Literature DB >> 35533199

High prevalence of small intestine bacteria overgrowth and asymptomatic carriage of enteric pathogens in stunted children in Antananarivo, Madagascar.

Jean-Marc Collard1, Lova Andrianonimiadana1, Azimdine Habib1, Maheninasy Rakotondrainipiana2, Prisca Andriantsalama2, Ravaka Randriamparany2, M A N Rabenandrasana1, François-Xavier Weill3, Nathalie Sauvonnet4, Rindra Vatosoa Randremanana2, Vincent Guillemot5, Pascale Vonaesch4, Philippe J Sansonetti4.   

Abstract

Environmental Enteric Dysfunction (EED) refers to an incompletely defined syndrome of inflammation, reduced absorptive capacity, and reduced barrier function in the small intestine. It is widespread among children and adults in low- and middle-income countries and is also associated with poor sanitation and certain gut infections possibly resulting in an abnormal gut microbiota, small intestinal bacterial overgrowth (SIBO) and stunting. We investigated bacterial pathogen exposure in stunted and non-stunted children in Antananarivo, Madagascar by collecting fecal samples from 464 children (96 severely stunted, 104 moderately stunted and 264 non-stunted) and the prevalence of SIBO in 109 duodenal aspirates from stunted children (61 from severely stunted and 48 from moderately stunted children). SIBO assessed by both aerobic and anaerobic plating techniques was very high: 85.3% when selecting a threshold of ≥105 CFU/ml of bacteria in the upper intestinal aspirates. Moreover, 58.7% of the children showed more than 106 bacteria/ml in these aspirates. The most prevalent cultivated genera recovered were Streptococcus, Neisseria, Staphylococcus, Rothia, Haemophilus, Pantoea and Branhamella. Feces screening by qPCR showed a high prevalence of bacterial enteropathogens, especially those categorized as being enteroinvasive or causing mucosal disruption, such as Shigella spp., enterotoxigenic Escherichia coli, enteropathogenic E. coli and enteroaggregative E. coli. These pathogens were detected at a similar rate in stunted children and controls, all showing no sign of severe diarrhea the day of inclusion but both living in a highly contaminated environment (slum-dwelling). Interestingly Shigella spp. was the most prevalent enteropathogen found in this study (83.3%) without overrepresentation in stunted children.

Entities:  

Mesh:

Year:  2022        PMID: 35533199      PMCID: PMC9119516          DOI: 10.1371/journal.pntd.0009849

Source DB:  PubMed          Journal:  PLoS Negl Trop Dis        ISSN: 1935-2727


Introduction

Stunting is a major public health and economic development concern in Madagascar which is the 5th most affected country in the world with 48.5% of all children under 5 (ca. 2 million) suffering from stunted growth [1]. Although deficient diet is the major cause of undernutrition, other factors such as Environmental Enteric Dysfunction (EED) has been proposed to be an associate driver of stunting in low and middle-income countries (LMICs) [2,3]. EED is a chronic inflammatory condition of the gut occurring among children living in unsanitary conditions [4], or among adults returning from deployment to LMICs [5,6]. According to estimates, greater than 75% of all children in LMICs could suffer from this syndrome at different degrees of severity [7]. Certain gut infections resulting in an abnormal gut microbiota and small intestinal bacterial overgrowth (SIBO) may also play a role in EED [5]. A study in Bangladesh found enteric infections in the first two years of life, mainly Shigella and Enterotoxigenic E. coli (ETEC), to be associated with EED and stunting [8]. Two additional studies found entero-aggregative E. coli (EAEC) and Campylobacter to be associated with markers of gut inflammation and stunting [9,10]. Even in the absence of diarrhea, these recurrent enteric infections may result in an imbalanced gut microbiota (i.e. dysbiosis) leading to growth faltering mediated through systemic inflammation [11]. SIBO is defined as the presence of excessive bacteria (greater than 105 CFU/ml) in the small intestine. It is frequently implicated as the cause of chronic diarrhea and malabsorption. SIBO can be measured noninvasively by hydrogen breath testing or by anaerobic and aerobic cultures of endoscopically aspirated upper gastrointestinal fluid [12]. In a study performed on Bangladeshi children, SIBO was associated with a decreased length-for-age Z score since birth and poor sanitation but was independent of frequent or recent diarrheal disease. It was also associated with intestinal inflammation but not with increased permeability or systemic inflammation [13]. Both repetitive gut infections and SIBO can co-exist in an intestine weakened by undernutrition and might lead themselves to micronutrient malabsorption fueling a vicious cycle with long-lasting effects. AFRIBIOTA is a case-controlled study for stunting, conducted in children in Antananarivo, Madagascar and in Bangui, Central African Republic, in which 460 children aged 2–5 years with no overt signs of gastrointestinal disease were recruited in each country [14]. In a preliminary study (feces from 153 children and 12 duodenal aspirates) [15], we showed vast majority of the stunted children (>80%) showed SIBO dominated by bacteria normally residing in the oro-pharyngeal tract. There was also an overrepresentation of oral bacteria in fecal samples of stunted children. Escherichia coli/Shigella spp. and Campylobacter spp. were found by a metataxonomic approach to be more prevalent in stunted children, while the butyrate-producers (Clostridia) were reduced [15]. The current research aimed to assess SIBO and gut infections in a population of children (N = 464) recruited in Antananarivo, Madagascar, using a quantitative culture-based technique on duodenal aspirates from stunted children and a more sensitive and accurate molecular-based approach (qPCR) than the classical metataxonomic approach [16,17,18], targeting the main enteropathogenic bacterial species and pathobionts in the feces.

Methods

Ethics statement

The study protocol for AFRIBIOTA has been approved by the Institutional Review Board of the Institut Pasteur (2016–06/IRB) and the National Ethical Review Boards of Madagascar (55/MSANP/CE, May 19th 2015). All participants received oral and written information about the study and the legal representatives of the children provided written consent to participate in the study.

Recruitment of participants

The case control was extensively described in a preliminary study [15] and is similar to the full-study. Briefly, the study population comprises HIV-negative children aged 2 to 5 years, neither suffering from acute malnutrition, nor from any other severe diseases (such as dysenteric syndrome, severe acute respiratory infections (SARI)/influenza-like illness (ILI), meningitis, malaria, acute otitis media, varicella, measles, …) who were recruited in the community of the two districts of Ankasina or Andranomanalina Isotry, and in two hospitals (Centre Hospitalier Universitaire Joseph Ravoahangy Andrianavalona (CHU-JRA) and Centre de Santé Materno-Infantile, Tsaralalana) in Antananarivo, Madagascar. Children were recruited either in the community (community-recruited children) or directly in the hospital (hospital-recruited children). The caregivers of all children received oral and written explanations of the study and provided written consent to participate. Anthropometric measurements were collected at the community-health centers and in the hospital. All children were admitted to the hospital for sample collection. Height was measured to the nearest 0.1 cm in a standing position using collapsible height boards; weight was measured using a commercial weighing scale to the nearest 100 g. All measurements were taken at least twice and repeated if the measurements were more than 0.1 cm/100 g apart from each other. The children were classified according to the median height of the WHO reference population [16] in three different groups: severe stunting (height-for-age z-score ≤ -3SD), moderate stunting (height-for-age z-score between -3SD and -2SD) and not stunted (height-for-age z-score ≥ -2SD). The non-stunted (control subjects) were matched for living area and sampling time period and were recruited during the entire study period (December 2016—March 2018). The realized sample size was 490 children: 211 stunted children and 279 not stunted. All children (hospital- and community-recruited children) were asked to come to the hospital for sample collection for the safety of the children (see hereafter).

