MicroRNA-139-5p acts as a suppressor gene for depression by targeting nuclear receptor subfamily 3, group C, member 1.

MicroRNA-139-5p (miR-139-5p) is one of the most differentially expressed miRNAs in the brain between healthy people and depressed patients. However, its function in depression is unclear. Therefore, we investigated the function of miR-139-5p in depression. Here, miR-139-5p expression was found to be upregulated in the model group. MiR-139-5p inhibition could increase sucrose preference and decrease mice immobility time after chronic corticosterone (CORT) injection. Furthermore, compared with the antago-NC group, 3 weeks of antagomiR-139-5p treatment significantly decreased miR-139-5p level in model group hippocampus, increased sucrose preference index, reduced neuron damages, and enhanced the levels of nuclear receptor subfamily 3 group C member 1 (NR3C1), brain-derived neurotrophic factor (BDNF), phosphorylated/total tyrosine kinase receptor B (p-TrkB/TrkB), phosphorylated/total cAMP-response element-binding protein (p-CREB/CREB) and phosphorylated/total extracellular regulated protein kinases (p-ERK/ERK). Moreover, as a potential target for miR-139-5p, NR3C1 level was reduced by miR-139-5p mimic. Altogether, by activating the BDNF-TrkB signaling pathway, miR-139-5p inhibition plays an antidepressant-like role and might serve as an effective depression target (Fig. graphical abstract).

Highlights

Antago-miR-139-5p has a protective effect on hippocampal neuronal degeneration.

MiR-139-5p regulates hippocampal neuron damage via BDNF/TrkB.

MiR-139-5p inhibition has an anti-depressant-like effect by activating BDN/TrkB.

Introduction

As one of the most common mental illnesses, depression is mainly characterized by depressed mood, loss of interest, or enjoyment to the external world, self-feeling incompetence, or deficiency, frustration demand, and out of touch with the rest of the society [1,2]. It leads to suicidal thoughts, distraction, appetite disorder, and sleep cycle disorder [3]. These characteristics may persist for a long time or often relapse in patients with depression, seriously affecting patients’ work, learning ability, and daily life [4]. However, the current prospect of antidepressant treatment is not satisfactory. According to literature reports, 50% of patients with depression have not received corresponding treatment, and 20% of treated patients have poor therapeutic outcomes [5]. Traditional antidepressant drugs still take several days or weeks to achieve antidepressant effects, mainly due to the lack of comprehensive understanding of depression pathogenesis [6]. Therefore, effective therapeutic drugs with low adverse reactions are still needed.

With the emerging evidence showing the involvement of microRNAs (miRNAs) in neurodevelopmental and neurological diseases, MiRNAs play pivotal roles in the pathophysiology, diagnosis, and treatment of depression. MiRNAs, approximately 22 ribonucleotides produced in the nucleus, could regulate gene expression and protein translation [7]. MiRNAs, which are widely distributed in various tissues and organs, participate in metabolism, hematopoiesis, immune response, development [8,9] and play critical roles in cell death, cancer development and progression, and disease outcomes [3,10]. MiRNAs play significant roles in neuron differentiation, neurotransmitter transmission, neuromorphological occurrence, and synaptic plasticity formation [11,12]. Therefore, in depressive disorders, the value of miRNAs is worth exploring. The human miR-139-5p gene at 11q13.4 [13] is poorly expressed in many diseases, and its expression indicates a poor prognosis [14]. Recent studies have shown that miR-139-5p has been identified as a potential depressive biomarker isolated from patients’ serum exosomes [15,16] and miR-212 might play a protective role in depression by regulating apoptosis and inflammatory responses in mouse hippocampal neurons [17]. However, no study have demonstrated the role of Mir-139-5p in hippocampal neurons.

The hippocampus is the most commonly studied brain region associated with depression. Several stresses could reduce neuronal dendrite branching and plasticity in the hippocampus, possibly due to long-term potentiation (LTP) and long-term depression (LTD) [18]. Moreover, the effects on behavioral improvement were coupled with activation of brain-derived neurotrophic factors by cAMP-response element binding protein (CREB), extracellular regulated protein kinases (ERK), Tyrosine Kinase receptor B (TrkB) and brain-derived neurotrophic factor (BDNF), as well as induction of neuronal proliferation and synaptogenesis. Recently, BDNF has been integral to the LTP plasticity mechanisms. MicroRNAs (miRNAs) regulate downstream target genes to exert their biological roles [19]. Previous studies found that, in HEK 293 cells, miR-124 directly targets glucocorticoid receptor (GR) [20]. In addition, miR-124 inhibition by its antagomir could reverse the increased immobility time and decreased sucrose preference in mice after chronic corticosterone (CORT) injection. Inhibition of miRNAs may activate the BDNF-TrkB pathway for treating depression in the hippocampus [21]. Currently, the function of BDNF-TrkB pathway in anxiety disorders has received increasing attention [20]. It has been reported that BDNF-TrkB signaling pathway is closely related to the occurrence and development of anxiety disorders through interaction with other pathways [22,23]. For example, gamma-aminobutyric acid (GABA) production affects glutamate transmission, leading to anxiety [24,25]. Studies have shown that miR-139-5p could change individuals’ responses to stress. Because overreaction to stress is an important inducement of anxiety and depression, miR-139-5p could be an important candidate for anxiety and depression.

