_6_3_12762.0610ThymusThThmF63Thm-F-632081813608557536442401740270619180748175502506620616147315840823491GSM5251422SRR14265526
Thm_F_006_4lane2_Thm_F_6_4_12842.069.3ThymusThThmF64Thm-F-628723283640970562181972106283123124643816431897962112992283295617866GSM5251423SRR14265527
Thm_F_021_1lane5_Thm_F_21_1_12622.0610ThymusThThmF211Thm-F-2131475893484478461792437476228917137526075050785956211612311207615649GSM5251424SRR14265528
Thm_F_021_2lane7_Thm_F_21_2_12702.0510ThymusThThmF212Thm-F-2126159082933078419302055646201314871451563801224643613946257869315788GSM5251425SRR14265529
Thm_F_021_3lane7_Thm_F_21_3_12782.0510ThymusThThmF213Thm-F-213440091375452146285278367423421710951857456245558208021339525318738GSM5251426SRR14265530
Thm_F_021_4lane1_Thm_F_21_4_12862.069.8ThymusThThmF214Thm-F-2130670463571577463932377747232718287613694436396841114214300031334659GSM5251427SRR14265531
Thm_F_104_1lane2_Thm_F_100_1_12642.059.2ThymusThThmF1041Thm-F-104303969840213224683517950052142181145757789030411971278549295366631460GSM5251428SRR14265532
Thm_F_104_2lane3_Thm_F_100_2_12722.029.7ThymusThThmF1042Thm-F-10430055103698262487292028584209514850549977259685886248814294527322611GSM5251429SRR14265533
Thm_F_104_3lane6_Thm_F_100_3_128029.4ThymusThThmF1043Thm-F-10437223554161057552232764919251217379624816798766885340120365888330992GSM5251430SRR14265534
Thm_F_104_4lane6_Thm_F_100_4_12882.039.2ThymusThThmF1044Thm-F-104363136242761336073623484062956213587404993870612206726607355984336477GSM5251431SRR14265535
Thm_M_002_1lane8_Thm_M_2_1_12572.0610ThymusThThmM21Thm-M-230198053744541392362428918204515903465944053304667313504296514721602GSM5251432SRR14265536
Thm_M_002_2lane2_Thm_M_2_2_12652.0610ThymusThThmM22Thm-M-22172326266225131963166758617432023539549346359428049519214003012568GSM5251433SRR14265537
Thm_M_002_3lane1_Thm_M_2_3_12732.0410ThymusThThmM23Thm-M-227255883154906351732108818192618527544193962745974816281265653034422GSM5251434SRR14265538
Thm_M_002_4lane5_Thm_M_2_4_12812.0610ThymusThThmM24Thm-M-218877342104725230941534504119111113290282292163794510080185990611563GSM5251435SRR14265539
Thm_M_006_1lane7_Thm_M_6_1_12592.0610ThymusThThmM61Thm-M-627065633065064432622055941210615035481214527456370510265266888615383GSM5251436SRR14265540
Thm_M_006_2lane8_Thm_M_6_2_12672.069.8ThymusThThmM62Thm-M-635556664043414596682751271296120628688125442066631010805348524431005GSM5251437SRR14265541
Thm_M_006_3lane1_Thm_M_6_3_12752.069.8ThymusThThmM63Thm-M-630854293449342490472351397266621619935564401167681912458301275637751GSM5251438SRR14265542
Thm_M_006_4lane6_Thm_M_6_4_12832.069.7ThymusThThmM64Thm-M-611945041386797226868784601166735928168213179178051635611708979325GSM5251439SRR14265543
Thm_M_021_1lane2_Thm_M_21_1_12612.0610ThymusThThmM211Thm-M-2125843073054720405172064900205716377418833440854953013690255639011268GSM5251440SRR14265544
Thm_M_021_2lane3_Thm_M_21_2_12692.0510ThymusThThmM212Thm-M-212016113228776032021156230615351298836654311510394487700198927411951GSM5251441SRR14265545