Collection of stools, gastric and duodenal aspirates

All those conditions have been previously described in Vonaesch et al., 2018 [15]. Briefly, stools were collected in the morning at the hospital (directly before coming to the hospital for the community-recruited children) and the time of defecation recorded. If community-recruited children were able to again emit feces in the hospital, these feces were also collected and directly snap-frozen in liquid nitrogen before being transferred to -80°C. The time spent between defecation and freezing (liquid nitrogen/-80°C) was recorded on specific tracking sheets for each sample. The time for freezing the emitted feces was comprised between 6 min and 23.66h with a mean of 3.69h. Gastric and duodenal samples were collected using a pediatric nasogastric tube with stent (Vygon, France), and were only collected for stunted children due to ethical concerns. The nasogastric tube was introduced in the infant’s nose sitting in an upright position and moved to the stomach. Proper placement in the stomach was controlled using the syringe-air test and confirmed by an acid pH (pH ≤ 4). Once at least 4 ml of liquid were aspirated, the tube was moved 5 cm forward. The child was then laid down on the right side as to facilitate the tube’s passage in the duodenum. Pyloric passage was monitored regularly and was confirmed when the pH reached a pH ≥ 5. In this case, a second aspiration was performed and identified as duodenal. The procedure was interrupted if the pH did not change to a pH ≥ 5 within 1h30 min after introducing the tube. We also ensured that the first ml of aspiration from both the stomach and the duodenum were discarded. This allowed flushing out possible contaminating bacteria and minimize the carry-over from the more proximal compartments. 100 μl of fresh duodenal sample were inoculated directly in 0.9 ml of Robertson’s Cooked Meat (RCM) medium and processed for culture (see below). The rest of the aliquots were directly snap-frozen in liquid nitrogen and then transferred the same day to a -80°C freezer.

Culture of duodenal aspirates, feces and identification of colonies

RCM-diluted duodenal aspirations were brought within a time frame of 30 min to the Institut Pasteur of Madagascar, where they were further diluted and streaked on plates according to the protocol described in Chandra et al. [17]. In brief, the duodenal samples were analyzed using plating techniques in aerobic and anaerobic culture conditions after the RCM-diluted duodenal aspirates were serially diluted (1:100, 1:1,000) in phosphate buffered saline containing 1% peptone and 20 μL of each dilution and inoculated onto 3 separate culture plates. Aerobic culture was performed on chocolate agar, 5% sheep blood agar, and MacConkey’s medium. Anaerobic cultures were performed directly from the RCM tube (without dilution) onto 5% sheep blood agar containing haemin (5 μg/ml) and vitamin K (menadione) (1 μg/mL). The plates were incubated in an anaerobic jar or aerobically at 37°C for 48 h. Total bacterial count per ml of duodenal aspirate was calculated based on the total count on the chocolate agar plates (incubated aerobically) and the anaerobic culture. The following formula was used to calculate the total CFU load: No. of CFU per 20 μL of fluid inoculated x x 1,000 X dilution on plate. The isolated colonies were counted by morphotype and at the beginning 2–3 colonies for every morphotype were re-isolated. Re-isolated colonies were all identified by MALDI-TOF mass spectrometry (Bruker Biotyper, Bruker Daltonics, Bremen, Germany). As colonies from the same morphotype from the same plate were all identical (same identification), finally only one colony/morphotype was isolated and subcultured. Cultures were considered positive for SIBO if the total bacterial count was ≥105 CFU per mL of duodenal fluid [12,17]. To isolate Shigella spp. from the last 143 feces samples, a fresh scoop of feces taken with an inoculation loop was suspended in 5ml of physiological water and 20 μL were plated on Hektoen and XLD media. Suspected Shigella isolates (green or pink colonies on Hektoen or XLD, respectively) were purified, stored and identified with API galleries. There were sent to the French National Reference Center for E. coli, Shigella and Salmonella (FNRC-ESS), Institut Pasteur, Paris for species confirmation and serotyping. Serotyping was done by slide agglutination assays using a complete set of antisera allowing recognition of all described Shigella serotypes [18].

Data collection

To assess risk factors for acquiring pathogens, a questionnaire was developed and administered to children and their caregivers. In brief, the questionnaire contained four sections: 1. Socio-demographic data: age, gender, community setting, education and occupation of parents, family marital status; 2. Environmental factors: housing conditions (proximity of the housing to landfill, soil type, lavatories and showers) and quality of drinking water; 3. Behavior habits: type of toilet commonly used, hand washing habit, exposure to sewage and garbage; 4. Medical status/history: dental cavities, cough, stuffy nose, runny nose, delivery mode.

Statistical analysis

The data were encoded in an Excel (microbiological data) and an Access (socioeconomic data) database and analyzed using the R statistical software version 3.6.2. Comparisons between groups (controls and stunted children MS+SS) were determined using Pearson’s χ2-test or Fisher’s exact test, as appropriate. Values of p < 0.05 were considered to be statistically significant. For risk factors analysis, bivariate logistic regression analysis was carried out between factors (S1 and S2 Tables) and the presence of SIBO using the Chi-squared test or the Fisher’s exact test. Variables having P-value of ≤0.25 were entered into multivariate logistic regression for final analysis. Additionally, we correlated the pathogen presence in stools with the measure of CFU/ml grown from duodenal aspirates in aerobic and anaerobic culture conditions using the non-parametric Wilcoxon’s rank sum test. For the clustering analysis, the data consisted in 0s and 1s corresponding to the infection status (detection of the pathogen by qPCR) of the children: 0 = uninfected and 1 = infected. The infection profiles for the children obtained were clustered with a Hierarchical Clustering based on a binary distance coupled with Ward’s agglomeration method. No clustering was applied on the variables.

DNA extraction and real-time PCR

Samples were extracted by commercial kits using a Qiacube instrument (Cador Pathogen 96 QIAcube HT Kit, Qiagen France SAS, Courtaboeuf, France). DNA extractions were performed following the manufacturer’s recommendations with an additional bead-beating step to increase mechanical disruption. In brief, 200 mg of freshly thawed sample were mixed with 1.4 mL of ASL buffer at 4°C and vigorously vortexed for 1 min. The suspension was transferred into a Pathogen Lysis Tube S (Qiagen) containing 2 mg of sterile glass beads (100μM diameter). Samples were mechanically disrupted using a TissueLyser II (Qiagen Retsch GmbH, Hilden, Germany) for 10 min at 30Hz. The suspension was then incubated at 95°C for 5 min, vortexed for 15 sec and centrifuged at 14,000 x g for 1 min to ensure that no solid particles were transferred to the subsequent steps. A volume of 1.2 mL of the supernatant was then transferred into a new tube containing an InhibitEX tablet (Qiagen). Samples were vigorously vortexed for at least 1 min or until complete dissolution of the InhibitEX tablet. Three steps of centrifugation and supernatant transfer were performed thereafter (14,000 x g for 3 min). The remainder of the protocol was performed as recommended by the manufacturer. All samples were eluted in 150 μL AE buffer. DNA concentrations and purity were assessed via 260/280 and 260/230 absorbance ratios by spectrophotometry (Nanodrop 2000 Spectrophotometer, Thermo Fisher Scientific, Waltham, MA, USA). Samples were stored at -80°C until molecular analyses. Amplifications were carried out in an ABI StepOne instrument (Applied Biosystems, Nairobi, Kenya). After an initial denaturation step (95°C for 10 min), 45 cycles of two-step PCR (95°C for 15 s and 50–56°C for 60 s according to the duplex reaction) were performed in 5 parallel duplex reactions, targeting a broad range of diarrheagenic bacterial agents as described in Table 1. The result for each agent was recorded as the Ct value, which is inversely related to the pathogen load in each specimen. Ct values < or equal to 37 were considered as positive. Standard curves for each target were established and the linearity ensured the Ct cutoff value of 37 was applicable.
Table 1

Primers and probes targeting DNA of diarrheagenic agents.