Here, we explored how miR-139-5p involves in regulating depression and hypothesized that miR-139-5p could activate the BDNF-TrkB pathway to exert antidepressant-like effects, with a hope to find new depression drug targets.

Materials and methods

Animals

Male C57BL/6 mice (24.38 ± 2.05 g, 5 weeks old) were purchased from Shanghai Slac Animal Center, China, and housed under the lights (12-h/12-h light/dark schedule) at 22 ± 2°C and 55 ± 5% relative humidity with eight per cage. All procedures were approved by Qingdao Women and Children’s Hospital and conducted following the guidelines published by the China Animal Protection Association (Supplementary material 1).

Drugs

The human miR-139-5 inhibitor oligonucleotide, antagomiR-139-5, from Ribobio Co., Ltd. and its negative control oligonucleotide (antago-NC) were obtained CORT was obtained from TCI (Shanghai, China).

Drug administration

Mice were randomized into CORT-antagomiR-139-5p group (model-antagomiR-139-5p), CORT-vehicle group (miR-139-5p antagomir control), control-antagomiR-139-5p group, and control-vehicle group (miR-139-5p antagomir control). CORT at a dose of 40 mg/kg was injected subcutaneously once a day. AntagomiR-139-5p and its antagomir control were injected into the lateral ventricle at an injecting rate of 0.5 μl/min. After that, mice were subjected to tail suspension test and sucrose preference test (Figure 1(a)).

Figure 1.

The miR-139-5p levels in mouse hippocampal. (a) Experimental specific design drawings. (b) The predicted expression levels of miRNAs. ** P < 0.01 and *P < 0.05 vs. the control group.

Sucrose preference test

The sucrose preference test was conducted according to a previous report (Liu et al., 2018). In brief, at 5:00 pm, all water and food were taken out. At 8:00 am of the following day, mice were given two identical water bottles with 100 ml of 2% sucrose solution in one bottle and 100 ml of water in the other. After 1 h, all bottles were taken. In the water bottle, the volume of liquid consumed was measured. In the rodent model, a decrease in sugar water preference rate reflects the lack of pleasure.

Tail suspension test (TST)

Tail suspension test was conducted as previously reported [17]. A 15 cm long and 1.9 cm wide tape was positioned. In preparation for any climbing behavior, 2 mm of tail protruding was used to enable mice to balance themselves. During the videotaped sessions, mice were suspended for 6 min by their tails. By utilizing this procedure, 13% of mice climbed using their tails and were removed from the experimental analysis. For the entire 6 min, a blind observer scored the videotapes.

Forced swimming test (FST)

Forced swimming test was conducted as previously reported [17]. The experimental animals were placed in a resin glass tank with a height of 24 cm, a diameter of 12 cm, a water depth of 20 cm, and a water temperature of 25.2°C. The cameras recorded the animal swimming for 6 minutes, and the cumulative resting time was measured in the following 4 minutes. The animals were considered stationary when they stopped struggling and floated in the water for 2 seconds. All animals were adapted at least 1 h prior to each experiment in the behavior lab to ensure that the time of each experiment was consistent. At the end of the experiment, the animals were warmed up by a heat lamp and returned to their cages.

Tissue sample collection

Mouse brains were quickly removed and frozen in a pre-cooled saline solution. The hippocampus was dissected on a cold plate.

qRT-PCR

Total RNAs were extracted from cells using TRIzol reagent. qRT-PCR was performed on a ViiATM 7 real-time PCR system with U6 and GAPDH as the internal references. MiR-139-5p expression levels were detected using SYBR Premix Ex Taq II following the procedure reported previously (Lekshmy and Jha, 2017). All primers are listed in Table 1.

Table 1.