Thm_M_021_3lane8_Thm_M_21_3_12772.049.9ThymusThThmM213Thm-M-2129144563464788401492306020207816742534613988165777514114286133425301GSM5251442SRR14265546
Thm_M_021_4lane4_Thm_M_21_4_12852.069.9ThymusThThmM214Thm-M-2134468403975628503492727895251214363551845104694382419347339621022897GSM5251443SRR14265547
Thm_M_104_1lane8_Thm_M_100_1_12632.049.3ThymusThThmM1041Thm-M-10427351643633845353261939430157612440562835557338036114993267187239022GSM5251444SRR14265548
Thm_M_104_2lane3_Thm_M_100_2_12712.079.4ThymusThThmM1042Thm-M-10422350992860042409781443476198410955389636134095377214827220162016735GSM5251445SRR14265549
Thm_M_104_3lane5_Thm_M_100_3_12792.019.5ThymusThThmM1043Thm-M-10428389933079880343282075514155313285735625136155848848162278071220486GSM5251446SRR14265550
Thm_M_104_4lane4_Thm_M_100_4_12872.059.1ThymusThThmM1044Thm-M-1044328259500260874208283448931352593991483105439013127068932424023144413GSM5251447SRR14265551
Tst_M_002_1lane4_Tst_M_2_1_12252.0410TestesTeTstM21Tst-M-245610975092382601413357734283342216809688497289703137656448156632790GSM5251448SRR14265552
Tst_M_002_2lane8_Tst_M_2_2_12332.0510TestesTeTstM22Tst-M-233778304091091490072385232244040790697296643739171741009330574833533GSM5251449SRR14265553
Tst_M_002_3lane8_Tst_M_2_3_12412.049.7TestesTeTstM23Tst-M-246183645516158535273394267273138420770038962538394832854452751439361GSM5251450SRR14265554
Tst_M_002_4lane6_Tst_M_2_4_12492.0510TestesTeTstM24Tst-M-251438425767793792223621580367543826104534111585810937825050505079940719GSM5251451SRR14265555
Tst_M_006_1lane2_Tst_M_6_1_12272.089.6TestesTeTstM61Tst-M-61812068519297804297858107028634888406869259455413400081350861661017733347264453GSM5251452SRR14265556
Tst_M_006_2lane2_Tst_M_6_2_12352.079.5TestesTeTstM62Tst-M-6185987591973939130236411150903476841716426418861376429231696992618192413281573GSM5251453SRR14265557
Tst_M_006_3lane5_Tst_M_6_3_12432.059.5TestesTeTstM63Tst-M-612901598134636502020327341932282427987417916129642120252421323012618905190471GSM5251454SRR14265558
Tst_M_006_4lane4_Tst_M_6_4_12512.069.3TestesTeTstM64Tst-M-61421123415148970232467104607625122302904194362110355964289831258713830645263510GSM5251455SRR14265559
Tst_M_021_1lane3_Tst_M_21_1_12292.069.3TestesTeTstM211Tst-M-21163375141723858226045210917962961233853421490461219198248414819116000664219487GSM5251456SRR14265560
Tst_M_021_2lane2_Tst_M_21_2_12372.069.3TestesTeTstM212Tst-M-211552355716742387251644118644027673327469215585211272039627051195115188916227784GSM5251457SRR14265561
Tst_M_021_3lane7_Tst_M_21_3_12452.059TestesTeTstM213Tst-M-211606800616991593256936124479928463319884203248611845239682481364715682644258304GSM5251458SRR14265562
Tst_M_021_4lane7_Tst_M_21_4_12532.069.4TestesTeTstM214Tst-M-211837808919423379286620141354632605358364230749613597766791631291717945620289612GSM5251459SRR14265563
Tst_M_104_1lane2_Tst_M_100_1_12312.059.6TestesTeTstM1041Tst-M-1046136291687157137778446406026095432715419513188356299110064607488831432GSM5251460SRR14265564