PathogenDuplex/annealing t°Forward primerReverse primerProbeFluorophoresTarget gene/Access number—GenBankReference
Salmonella spp.1 / 50°CCGGGTTGCGTTATAGGTCTGATGAAATACGATGCGAACAACATCAATACTGCGCTGCCAGATHEX-BQ1Outer membrane protein, ompC / AIH09487.1[19]
Shigella spp.2 / 56°CACCGGCGCTCTGCTCTCGCAATGTCCTCCAGAATTTCGCTGGGCAGGGAAATGTTCCGCCHEX-BQ1invasion plasmid antigen H, ipaH / DQ132807.1[19]
ETEC1 / 50°CAAGCATGAATAGTAGCAATTACTGCT -> AAGCATGAATRGTAGCAATTACTGCT*TTAATAGCACCCGGTACAAGCAAACAACACAATTCAC -> TACAACACAATTCAC*FAM-BQ1Heat-stable enterotoxin ST, estIa / M29255.1[19]*
ETEC2 / 56°CTCCGGCAGAGGATGGTTACACCAGGGTTCTTCTCTCCAAGCAGCAGGTTTCCCACCGGATCACCFAM-BQ1Heat-labile enterotoxin LT, eltB / BAI49232.1[19]
EPEC3 / 50°CCATTGATCAGGATTTTTCTGGTGATACTCATGCGGAAATAGCCGTTAATACTGGCGAGACTATTTCAAFAM-BQ1Intimin, eae / CAG17538.1[20]
EPEC3 / 50°CTGGTGCTTGCGCTTGCTCGTTGCGCTCATTACTTCTGCAGTCTGCGTCTGATTCCAAHEX-BQ1bundle-forming pilus, bfpA / AB247927.1[20]
EAEC4 / 52°CGAATCGTCAGCATCAGCTACACCTAAAGGATGCCCTGATGACGGACAACTGCAAGCATCTAFAM-BQ1transcriptional activator of aggregative adherence fimbriae expression, aggR / AF411067.1[21]
EAEC4 / 52°CCATTTCACGCTTTTTCAGGAATCCTGATTTAGTTGATTCCCTACGCACATACAAGACCTTCTGGAGAAHEX-BQ1part of the aai gene cluster, encoding a type VI secretion system, aaiC / FN554766.1[21]
Campylobacter jejuni -> Campylobacter jejuni/coli5 / 53°CCTGCTAAACCATAGAAATAAAATTTCTCAC -> CWGCTAAACCATARAAATAAAATTTCTCAC*CTTTGAAGGTAATTTAGATATGGATAATCG -> YTTTGAAGGTAATTTAGATATGGATAATCG*CATTTTGACGATTTTTGGCTTGA -> CATTTTGAYGATTTTTGGCTTGA*HEX-BQ1Fibronectin-binding protein, cadF / AJK71638.1[22]*
Vibrio cholerae 5 / 53°CCCACTTAGTGGGTCAAACTATATTGTCATGCCCCTAATACATCATTAACGTTAGCCACTGCACCCAAFAM-BQ1Cholera toxin A subunit, ctxA / X58785.1[19]

* with modifications in the nucleotide sequence of primers and/or probe

* with modifications in the nucleotide sequence of primers and/or probe

Bacterial agents and target sequences

The targets for real-time PCR are presented in Table 1. Bacterial PCRs were developed from available publications concerning suitable target regions. All sequences were controlled and blasted in GenBank and some primers were adapted according to new retrieved sequences from GenBank. Salmonella spp. and Shigella spp. were identified by amplification of the outer-membrane protein C and the invasion plasmid antigen H (ipaH) gene (which also may be present in enteroinvasive E. coli [EIEC]), respectively. The presence of ipaH gene present on the virulence plasmid and on the chromosome was also tested by conventional PCR with the primers described in Phantouamath et al. [23] For enterotoxigenic Escherichia coli (ETEC), heat-labile toxin (eltB) and heat-stable toxin (estA) coding regions were targeted. For enteropathogenic E. coli (EPEC), the bundle-forming pilus (encoded by the bfpA gene) carried by the EPEC adherence factor (EAF) plasmid and the intimin (eae gene for EPEC attaching and effacing), an outer membrane adhesion essential for the intimate attachment of the EPEC or enterohemorrhagic E. coli (EHEC) to enterocytes were the targets. For enteroaggregative E. coli (EAEC), aggR and aaiC genes were amplified. The aggR gene encodes a transcriptional activator of the aggregative adherence fimbriae expression in enteroaggregative E. coli and aaiC, is part of the aai gene cluster, encoding a type VI secretion system. When one of the two targets was detected for ETEC (estIa or eltB) or EAEC (aggR or aaiC), the pathogen was considered to be present. Since eae can be present both in EPEC and EHEC, we considered only the presence of bfpA gene for EHEC detection. Fibronectin-binding protein (cadF) gene and the cholera toxin (CT) subunit A gene (ctxA) were the targeted genes for Campylobacter jejuni/coli and Vibrio cholerae, respectively. Sufficient amplification efficiencies were documented for each realtime PCR by analyzing serial dilutions of pUC57 plasmids carrying all synthetic target inserts (GeneCust Europe, Dudelange, Luxembourg). By comparing Ct values for each target amplified alone or in duplex reactions, it was confirmed that performance was not compromised by multiplexing (5 duplex reactions). In addition to optimization, which focused on analytical sensitivity, diagnostic accuracy was evaluated by analyzing well-characterized bacterial strains from the Culture Collection, Pasteur Institute of Madagascar (Salmonella Typhimurium [BEX125], Shigella flexneri [BEX126], E. coli Diego 1120 ETEC (astA, estA, eltB, uidA) [BEX228], E. coli Tul 2322 EPEC (escV, bfpA, uidA, eae) [BEX217], E. coli Morondava 1612 EAEC (eae, astA, aggR, pic, aaiC, uidA) [BEX216], Campylobacter jejuni [BEX112], Vibrio cholerae [BEX227]). Negative and positive controls were included in each qPCR amplification run.