Sequences of primers used in qRT-PCR

Gene	Forward primer (5’-3’)	Reversed primer (5’-3’)
miR-139-5p	TCTACAGTGCACGTGTCTCCAGT	TGGAGACACGTGCACTGTAGATT
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT
NR3C1	GAAACCTGCTCTGCTTTGCTCC	CTCTTGGCTCTTCAGACCTTCCTTAG
GAPDH	CCATTTGCAGTGGCAAAG	CACCCTTTGTGTTAGTG

Cell transfection

Cells transfection was performed using transfection agent Lip2000 (Ribo, China). Briefly, 100 nmol miR-139-5p mimic was mixed with Lip2000 and incubated 1 × 106 HT22 cells plated in a 24-well plate. After 72 h co-culture, proteins were isolated and analyzed using Western blot.

Western blot

After the last behavioral evaluation, mice were anesthetized by intraperitoneally injecting 100 g·L−1 chloral hydrate. The bilateral hippocampus tissues were rapidly and bluntly separated on ice, washed with physiological saline, and placed in a cold storage tube. An appropriate amount of hippocampus tissue was placed in a centrifuge tube (2 mL) and homogenized. Proteins were quantified using BCA Protein Assay, separated by SDS-PAGE, and transferred onto PVDF membranes. The membranes were first incubated overnight with appropriate primary antibodies against CREB, NR3C1, BDNF, p-CREB, ERK, p-ERK, TrkB, p-TrkB, or GAPDH from Shidai, Shanghai, China, at 1:1000 and then with HRP-labeled secondary antibody (1:2000). Protein signals were visualized using the ECL substrate and analyzed using an Imager, as previously reported (Yamauchi et al., 2017).

Nissl staining

After mice were anesthetized with chloral hydrate 10%, their brain tissues were isolated, fixed with 4% paraformaldehyde PBS buffer, embedded in paraffin, and prepared as 50 μm coronal sections. The paraffin sections were routinely dewaxed, rehydrated, subjected to Nissl staining for 30 min, sealed with resin, and observed under an optical microscope. Morphologically normal neurons and damaged neurons showing the features of shrunken cell bodies, triangulated, pyknotic nuclei, and Nissl bodies in six different fields were detected using ImagePro Plus 5.1 software and counted by two blinded investigators. In the six defined areas, the percentage of damaged neurons was calculated.

Luciferase reporter assay

Luciferase reporter assay was conducted as previously reported [26]. The wild type (WT) and mutant (MT) NR3C1-3’-UTR containing the putative binding site of miR-139-5p were constructed. MiR-139-5p mimic or NC and a reporter vector containing WT or MT NR3C1 3’-UTR were co-transfected into HT22 cells using Lipofectamine 2000. Luciferase activity was measured after 48 h transfection.

Statistical analysis

All data were shown as mean ± standard deviation (SD) and evaluated using SPSS19.0. The Differences between two groups were analyzed using Student’s t-test and differences among multiple groups were analyzed using two-way ANOVA followed by LSD test. P < 0.05 indicated a significant difference.

Results

In this study, we explored how miR-139-5p regulates depression and exerts its antidepressant-like effect via activating the BDNF-TrkB pathway and suggested the BDNF-TrkB pathway could be a new depression drug target (Fig. graphical abstract).

MiR-139-5p expression in mouse hippocampus

To analyze the potential miRNAs targeting NR3C1, miRNA–mRNA interactions were predicted using online tools (PITA, miRmap and miRanda). A total of 10 miRNAs were selected as candidates (Table 2). MiR-139-5p expression was significantly upregulated in model group than in control group (Figure 1(b), p = 0.005). In addition, miR-139-5p expression was increased in antago-NC group hippocampus than in the control group hippocampus (P = 0.003). Moreover, 3 weeks of antagomiR-139-5p treatment decreased miR-139-5p expression in model group hippocampus (P= 0.021) (Figure 1(c)) but did not alter miR-139-5p expression in control group hippocampus (P = 0.121).

Table 2.

A total of 10 potential miRNAs targeting NR3C1

Relative expression	Control (mean ± SD)	Model (mean ± SD)	P value
has-miR-365a-3p	1 ± 0.09	0.92 ± 0.08	>0.05
has-miR-374b-5p	1 ± 0.03	1.13 ± 0.08	>0.05
has-miR-18a-5p	1 ± 0.09	0.88 ± 0.03	>0.05
has-miR-377-3p	1 ± 0.05	1.09 ± 0.10	>0.05
has-miR-18b-5p	1 ± 0.04	1.25 ± 0.08	>0.05
has-miR-183-5p	1 ± 0.10	0.81 ± 0.03	>0.05
has-miR-381-3p	1 ± 0.04	0.78 ± 0.07	>0.05
has-miR-211-5p	1 ± 0.06	1.19 ± 0.08	>0.05
has-miR-144-3p	1 ± 0.06	0.69 ± 0.04	>0.05
has-miR-139-5p	1 ± 0.13	2.01 ± 0.24	<0.01