Tst_M_104_2lane1_Tst_M_100_2_12392.069.5TestesTeTstM1042Tst-M-104673468073856093308856333981740450921035037719786160313517660839270761GSM5251461SRR14265565
Tst_M_104_3lane7_Tst_M_100_3_12472.069.6TestesTeTstM1043Tst-M-10480254008518505244197310154123246221491764982093255827366794303936065GSM5251462SRR14265566
Tst_M_104_4lane6_Tst_M_100_4_12552.059.2TestesTeTstM1044Tst-M-1048155212869141526276738327912373624853132572748373284895806740240069GSM5251463SRR14265567
Utr_F_002_1lane1_Utr_F_2_1_12261.979.1UterusUtUtrF21Utr-F-27351967856684255013563009924323508788126121338820290537614719562487303GSM5251464SRR14265568
Utr_F_002_2lane4_Utr_F_2_2_12341.899.1UterusUtUtrF22Utr-F-290922301020884474386681456231933961193735169678725940644355895342366195GSM5251465SRR14265569
Utr_F_002_3lane3_Utr_F_2_3_12422.029.1UterusUtUtrF23Utr-F-232593564113821263652310018109614183289217570057875124754321260118263GSM5251466SRR14265570
Utr_F_002_4lane6_Utr_F_2_4_12501.959.6UterusUtUtrF24Utr-F-2403053545769414296428651182028180295594984645613121433921395248634856GSM5251467SRR14265571
Utr_F_006_1lane3_Utr_F_6_1_12281.989.6UterusUtUtrF61Utr-F-674931428298302541756291236211324356613339026249218334079741543231043GSM5251468SRR14265572
Utr_F_006_2lane5_Utr_F_6_2_12361.979.6UterusUtUtrF62Utr-F-66265079696929967430471706626632310167249111913419391245407619935729117GSM5251469SRR14265573
Utr_F_006_3lane5_Utr_F_6_3_12441.979.6UterusUtUtrF63Utr-F-6646582269336743742155519451640173484604462617212539835244640554124610GSM5251470SRR14265574
Utr_F_006_4lane1_Utr_F_6_4_12522.029.7UterusUtUtrF64Utr-F-6615642771161435458749137192181241847827285153815025623980604620257710GSM5251471SRR14265575
Utr_F_021_1lane4_Utr_F_21_1_12302.059.7UterusUtUtrF211Utr-F-21794006688899157219565899192729205187484610301117314234051783859242555GSM5251472SRR14265576
Utr_F_021_2lane6_Utr_F_21_2_12382.049.7UterusUtUtrF212Utr-F-21885525196621165104876868982133245597450182591110471538108874126347378GSM5251473SRR14265577
Utr_F_021_3lane3_Utr_F_21_3_12461.99.8UterusUtUtrF213Utr-F-2175473458507707509756428893213018466572488558318897515816747528829011GSM5251474SRR14265578
Utr_F_021_4lane8_Utr_F_21_4_12542.059.7UterusUtUtrF214Utr-F-2180838209135660524316967427217530734766727511688050368599795957254111GSM5251475SRR14265579
Utr_F_104_1lane5_Utr_F_100_1_12321.889.7UterusUtUtrF1041Utr-F-104116754831239031657872105717712230276487827777509397314256691157466839609GSM5251476SRR14265580
Utr_F_104_2lane7_Utr_F_100_2_12401.979.5UterusUtUtrF1042Utr-F-10473956708117464491336444291200925332591186903307784418043731927229570GSM5251477SRR14265581
Utr_F_104_3lane8_Utr_F_100_3_12481.959.6UterusUtUtrF1043Utr-F-104952134410347657616018232079243327463906609325058553630172938342658895GSM5251478SRR14265582
Utr_F_104_4lane1_Utr_F_100_4_12561.999.4UterusUtUtrF1044Utr-F-10494807901030450361999817999425503294711493786910510971224159931595385387GSM5251479SRR14265583