DNA extraction, whole genome sequencing and phylogenetic analysis

DNA was extracted from the Shigella isolates with cador Pathogen 96 QIAcube HT Extraction Kit (QIAGEN, Paris, France) on a Qiacube HT from 5 mL of liquid cultures grown overnight at 37°C in Luria-Bertani infusion medium, following the manufacturer’s protocol. Purity and DNA quantity were assessed using Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). As previously described [24], illumina sequencing libraries were prepared by using Nextera XT DNA Sample Kit (Illumina, San Diego, CA, USA) with indexed-encoded adapters from Illumina, according to the manufacturer’s instructions. The libraries were pooled for sequencing on NextSeq 500 platform (Illumina) using 2 × 150-bp runs. FqCleaner (version 3.0) was used to eliminate adaptor sequences, reduce redundant or overrepresented reads, correct sequencing errors, merge overlapping paired reads, and discard reads with Phred scores (measure of the quality of identification of nucleobases generated by automated DNA sequencing) <20. The Illumina sequence data were assembled using Spades software [25]. The average nucleotide identity (ANI) values were calculated in EzGenome (https://www.ezbiocloud.net/taxonomy) [26] and Genome-to-Genome Distance Calculator (GGDC; http://ggdc.dsmz.de) [27], respectively. Whole-genome-based taxonomic analysis was performed by Type Strain Genome Server (TYGS) (at https://tygs.dsmz.de) [28]. The phylogenomic tree was constructed using FastME [29] from the genome blast distance phylogeny (GBDP). The trees were rooted at the midpoint [30]. Branch supports were inferred from 100 pseudo-bootstrap replicates. MLST, wgMLST, rMLST and cgMLST were obtained using Enterobase and virulence factor were identified using abricate package. This whole-genome shotgun project has been deposited at DDBJ/ENA/GenBank under the accession number JAIQVZ000000000 for Shigella flexneri HJRA178 and JAIQWA000000000 for Shigella flexneri HJRA198. The version described in this paper is version JAIQVZ010000000 and JAIQWA010000000. Raw sequence data for those strains were deposited under strain ESC_WA5556AA for Shigella flexneri HJRA198 and ESC_WA5569AA for Shigella flexneri HJRA178 in Enterobase.

Gentamicin invasion assay

The gentamicin invasion assay was performed to determine the invasion rate of viable Shigella isolates inside the HEp-2 cells. The methodology used was described in the Bio-protocol 9(13): e3292. [31]. In brief, the amount of 3.105 HEp-2 cells per well were initially seeded in a 6-well microplate. After 24 hours of incubation at 37°C in 10% CO2, the cell cultures were inoculated with Shigella isolates at multiplicity of infection (MOI) for this experiment of 5 (about 5 x 106 bacteria). The infected cells were incubated for 1 hour, washed three times with PBS and incubated for an additional hour with the gentamicin solution. The antibiotic solution was removed, the cells were washed three times with PBS and the infected cells were lysed with 1 ml of sodium deoxycholate solution. The remaining Shigella were quantified by CCU methodology and performed in duplicate. These CCU were compared with the initial values of Shigella suspensions.

Results

Description of the study population

The study population of the Afribiota full-project (Madagascar) comprises 490 children recruited in the community of the two districts of Antananarivo, Madagascar, of which 464 were able to provide enough feces for molecular analysis. Among these 464 children, 96 were severely stunted -SS-, 104 moderately stunted -MS- and 264 non-stunted considered as controls—C -. Sex ratio (M/F) was distributed as follows: 0.92, 1.36 and 1.2 for SS, MS and C, respectively. Duodenal aspirates (N = 109) were analyzed using bacteriological techniques and stools were analyzed by qPCR (Fig 1).
Fig 1

Flowchart inclusion process.

HIV-negative children aged 2 to 5 years, neither suffering from acute malnutrition, nor from any other severe disease recruited in the community of the two districts of Ankasina or Andranomanalina Isotry, and in two hospitals (Centre Hospitalier Universitaire Joseph Ravoahangy Andrianavalona (CHU-JRA) and Centre de Santé Materno-Infantile, Tsaralalana) in Antananarivo, Madagascar. They were classified in three different groups*: severe stunting—SS—(height-for-age z-score ≤ -3SD), moderate stunting—MS—(height-for-age z-score between -3SD and -2SD) and not stunted—C for controls—(height-for-age z-score ≥ -2SD). SR: Sex ratio.

Flowchart inclusion process.

HIV-negative children aged 2 to 5 years, neither suffering from acute malnutrition, nor from any other severe disease recruited in the community of the two districts of Ankasina or Andranomanalina Isotry, and in two hospitals (Centre Hospitalier Universitaire Joseph Ravoahangy Andrianavalona (CHU-JRA) and Centre de Santé Materno-Infantile, Tsaralalana) in Antananarivo, Madagascar. They were classified in three different groups*: severe stunting—SS—(height-for-age z-score ≤ -3SD), moderate stunting—MS—(height-for-age z-score between -3SD and -2SD) and not stunted—C for controls—(height-for-age z-score ≥ -2SD). SR: Sex ratio.

SIBO

In our study, a total of 165 duodenal aspirates were collected; however, due to several limitations and constraints (i.e. pH ≥ 5, enough volume for subsequent analyses), only 109 samples were investigated, 61 from SS and 48 from MS children (Fig 1). This is a substantial extension of the initial dataset presented in ref. 15 (12 duodenal samples). The duodenal samples were analyzed using plating techniques in aerobic and anaerobic culture conditions at 37°C. The prevalence of SIBO (≥105 CFU/ml of bacteria in the upper intestinal aspirates) was 85.3% (93 children out of 109) with 58.7% hosting more than 106 bacteria/ml (Table 2). The gender distributions were similar for the two groups, with a sex ratio of 0.94 and 0.63 for SS and MS, respectively. The mean age was 41.3 and 40.1 months for SS and MS, respectively. Per aspirate, two to eleven different morphotypes were randomly chosen and identified. In total, 51 different species were identified. Streptococcus, Neisseria, Staphylococcus, Rothia, Haemophilus, Pantoea and Branhamella were the most prevalent genera cultivated (Fig 2).
Table 2

CFU values in duodenal aspirates of stunted children (N = 109).

SIBO is defined as greater than 105 CFU/ml of upper intestinal aspirate as assessed by both anaerobic and aerobic cultures [16].

CFU valuesN (%)
07/109 (6.4)
102<cfu<1059/109 (8.3)
105<cfu<10629/109 (26.6)
106<cfu<10729/109 (26.6)
107<cfu<10828/109 (25.7)
cfu> = 1087/109 (6.4)
Fig 2

Number of isolates of the 12 most-abundant genera identified by culture techniques in duodenal aspirates of stunted children.

The color code for the different genera is given on the right.

CFU values in duodenal aspirates of stunted children (N = 109).

SIBO is defined as greater than 105 CFU/ml of upper intestinal aspirate as assessed by both anaerobic and aerobic cultures [16].

Number of isolates of the 12 most-abundant genera identified by culture techniques in duodenal aspirates of stunted children.

The color code for the different genera is given on the right.

SIBO and risk factors

SIBO was determined in stunted children only. Consequently, risk factors were assessed only for these children. According to the univariate analysis, age group, dental cavities, mode of delivery, lavatories, showers, household waste and soap usage for hand washing (mother) showed a p-value less than 0.25 to SIBO. A multivariable logistic regression analysis was carried out on these variables and none of these were found to be statistically associated with SIBO (p>0.05) (Tables 3 and S1 and S2). Regarding the pH values measured in the stomach samples from stunted children, they were low and there were no significant differences in a bivariate analysis for stomach pH and SIBO (S3 Table).
Table 3

Possible risk factors associated with SIBO.

Only variables having a P-value ≤0.25 in the univariate analysis (S2 Table) were entered into multivariate logistic regression for a final analysis (S3 Table). All variable were recorded by field workers (clinical research associates).