Effects of antago-miR-139-5p on mouse behaviors

The sucrose preference index was decreased in the model group compared with the control group (Figure 2(a), p = 0.006) but enhanced after 3 weeks of antagomiR-139-5p treatment compared with antago-NC group (P = 0.004). In addition, there was no significant difference in sucrose preference index (P = 0.094) between the antagomiR-139-5p group and the control group. Moreover, 3 weeks of antagomiR-139-5p treatment significantly decreased the sucrose preference index in the model group than in antago-NC group (Figure 2(b), p = 0.023).

Figure 2.

Effect of antagomiR-139-5p on sucrose preference (a), body weight change (b), suspension time of TST (c) and FST (d) in mice. ** P < 0.01 vs. Control group.

The suspension time in the tail suspension test was significantly increased in the model group (Figure 2(c), p = 0.001), but not in the antagomiR-139-5p treatment group (P = 0.512) than in the control group. Moreover, the suspension time was significantly reduced after 3 weeks of antagomiR-139-5p treatment compared with the model group (Figure 2(c), p = 0.002). We also found that antagomiR-139-5p treatment shorted the immobility time in the forced swimming test compared with the control (Figure 2(d), p = 0.006).

AntagomiR-139-5p is involved in hippocampus morphological damages

The morphological changes of the hippocampus were assessed using Nissl staining. As shown in Figure 3(a) and (b), under different magnification (× 40, × 200, bar = 50 μ m), the number of Nissl bodies in the neurons of the antago-NC group was significantly reduced, the neural network and dendritic spines were broken or disappeared, and the cells were damaged (P = 0.002). The neural network and synaptic connections of the mice recovered after 3 weeks of antagomiR-139-5p treatment, the number of Nissl bodies in the cells increased, and the neuronal damage was significantly decreased (P = 0.003). In addition, antagomiR-139-5p treatment did not alter the morphological features of the control group (P = 0.082, Figure 3(c)). These suggested that antagomiR-139-5p has protective effects on hippocampal neuronal degeneration.

Figure 3.

Effects of antagomiR-139-5p on hippocampal morphological damage. (a). Representative chromatogram (× 40, bar = 50 μ m) to determine the damage of cells by the CORT in the hippocampus. (b). Representative chromatogram (× 200, bar = 50 μ m) to determine the damage of cells by the CORT in the hippocampus. (c) The quantitative assessments to determine the damage of cells by the CORT in the hippocampus. ** P < 0.01 and * P < 0.05 vs. the control group.

Effects of antagomiR-139-5p on hippocampal NR3C1, BDNF, p-TrkB/TrkB ratio, and BDNF signaling

The levels of NR3C1, BDNF, p-TrkB/TrkB, p-CREB/CREB, and p-ERK/ERK in antago-NC group hippocampus were reduced compared with the control group (Figure 4(a-e), P = 0.005). Compared with the antago-NC group, the levels of NR3C1, BDNF, p-TrkB/TrkB, p-CREB/CREB, and p-ERK/ERK were increased in the hippocampus after 3 weeks of antagomiR-139-5p treatment (P = 0.002, P = 0.035). There were no significant differences in NR3C1, BDNF, p-TrkB/TrkB, p-ERK/ERK, and p-CREB/CREB levels between the antagomiR-139-5p group and the control group (P = 0.135).

Figure 4.

Effect of antagomiR-139-5p on NR3C1, BDNF, p-TrkB/TrkB and BDNF expression in mouse hippocampus. (a-e) Western blot analysis and quantitative densitometry of hippocampal NR3C1, BDNF, p-TrkB/TrkB, p-CREB/CREB and p-ERK/ERK expression. *P< 0.05 and ** P < 0.01 vs. the control group.

MiR-139-5p directly targets NR3C1

NR3C1 was identified as a potential target for miR-139-5p by Starbase v2.0 (Figure 5(a)). The results showed that miR-139-5p mimic significantly inhibited the WT NR3C1 luciferase activity (P = 0.001) but did not alter the MT NR3C1 luciferase activity of (Figure 5(b)) (P = 0.235). Furthermore, miR-139-5p mimic significantly reduced NR3C1 mRNA and protein levels (P = 0.001) compared with the NC group (Figure 5(c) and (d)). These results indicated that NR3C1 is a direct target of miR-139-5p.

Figure 5.