Quality of libraries

The quality of miRNA sequencing data for each sample was checked (Fig. 2). Briefly, a total of 1.6 billion raw reads was obtained, with 5.1 million reads per sample on average, which is sufficient for miRNA quantification. After quality filtering and length filtering, 4.5 ± 2.8 million reads of high quality were retained per sample on average (Fig. 2a). The proportions of various transcript types of these reads were demonstrated in Fig. 2b. The majority of libraries were contributed by miRNA and piRNA sequences, followed by tRNA, rRNA, mRNA and other sequences from the rat transcriptome and genome. Most libraries were dominated by miRNA reads (75.6 ± 8.5%), except for the testis samples from the adolescent and adult rats, which were dominated by piRNA (73.8 ± 0.8%). However, the proportion of miRNA for the Brn_F_104_4 sample was 14.4%, much lower than the average proportion of brain samples.
Fig. 2

Quality of sequencing reads. (a) The overall height of each bar represents the number of total reads sequenced from each RNA sample, and the green part and orange part correspond to the reads which either passed or failed the quality filter, respectively. High-quality reads entered the following mapping workflow. (b) Percentages of the reads that mapped to miRNA, piRNA, tRNA, rRNA, miscRNA, mRNA, other RNA, as well as the reads that mapped to none of the aforementioned transcript types but mapped to the rat genome, are represented by different colours. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus.

Quality of sequencing reads. (a) The overall height of each bar represents the number of total reads sequenced from each RNA sample, and the green part and orange part correspond to the reads which either passed or failed the quality filter, respectively. High-quality reads entered the following mapping workflow. (b) Percentages of the reads that mapped to miRNA, piRNA, tRNA, rRNA, miscRNA, mRNA, other RNA, as well as the reads that mapped to none of the aforementioned transcript types but mapped to the rat genome, are represented by different colours. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus.

Reproducibility of biological replicates

To assess the reproducibility of biological replicates, we calculated the Pearson’s correlation coefficients between any two of the 320 samples (Fig. 3a–c). The Pearson’s correlation coefficients between miRNA expressions of biological replicates from the same group (0.98 ± 0.01, mean ± sd) were much higher than those from different sample groups (0.8 2 ± 0.09) (Fig. 3a). This result indicated good consistency among biological replicates in which biological variations between animals and technical variations between sample processing were included. Moreover, this conclusion was further confirmed in principal component analysis, from which the majority of biological replicates could be grouped together (Fig. 4a–d).
Fig. 3

Reproducibility of biological replicates. (a) Distributions of the pairwise Pearson correlation coefficients between the biological replicates (navy blue) and between samples from different groups (light blue). (b) Correlations between four biological replicates from each of two particular groups (adrenal gland and brain samples of female rats at week 6) were demonstrated as an example. (c) Pairwise Pearson correlation coefficients between miRNA expressions of the 318 samples. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus.

Fig. 4

Expression profiles of miRNAs are discriminating among different organs. miRNA expression profiles are depicted by the top three principal components (a–d). Each point corresponds to one of the 318 samples. Samples from different organs are represented by different colours, and those of different ages are represented by different shapes. (e) Hierarchical clustering analysis (HCA) of expression profiles from 318 rat samples with 604 miRNAs. Heatmap (left) for normalized log2 (CPM) values. Right, normalized loadings of each miRNA for the top three PCs. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus.

Reproducibility of biological replicates. (a) Distributions of the pairwise Pearson correlation coefficients between the biological replicates (navy blue) and between samples from different groups (light blue). (b) Correlations between four biological replicates from each of two particular groups (adrenal gland and brain samples of female rats at week 6) were demonstrated as an example. (c) Pairwise Pearson correlation coefficients between miRNA expressions of the 318 samples. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus. Expression profiles of miRNAs are discriminating among different organs. miRNA expression profiles are depicted by the top three principal components (a–d). Each point corresponds to one of the 318 samples. Samples from different organs are represented by different colours, and those of different ages are represented by different shapes. (e) Hierarchical clustering analysis (HCA) of expression profiles from 318 rat samples with 604 miRNAs. Heatmap (left) for normalized log2 (CPM) values. Right, normalized loadings of each miRNA for the top three PCs. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus.