VariablesSIBOp-values
positivenegative
Age group
[2–3]4660.13
[4–5]4314
Dental cavities
yes34110.25
no559
Delivery mode
Vaginal delivery80200.20
Caesarean delivery90
Lavatories
Collective79170.14
Individual60
No toilets43
Showers
Inside house220.14
Outside house447
No showers4311
Household waste
Burn1300.12
Threw7620
Soap usage for hand washing (mother)
Before meals50150.07
Before and after meals384
After meals10
Never01

Possible risk factors associated with SIBO.

Only variables having a P-value ≤0.25 in the univariate analysis (S2 Table) were entered into multivariate logistic regression for a final analysis (S3 Table). All variable were recorded by field workers (clinical research associates).

Pathogens detection rates

In total, 464 fecal samples (264 controls -C-, 104 MS and 96 SS children) were included in the analysis. Negative and positive (pUC57 plasmids carrying synthetic target inserts and reference strains) controls were included in each qPCR amplification run. Table 4 (see also S4 Table) presented the percentages of bacterial diarrheagenic agents found in stunted children (moderately and severely stunted) and controls (C values < or equal to 37.0 were considered as positive). At least one bacterial pathogen was detected for 91.8% (90.9% in controls (N = 240) and 92% in stunted children (99 MS and 85 SS)).
Table 4

Comparison between stunted children and controls for the presence of bacterial diarrheagenic agents in fecal samples.

% for controls (N = 264)% for MS = (N = 104)% for SS = (N = 96)P-value*
Salmonella spp.7.95 (N = 21)5.21 (N = 5)12.5 (N = 12)0.13
Shigella spp.80.68 (N = 213)90.38 (N = 94)84.38 (N = 81)0.07
ETEC estIa4.17 (N = 11)5.77 (N = 6)6.25 (N = 6)0.66
ETEC eltB29.92 (N = 79)40.38 (N = 42)32.29 (N = 31)0.15
EPEC bfpA13.26 (N = 35)11.54 (N = 12)18.75 (N = 18)0.29
EPEC eae37.50 (N = 99)36.54 (N = 38)36.46 (N = 35)0.97
EAEC aggR31.06 (N = 82)27.88 (N = 29)29.17 (N = 28)0.82
EAEC aaiC17.80 (N = 47)25.96 (N = 27)22.92 (N = 22)0.18
Campylobacter jejuni/coli 14,39 (N = 38)11,54 (N = 12)13.54 (N = 13)0.77

%: percentage; N: total number of sample analysis; MS: moderately stunted; SS: severely stunted;

Comparisons between groups (controls and stunted children MS+SS) were determined using Pearson’s χ2-test or Fisher’s exact test, as appropriate. Only values with p < 0.05 could be considered to be statistically significant*.

%: percentage; N: total number of sample analysis; MS: moderately stunted; SS: severely stunted; Comparisons between groups (controls and stunted children MS+SS) were determined using Pearson’s χ2-test or Fisher’s exact test, as appropriate. Only values with p < 0.05 could be considered to be statistically significant*. All pathogens were detected at similar prevalence in MS/SS and in C (no statistical differences). The highest prevalence was found for the ipaH gene (Shigella spp. or enteroinvasive E. coli) with values up to 90.4% in MS and equal to 83.3 for the three groups altogether (MS, SS and C). The mean, median, lowest and highest C values for ipaH were 30, 31.5, 14.5 and 45, respectively. This suggests that the bacterial load was relatively high (Fig 2). The C values were not significantly lower in stunted children than controls for ipaH, as for the other genes/pathogens (Fig 3).
Fig 3

Box plot showing CT values for pathogens targeted by real-time PCR among stunted (104 moderately stunted and 96 severely stunted) and controls (N = 264).

Boxes show the median (midline) and the 25th and 75th percentiles, and bars indicate the 10th and 90th percentiles. Only the positive subjects (CT values = <37) for the respective pathogen agent was considered.

Box plot showing CT values for pathogens targeted by real-time PCR among stunted (104 moderately stunted and 96 severely stunted) and controls (N = 264).

Boxes show the median (midline) and the 25th and 75th percentiles, and bars indicate the 10th and 90th percentiles. Only the positive subjects (CT values = <37) for the respective pathogen agent was considered. When considering the presence of only one of the two genes for ETEC and EAEC, and only bfpA for EPEC since eae can be present both in EPEC and EHEC, ETEC and EAEC were present in about one-third (ETEC = 32.8 and EAEC = 29.9%) of the children (C, MS and SS children) and EPEC in 14% of the children. Campylobacter jejuni/coli and Samonella spp. were present in 13.6% and 8.2% of all children. No Vibrio cholerae were found. Infection with more than one pathogen was a common finding for both stunted children and asymptomatic controls: Out of 464 children, 173 (37.3%) carried 3 or more (until 5) pathogens, 151 (32.5%) and 107 (23%) carried two or one pathogen, respectively. No pathogens were detected in only 7.1% (N = 33) of the children. Using the Wilcoxon’s rank sum test, we correlated the pathogen presence in stools with the CFU/ml values from duodenal aspirates in aerobic and anaerobic culture conditions. The only pathogen significantly associated with the duodenal CFU count was Campylobacter spp. (p = 0.026) (S5 Table). The distributions of the CFU in duodenal aspirates with SIBO matching with feces contaminated or not by Campylobacter spp. are presented in S1 Fig.

Hierarchical clustering of enteropathogens according to their virulence factors and nutritional the status of children

A hierarchical clustering based on a binary distance and Ward’s agglomeration method allowed us to highlight 8 different clusters of pathogen detection profiles (Fig 4). A linear model was then applied to predict if HAZ correlated with the different virulence genes (invA, ipaH, estla, eltB, aggR, aaiC, bfpA, eae and cadF). The model showed a statistically not significant and weak proportion of variance (R2 = 0.03, F(9, 450) = 1.34, p = 0.214, adj. R2 = 6.61e-03). However, within this model, the effect of aaiC was statistically significant and negative (beta = -0.31, 95% CI [-0.58, -0.03], t(450) = -2.19, p < .05).
Fig 4

Heatmap showing gene frequency detected by qPCR and height for age Z (HAZ) scores (x-axis: isolates; y-axis: targeted genes).

The dendrogram fitted on the isolates (i.e. the subjects) were computed based on an asymmetric binary distance coupled with a Ward agglomeration method based on the presence—black color—or absence of the genes—gray color. The clusters derived from the hierarchical clustering were not shown to be significantly associated to HAZ. No clustering was performed on the variables (targeted genes).

Heatmap showing gene frequency detected by qPCR and height for age Z (HAZ) scores (x-axis: isolates; y-axis: targeted genes).

The dendrogram fitted on the isolates (i.e. the subjects) were computed based on an asymmetric binary distance coupled with a Ward agglomeration method based on the presence—black color—or absence of the genes—gray color. The clusters derived from the hierarchical clustering were not shown to be significantly associated to HAZ. No clustering was performed on the variables (targeted genes).