Targeting relationship between miR-139-5p and NR3C1. (a) Binding sites for miR-139-5p and NR3C1. (b) a luciferase reporter assay. (c) NR3C1 mRNA expression in HT22 cells after miR-139-5p mimic treatment. (d) NR3C1 protein expression in TH22 cells after miR-139-5p mimic treatment. ** P < 0.01 compared with the control group.

Discussion

Major depressive disorder (MDD) is a high-risk, high-recurring, highly disabling and severe mental disorder. It is the second most common disease right after cardiovascular diseases [27]. The mechanism of depression and the action of antidepressants remain unclear. At present, the most commonly used first-line SSRI antidepressants have a slower onset of action. After several weeks of treatment, more than 30% of patients still have no remission [28]. Therefore, there is an urgent need for exploring the depression mechanism and molecular pathways responsible for specific actions of antidepressants. Although there are many hypotheses about the pathogenesis of depression, the pathophysiological processes of depression and the molecular mechanisms of antidepressant effects remain unclear.

Emerging evidence has shown that miRNAs have important functions in the pathophysiological process of depression and antidepressant action [20,29]. More than 1,000 miRNAs have been discovered, but the biological functions and regulatory mechanisms of some miRNAs have been continuously reported. MiRNAs are widely distributed in various tissues and organs [30] and play important roles in maintaining normal body physiological functions [31]. Moreover, increasing numbers of miRNAs participated in cell differentiation and organ formations [32]. The analysis of miRNAs in the brain of the depressed suicide population showed that 17% of miRNAs in depressed patients are significantly downregulated and are closely related to depression [33]. In addition, miR-144-5p level is reduced in patients and associated with depressive symptoms [34]. MiR-139-5p is involved in the occurrence and development of various diseases [35]. Previous studies showed that miR-139-5p alleviates neurological deficit through BCL-2 activation and HDAC4 loss in hypoxic-ischemic brain damage [36]. More importantly, miR-139-5p knockdown by antagomir attenuates NGF-mediated neuronal differentiation [37]. This study showed that mice in the antago-NC group had increased miR-139-5p level in the hippocampus, reduced sucrose preference index, prolonged suspension time, decreased bodyweight, and deteriorated neuron damages. Compared with the antago-NC group, 3 weeks of antagomiR-139-5p treatment of model mice significantly decreased miR-139-5p level in the hippocampus, augmented sucrose preference index, shortened suspension time, increased body weight, and attenuated neuron damages, suggesting that antago-miR-139-5p has protective effects on hippocampal neuronal degeneration.

MiRNAs were reported to target other signaling pathways to affect disease development and occurrence [38]. BDNF-TrkB pathway is involved in depression development [39]. BDNF is widely distributed in the hippocampus and cortex. BNDF initiates a series of downstream signal transduction processes by binding to its specific receptor TrkB to exert its biological effects on the nervous system, including promoting neuronal survival, growth, and differentiation and regulating synaptic plasticity, nerves regeneration, and other processes [40]. Melatonin was reported to enhance the antidepressant effect of fluoxetine hydrochloride by increasing the BDNF-TrkB signaling pathway [41]. In addition, glutamine transaminase 2 overexpression in the mouse brain exerts its depressive effect by downregulating the BDNF-TrkB signaling pathway [41]. All the above studies indicate that BDNF-TrkB signaling pathway is related to the occurrence of depression. In the rat Nr3c1 promoter, decreased NGFI-A methylation enhanced the negative HPA feedback stress regulation and hippocampal exon NR3C1 transcript expression. The methylation status of the 5’ CpG regulates NR3C1 transcription and NGFI-A binding to this region [42]. In addition, studies have shown that NR3C1 inhibits neuronal regeneration in the hippocampus and affects spatial learning and memory in rodents. This study found that BDNF, NR3C1, p-ERK/ERK, p-TrkB/TrkB, and p-CREB/CREB levels in antago-NC group hippocampus were reduced but increased after 3 weeks of antagomiR-139-5p treatment. In addition, miR-139-5p mimic reduced NR3C1 expression. These demonstrated that miR-139-5p regulates hippocampal neuron damage via the BDNF-TrkB signaling pathway. In future research, the status of PI3K/mTOR signaling after miR-139-5p treatment should be further explored. The action mode diagram is shown in Figure 6.

Figure 6.

A sketch map of depression induced by miR-139-5p. By activating BDNF-TrkB signaling pathway, miR-139-5p inhibition may have antidepressant-like effects.

Conclusion

MiR-139-5p inhibition is likely to have antidepressant-like effects via activating the BDNF-TrkB signaling pathway, and miR-139-5p might be a new depression drug development target.

Click here for additional data file.