Validation of organ specific signature

To obtain an overview of miRNA expression profiles, we performed principal component analysis and hierarchical clustering (Fig. 4a–e). The miRNA profiles were discriminating among different organs (Fig. 4e). To identify the miRNAs that contribute the most to organ-specific expression, we set out to identify ‘organ-enriched’ miRNAs. A miRNA is considered ‘organ-enriched’ if it is over-expressed by at least four folds in one organ over any other organs and across all four developmental stages, a quite stringent criterion. Consequently, 67 organ-enriched miRNAs were identified, including a novel miRNA candidate. The z-scaled expression levels of these miRNAs were shown in Fig. 5a.
Fig. 5

Validation of organ-specific miRNA signatures in a microarray dataset. (a) Expression profiles of 67 organ-enriched miRNAs across 318 samples are arranged by organ type. Expression data were Z-score scaled per gene across all 318 samples. Each row represents a miRNA that is enriched in an organ. (b) Expression profiles of 31 organ-enriched miRNAs across 23 tissues in the microarray miRNA expression dataset of Minami et al.[15] are arranged by biological system. Each row represents a miRNA that is enriched in an organ. Each column represents a sample profiled in the microarray dataset. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus.

Validation of organ-specific miRNA signatures in a microarray dataset. (a) Expression profiles of 67 organ-enriched miRNAs across 318 samples are arranged by organ type. Expression data were Z-score scaled per gene across all 318 samples. Each row represents a miRNA that is enriched in an organ. (b) Expression profiles of 31 organ-enriched miRNAs across 23 tissues in the microarray miRNA expression dataset of Minami et al.[15] are arranged by biological system. Each row represents a miRNA that is enriched in an organ. Each column represents a sample profiled in the microarray dataset. Abbreviation for organs, Adr, adrenal; Brn, brain; Hrt, heart; Kdn, kidney; Lng, lung; Lvr, liver; Msc, skeletal muscle; Spl, spleen; Thm, thymus; Tst, testis; and Utr, uterus. To independently validate the organ-enriched miRNAs discovered in this study, the literature-reported miRNA profiles of 55 different organs and tissues from normal male rats based on Agilent miRNA microarrays were used[15]. Thirty-one (31) organ-enriched miRNAs identified in our study, including brain-enriched, testis-enriched, liver-enriched, and spleen-enriched and heart-enriched miRNAs, were also profiled in the miRNA microarray dataset and displayed a pattern of high-level expression in biological systems with functions similar to those of the organs examined in this study (Fig. 5b). This result confirmed the reliability of the organ specific signature presented in our dataset.

Reliability of miRNA-mRNA integration

To examine the reliability of miRNA-mRNA integration using the miRNA dataset presented here and the previously published mRNA dataset, we compared the source of variability in these two datasets. Principal variance component analysis was performed on miRNA and mRNA expression profiles respectively (Fig. 6a). As expected, the ‘organ’ factor accounted for the most total variance in both datasets, with 61.6% for miRNA and 64.2% for mRNA profiles. The variance attributable to each factor was similar in the mRNA and miRNA datasets, except for age. The overall expression difference due to age was significantly higher for miRNA (11.7%) than that for mRNA (1.7%) expression. However, there was a stronger interaction between age and organ type for miRNA (15.7%) compared to that for mRNA (2.5%) expression. It appeared that there is a more dynamic miRNA expression pattern across the four developmental stages independent of organ types, whereas the temporal expression of mRNA appeared to be more organ dependent than that of miRNA expression. These results highlight the concordance of the two datasets.
Fig. 6

Reliability of miRNA-mRNA integration (a) Principal variance component analysis (PVCA) shows the relative contribution of main effects (organ, age, sex, and replicate) and interactions (:) to total model variance in miRNA (blue) and gene (red) expression. Effects in the Y-axis are ordered by proportion of overall variations explained in the miRNA dataset. (b) Pairwise correlations between all 10,418,396 miRNA-gene pairs (604 miRNAs versus 17,249 genes), 20 intragenic miRNAs on opposite strand of host genes, 147 intragenic miRNAs on the same strand of host genes.