Shigella spp. carriage

During the study, we decided to isolate Shigella spp. from the feces collected (N = 143 samples) by cultivating them on Hektoen and XLD media. Very few green or pink colonies grew respectively on Hektoen or XLD [from 41 feces samples] on which 1 representative was isolated for further study. Only two isolates (from HJRA178—HJRA198 samples) were positive (qPCR) and were identified by API20E as Shigella flexneri (ID scores of 69.1 and 82.4%). They were isolated from a severely (HJRA178) and a moderated stunted child (HJRA198), both female, showing no recent clinical sign of diarrhea. The two isolates from HJRA178—HJRA198 samples were sequenced and their ANI and dDDH values based on full genome sequence regarding the closest relatives’ strains were significantly higher than the recommended cut-off points for species boundary [27] to indicate that they belong to the genus Shigella and the species flexneri with the closest relative being Shigella flexneri ATCC 29903 (S6 Table). In addition, the phylogenomic tree constructed on the TYGS using FastME from the genome blast distance phylogeny (GBDP) [26,27] provided further evidence on the taxonomic position of these strains within the genus Shigella and the species flexneri (S2 Fig). These two isolates clustered with Shigella flexneri ATCC 29903. Genotypic differences between the two isolates were also found based on their MLST, wgMLST and cgMLST and virulence factors (S7 Table). The two Shigella isolates from HJRA 178 and HJRA 198 stool samples were also referred to the French National Reference Center for Shigella at Institut Pasteur, Paris, France and were serotyped as S. flexneri 1b and S. flexneri 4v, respectively. As the two Shigella isolates were isolated from feces of asymptomatic stunted children, we investigated whether the two isolates of S. flexneri were able to invade Hep2 cells by using the classical gentamicin protection assay [27]. After incubation and treatment with gentamicin the total number of Hep2 cell- internalized bacteria was calculated and compared to a wild-type (M90T) and an invasion-deficient (mixD) strain. The gentamicin assay was realized in duplicate. Invasion was defined as the total number of intracellular bacteria in cells (extracellular bacteria were killed by gentamicin, a cell-impermeable antibiotic). The HJRA178 isolate (S. flexneri 1b = 3109 in S3 Fig) displayed the same behavior than the invasion-deficient (mixD) mutant and the HJRA198 isolate (S. flexneri 4v = 3110 in S3 Fig) the same behavior than the wild-type (M90T) strain. This confirmed that one of the two strains had intact invasiveness properties while the other one did not. The HJRA178 isolate displayed the Congo red binding (Crb+) phenotype associated the infectivity properties of S. flexneri whereas the HJRA198 isolate did not (Crb-) confirming the data obtained in the gentamicin protection assay.

Discussion

In this study, duodenal aspirates from stunted children (N = 109) were analyzed to characterize the bacterial population in the duodenum of stunted children and to investigate SIBO. Unfortunately, there is currently no single valid test for SIBO, and the accuracy of all current tests remains limited due to the failure of culture to be a gold standard. Even the value of 105 CFU/ml has begun to be questioned by consensus and review of the literature. Some studies suggest normal subjects rarely exceed 103 CFU/ml and that this should be the defining threshold for SIBO [32]. However, if we consider SIBO defined as greater than 105 CFU/ml upper intestinal aspirate as assessed by both anaerobic and aerobic cultures, this study confirms the preliminary results obtained in the Afribiota study [15] showing a very high prevalence of SIBO in stunted children (85.3%) with 58.7% having more than 106 bacteria/ml of duodenal fluid. Studies of children living in shantytowns in South America and Asia have detected SIBO at lower prevalence; from 16% (Bangladesh) to 61% (São Paulo, Brazil) [13,33,34,35]. These high SIBO positivity rates in our study also reflect the fact that the cultivation approach is more sensitive than the breath tests utilized in other studies. The presence of excessive bacteria in the small intestine is typically associated with a malabsorptive syndrome occurring in the context of gut stasis syndromes [36]. It was also suggested that SIBO is associated with intestinal inflammation [13], especially in resource-poor communities where an extreme poverty and unhygienic conditions prevail. The duodenum and proximal jejunum normally contain small numbers of bacteria (< 104 organisms per mL), usually lactobacilli, enterococci, streptococci (from the Lactobacillales order), gram-positive aerobes such as Veillonella (Firmicutes) or facultative anaerobes from Moraxellaceae and transiently non-oral genera from Enterobacteriaceae [37]. In this study, the most prevalent genera cultivated from the small intestine were Streptococcus, Neisseria, Staphylococcus, Rothia, Haemophilus, Pantoea and Branhamella. Those genera are generally oral taxa [38] and their presence in high numbers in duodenal fluids is uncommon. Our previous study on a relatively small number of stunted children in Antananarivo (Madagascar) and Bangui (CAR) showed a similar microbiota in both the stomach and duodenum of stunted children and a clear over-representation of pathobionts and of oropharyngeal species in the stools suggesting a decompartmentalization of the gastrointestinal tract [15]. We speculate that in these stunted children, gut maintenance declines and microbes can stray from traditional zones, negatively impacting intestinal homeostasis, host health and altered nutriment absorption [15]. In a recent study conducted on stunted undernourished children with enteropathy living in Bangladesh, the authors showed after esophagogastroduodenoscopy and duodenal biopsies a shared group of 14 taxa (not typically classified as enteropathogens) negatively correlated with linear growth and positively correlated with duodenal proteins involved in inflammatory responses [39]. The three most strongly correlated bacteria with the duodenal inflammatory markers were a Veillonella species, a Streptococcus species and Rothia mucilaginosa. Dysbiosis in the oral microbiota, and the significant increase of Veillonella sp. also positively correlated with elevated levels of inflammatory cytokines (IL-1ß, IFN-ɣ, TNF-α, IL-8) and immunoglobulin A in the saliva in patients with autoimmune liver disease [40] and in patients with inflammatory bowel disease (dominant genera: Streptococcus, Prevotella, Neisseria, Haemophilus, Veillonella and Gemella correlating to increased IL-1ß and lysozyme levels) [41]. The collected data emphasizes the possible role of the ectopic colonization in the upper part of the small intestine by some oral bacteria with pro- inflammatory features that could be tested in animal models with our isolated bacteria from the duodenum. Another explanation might be lack or the reduced concentration of gastric acid in the stunted children in LMICs (i.e. due to Helicobacter pylori contamination) which may lead to this bacterial overgrowth since gastric secretions is one of the normal defense mechanisms controlling the intestinal microflora [42]. However, the pH values measured in the stomach samples of our stunted children were low and there were no significant differences in a bivariate analysis for pH and SIBO (S4 Table). This study also assessed the possible association of SIBO with potential risk factors among the participants (education, possible exposure to contaminants, hygiene, …). Although some studies on SIBO have revealed an association with some risk factors such as open sewer outside the home (OR, 4.78; 95% CI, 1.06 to 21.62) [13], the present study did not find any association between SIBO and the variables assessed. The absence of association could be due to the high prevalence of SIBO in this study (85.3% vs 16.7% and 13.5% for the studies referred to in 34 and 35). The current research also aimed to assess by a molecular approach the carriage of intestinal pathogens in the feces, one of the important etiological causes which may be associated to EED in the children population. Despite the disadvantages of molecular approaches, such as being unable to determine whether bacteria are still alive or metabolically active [43], they offer a high level of sensitivity. For example, it has been shown that systematic application of multiplex qPCR enhances from 18 to 30% the detection of bacteria, parasites, and viruses in stool samples [44,45]. The current study shows a high prevalence of bacterial enteropathogens, especially those categorized as “enteroinvasive” or causing mucosal disruption such as Shigella spp., ETEC, EPEC and EAEC. Unexpectedly, all these pathogens were detected at similar rate in MS/SS and in C (no statistical differences) and all the children showed no sign of severe diarrhea 15 days before the inclusion. Particularly, Shigella spp. was highly prevalent in the qPCR approach, also confirmed by a conventional PCR approach on a limited number of samples. To assert the presence of living Shigella spp. in the feces samples, isolation was performed at the end of the cross-sectional study directly from stool streaked on XLD and Hektoen plates and only two samples gave rise to two S. flexneri isolates confirmed by whole genome sequence analysis and serotyping. This very low recovery of Shigella isolates could be explained by the fact that no specific enrichment broth exists for Shigella (except Selenite-F [46]) or that there were no-metabolically active Shigella in the samples. Subclinical infections (an infection in which symptoms are either absent or sufficiently mild to escape diagnosis [47]) or asymptomatic carriage (one who harbors pathogenic organisms without clinically recognizable symptoms and may infect others [48]) of intestinal pathogens seems common in low- and middle-income countries suffering from poor sanitary conditions. For instance, in Rwanda, high proportions of asymptomatic carriage (young healthy controls) were observed for adenovirus (50%), ETEC—based on eltB detection—(47%), EPEC—eae—(23%), Campylobacter (22%) and Shigella—ipaH—(17%) [49]. In children living in the Peruvian amazon, Shigella isolates (S. flexneri accounted for 67.1% of isolates) were also obtained by bacteriological cultures from 3.2% of surveillance stool cultures in the absence of diarrheal illness [50]. Asymptomatic carriage in young children has been attributed to several factors, including breastfeeding and maternal immunity, immunity gained from previous clinical or subclinical infections, and the intestinal microbiome acting as a gut barrier (which affects the likelihood that an enteric pathogen induces disease) [51]. In the case of Shigella it can be also interpreted as a prolonged pathogen excretion after illness (up to 17 months) [50] or a reinfection with the same strain from a very contaminated area with short- to medium term and serotype-specific immunity in children provided following clearance [52]. The carriage of a microorganism with limited pathogenicity could be also considered what could be the case for one of the two Shigella isolates (from the HJRA178 sample) as shown by the genomic analysis of the virulence factors and the inability to invade Hep2 cells. The limited pathogenicity could be explained by the loss of the virulence plasmid harboring the Mxi/Spa secretory apparatus encoded by two operons comprising about 25 genes. However, the other Shigella isolate (from the HJRA198 sample) was fully virulent and invasive suggesting different patterns of infection. The MAL-ED Network Investigators [11] study showed an association between enteropathogens (mainly Campylobacter and EAEC) in non-diarrheal stools and reduced linear growth (length and weight). The high proportion of enteropathogens in this study, especially Shigella spp. but also ETEC and EAEC, in both populations (stunted and non-stunted), supports the fact that carriage of enteropathogens could not be only associated with the population of stunted children and could prevented us to propose a direct association with stunting. However, in our previous study conducted on a more restricted number of samples by 16S rDNA sequencing, members of Escherichia coli/Shigella and Campylobacter sp. were more prevalent in stunted children compared with non-stunted controls [15]. Our data suggest that, beside combatting poverty and improving diet, environmental sanitation, quality of water sources, hygiene promotion and health education are key points to mitigate stunting and restore nutritional benefits even if a recent study provided evidence for the important role of timing of stunting on the recovery from the phenomenon rather than WASH practices [53].