Reliability of miRNA-mRNA integration (a) Principal variance component analysis (PVCA) shows the relative contribution of main effects (organ, age, sex, and replicate) and interactions (:) to total model variance in miRNA (blue) and gene (red) expression. Effects in the Y-axis are ordered by proportion of overall variations explained in the miRNA dataset. (b) Pairwise correlations between all 10,418,396 miRNA-gene pairs (604 miRNAs versus 17,249 genes), 20 intragenic miRNAs on opposite strand of host genes, 147 intragenic miRNAs on the same strand of host genes. Meanwhile, the genomic locus of miRNA genes was used to test the reliability of the association between these miRNA and mRNA datasets. We calculated the correlations between expression levels of miRNAs and those of genes (miRNA-gene pairs). The distributions of correlations between several types of miRNA-gene pairs were demonstrated in Fig. 6b. The correlations between all miRNA-gene pairs were weak (0.01 ± 0.28, median ± sd) as expected. Importantly, the co-transcription events of miRNA and host genes were observed in these datasets, as the expressions of intragenic miRNAs were highly positively correlated with those of their host genes on the same strand (0.60 ± 0.29, N = 179). In addition, the slightly negative correlations (−0.17 ± 0.35) between these miRNAs-host genes (opp) pairs confirmed that co-expression events are rare when intragenic miRNAs and the host genes are located on the opposite strands. In summary, the miRNA dataset along with the mRNA datasets provided a reliable and unique resource for integration.
Measurement(s)miRNA expression profiling
Technology Type(s)Next Generation Sequencing
Factor Type(s)organ • age • sex
Sample Characteristic - OrganismRattus norvegicus
  35 in total

1.  Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation.

Authors:  Eric C Lai
Journal:  Nat Genet       Date:  2002-03-18       Impact factor: 38.330

Review 2.  MicroRNAs in cancer: biomarkers, functions and therapy.

Authors:  Josie Hayes; Pier Paolo Peruzzi; Sean Lawler
Journal:  Trends Mol Med       Date:  2014-07-12       Impact factor: 11.951

Review 3.  Cancer stem cells, microRNAs, and therapeutic strategies including natural products.

Authors:  Darshni Vira; Saroj K Basak; Mysore S Veena; Marilene B Wang; Raj K Batra; Eri S Srivatsan
Journal:  Cancer Metastasis Rev       Date:  2012-12       Impact factor: 9.264

Review 4.  MicroRNAome genome: a treasure for cancer diagnosis and therapy.

Authors:  Ioana Berindan-Neagoe; Paloma del C Monroig; Barbara Pasculli; George A Calin
Journal:  CA Cancer J Clin       Date:  2014-08-07       Impact factor: 508.702

Review 5.  MicroRNAs: target recognition and regulatory functions.

Authors:  David P Bartel
Journal:  Cell       Date:  2009-01-23       Impact factor: 41.582

6.  Comprehensive RNA-Seq transcriptomic profiling across 11 organs, 4 ages, and 2 sexes of Fischer 344 rats.

Authors:  Ying Yu; Chen Zhao; Zhenqiang Su; Charles Wang; James C Fuscoe; Weida Tong; Leming Shi
Journal:  Sci Data       Date:  2014-06-24       Impact factor: 6.444

7.  The Rat microRNA body atlas; Evaluation of the microRNA content of rat organs through deep sequencing and characterization of pancreas enriched miRNAs as biomarkers of pancreatic toxicity in the rat and dog.

Authors:  Aaron Smith; John Calley; Sachin Mathur; Hui-Rong Qian; Han Wu; Mark Farmen; Florian Caiment; Pierre R Bushel; Jianying Li; Craig Fisher; Patrick Kirby; Erik Koenig; David G Hall; David E Watson
Journal:  BMC Genomics       Date:  2016-08-30       Impact factor: 3.969

8.  Identification and Analysis of Human Sex-biased MicroRNAs.

Authors:  Chunmei Cui; Weili Yang; Jiangcheng Shi; Yong Zhou; Jichun Yang; Qinghua Cui; Yuan Zhou
Journal:  Genomics Proteomics Bioinformatics       Date:  2018-07-11       Impact factor: 7.691
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.