Limitations

This study has however some limitations such as a single run of qPCR amplification on individual samples. Moreover, the integration of qPCR amplification results for enteric parasites [43] and viral infections was not considered either. Regarding the duodenal sampling technique via nasogastric tube, we ensured the first ml of aspiration from both stomach and duodenum were discarded in order to flush out possible contaminating bacteria and carry-over from the more proximal compartments. This study was not intended to directly measure evidence of EED but two investigate two major–possibly combined—etiologies, which may account for EED: SIBO and exposure to enteropathogens.

Distributions of the CFU in duodenal aspirates.

Distributions of the CFU in duodenal aspirates with SIBO matching with feces not contaminated by Campylobacter spp. [0 (in blue)]; and in duodenal aspirates with SIBO matching with feces contaminated by Campylobacter spp. [1 (in yellow)]. (TIF) Click here for additional data file.

Phylogenomic tree.

The phylogenomic tree includes the two Shigella isolates from HJRA178—HJRA198 samples constructed on the Type Strain Genome Server (TYGS) (at https://tygs.dsmz.de) using FastME from the genome blast distance phylogeny (GBDP). [26,27]. (TIF) Click here for additional data file.

Ratio of intracellular bacteria per input for the two Shigella flexneri isolates (from HJRA178 = 3109 and HJRA198 = 3110 samples) and for the mutant mxiD (non-invasive) and the strain M90T (invasive).

(TIF) Click here for additional data file.

Lists all data (risk factors) collected and used in univariate analysis with SIBO.

(XLSX) Click here for additional data file.

Results for univariate analysis and multivariate analysis.

(XLSX) Click here for additional data file.

Bivariate analysis for stomach pH and SIBO.

(PDF) Click here for additional data file.

SIBO and qPCR results.

(XLSX) Click here for additional data file.

Correlation between the pathogen presence in stools with the measure of CFU/ml grown from duodenal aspirates in aerobic and anaerobic culture conditions using the Wilcoxon’s rank sum test.

(XLSX) Click here for additional data file.

ANI and dDDH values based on genome sequences of the two isolated strains from HJRA178–HJRA198 samples and the closest relatives’ strains.

(XLSX) Click here for additional data file.

Virulence factors of the two isolated strains from HJRA178–HJRA198 samples.

(XLSX) Click here for additional data file.

List pf all AFRIBIOTA Investigators.

(PDF) Click here for additional data file. 11 Nov 2021 Dear Dr Collard, Thank you very much for submitting your manuscript "High prevalence of small intestine bacteria overgrowth and asymptomatic carriage of enteric pathogens in stunted children in Antananarivo, Madagascar." for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts. Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Andrew S. Azman Deputy Editor PLOS Neglected Tropical Diseases *********************** Reviewer's Responses to Questions Key Review Criteria Required for Acceptance? As you describe the new analyses required for acceptance, please consider the following: Methods -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? -Is the study design appropriate to address the stated objectives? -Is the population clearly described and appropriate for the hypothesis being tested? -Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? -Were correct statistical analysis used to support conclusions? -Are there concerns about ethical or regulatory requirements being met? Reviewer #1: The methods are well described and are appropriate. Reviewer #2: -Enrollment criteria need to be reviewed in detail. “other severe diseases” is vague. -Were all children truly admitted to the hospital as stated in line 119? If so, reason for admission needs to be detailed. -It seems that duodenal sampling technique via nasogastric tube could introduce nasopharyngeal flora into the sample thus contaminating it and skewing results for an over-representation of oral taxa. Authors should address this in methods and/or the limitations section of the discussion. -Data collection on co-variates is unclear. A complete list of what was assessed in univariate analysis needs to be provided with details (ie. Who assessed for dental carries). If extensive then perhaps a correction for multiple comparisons is appropriate. -Can authors cite a reference for using a CT cutoff of 37? This seems higher than most qPCR analyses. How was this value chosen? -eae, as authors state, could represent EHEC as well as EPEC. When authors use “either target” this may over-represent EPEC with some of these isolates being EHEC. -------------------- Results -Does the analysis presented match the analysis plan? -Are the results clearly and completely presented? -Are the figures (Tables, Images) of sufficient quality for clarity? Reviewer #1: Yes Reviewer #2: -Would add the number of duodenal aspirates to line 287. -Line 289 – 292 “The duodenum and proximal jejunum…” this is more fitting in the background. Not in the results. -A better description of how colonies and morphotypes were selected for MALDI-TOF is needed. Were a random number chosen from each sample? Were all isolates cultures sent for MADLI-TOF. This has major implications on the results so this needs to be clear. The description of this should be in the methods, not results. -Line 306 – 208 suggests no risk factors for SIBO were identified however in Table 3 handwashing is significant. Please clarify. Is table 3 univariate only (if so, suggest changing to multivariate final model). -Line 316 states no significant difference was found between pathogen carriage amongst stunting groups. However, in Table 4 Salmonella and Shigella are statistically significant. Please clarify. -Line 319 reports mean, median, and range of CT values. Is this for all pathogens and targets? -Line 320 states no difference in CT values was noted between groups, CT values for which pathogen? All pathogens? Please clarify. -Line 322-323: Meaning isn’t clear. 1/3 of the children had one of the 3 tested E. coli pathotypes? -It is unclear what exactly the cluster dendrogram of Fig 4 was clustered on. Details need to be provided in the methods section. -The difference in positivity between conventional and qPCR needs to be explained. Do you this qPCR has false positives or does traditional PCR miss cases? I suggest the authors make an argument for a single method and limit reporting to that method. -Analysis on Shigella carriage seems unrelated to the SIBO story. While interesting, I would suggest removing it and submitting as a separate report. -Table 3: Is this univariate or multivariate. Title should be more descriptive. -Figure 1: The abbreviation SR is not defined in the figure legend. -Figure 2: No microbiome analysis was conducted and thus the units on the Y axis of “relative abundance” do not make sense. Also, the range of 0-500 does not make sense if this is relative abundance. Please clarify. -Figure 4: Legend needs to be expanded to describe what variables were clustered on here. -------------------- Conclusions -Are the conclusions supported by the data presented? -Are the limitations of analysis clearly described? -Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? -Is public health relevance addressed? Reviewer #1: yes Reviewer #2: -Authors state they “precisely characterize the bacterial population in the duodenum”. This is an overstatement as they utilized outdated culture techniques rather than molecular means of quantifying the SIBO dysbiois. This should be listed as a limitation and this sentence revised. -Would discuss differences in positivity rates between this study and others in the literature. Perhaps culture of duodenal aspirate is more sensitivity than the breath testing utilized in the other studies discussed. -Authors suggest that SIBO causes inflammation, villus blunting, and decreased crypt-to-villous ratio. The relation of SIBO to histology needs to be cited. Further, stating the relationship is causal is an overstatement. “Associated” is more appropriate. -Line 399 – 400 “Those genera are generally…”: Needs citation. -Line 406 – 407 “In these stunted children…”: Sentence is purely speculative and none of this was shown in the cited reference. -Line 413: This is misleading. Strep, Veillonella, and Rothia are often found in the small intestine as well as the oral cavity. -The discussion of URI and children swallowing oral flora is purely speculative and without evidence. This should be removed. -Again, suggest revising all instances where authors state a causal relationship between pathogen carriage and SIBO/EED. -Limitations section should be moved to the discussion. Sampling technique and possible contamination of oral taxa on the nasogastric tube as well as lack of molecular testing on aspirates (i.e. culture techniques) should be added as limitati -------------------- Editorial and Data Presentation Modifications? Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”. Reviewer #1: The results section describing the two shigella isolates is too wordy - this can be shortened to very few lines. Reviewer #2: -There are many typos throughout this manuscript which are irksome to the reviewer -English and grammar are incorrect throughout the manuscript. This obscures meaning in places. -------------------- Summary and General Comments Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed. Reviewer #1: This is a well written article that reports high rates of small intestinal overgrowth in stunted, but not acutely ill children aged 2 to 5 years. The report is consistent with earlier studies in the literature so in this way, the data are mostly confirmatory, but the finding of oral bacteria in the upper small intestine is interesting. The finding of such a high prevalence of Shigella in fecal samples of all groups is also similar to other studies, except this is even higher. It is a bit unusual to find such a low number of these could be cultured. Shigella culture is not sensitive because of lack of enrichment broth, but it is strange to only recover Shigella from two samples. Some specific suggestions: Line 353-380 The description of the two Shigella isolates is too wordy. The data is important, but it could be said using many fewer lines. Regarding the discussion section. The authors suggest the intestinal bacteria are coming from the oral cavity and are perhaps protected from stomach acid by oral or nasal mucus. Another explanation might be lack of gastric acid in the stunted children and this may also be associated with Helicobacter infection. See Gracey M, et al. The stomach in malnutrition. Arch Dis Child 1977;52:325-7 and Windle HJ, et al Childhood Helicobacter pylori infection and growth impairment in developing countries: a vicious cycle? Pediatrics 2007;119:e754-9. The authors have information on the pH of the stomach (especially if stimulated) or information on rates of infection with Helicobacter in this population? If the authors are proposing the intestinal bacteria originate from the oral cavity, what are the suggestions for future studies to explore this. Also, how did the intubation method exclude the potential that the fluid obtained was not contaminated by the nasal bacteria as it was passing through the nasal cavity? The section on limitations is too brief. Some additional limitations include: 1) the study did not directly measure evidence of EE, but they assumed this. 2) the finding of the bacteria in the small intestine and stool shows an association with malnutrition, but this does not prove cause and effect. While came first? 3) the study did not attempt to correlate oral and intestinal bacteria. Table 4 should clarify that these are fecal samples Reviewer #2: OVERALL: The authors present an interesting analysis of children in Madagascar investigating the dysbiotic microbiome associated with SIBO using culture methods. They attempt to determine risk factors for SIBO as well as describe enteric pathogen carriage. They report 2 Shigella isolates which were sequenced and further investigated. This analysis has significant overlap with reference 14 and likely utilizes some of the same samples although this is unclear. Major critiques center around unrelated analyses being reported and unclear methodology. The introduction and discussion sections are also highly speculative. Further, it seems there is a missed opportunity here to investigate the relationship of enteric pathogen carriage to SIBO. I would suggest correlating pathogen presence or burden (CT value) with the continuous measure of CFU/ml of growth on duodenal aspirate culture. ABSTRACT: -The preferred term is Environmental Enteric Dysfunction (EED), not Environmental Enteric Disease. EE generally stands for Environmental Enteropathy, a term that has gone out of favor in recent years. -While EED has certainly been associated with enteric pathogen carriage, mechanisms of pathogenesis have yet to be fully explained. Throughout the manuscript, authors should refrain from stating that EED is caused by pathogen carriage. -EED is a complex syndrome, part of which includes an upper intestinal dysbiosis but to say EED causes a dysbiosis is misleading and unproven. -Lines 40 – 44 “The presence of those commonly…”: This sentence is purely speculative without evidence. Would remove such speculation. INTRODUCTION: -Overall, much of the introduction is author opinion/speculation which is inappropriate in scientific writing. I suggest the authors focus on reviewing the relevant literature (cited appropriately and correctly) to suggest the current study is needed. -Line 75: Adults in LMICs also have evidence of EED although this is less studied. -Line 76: The term “developing world” is no longer preferred. Recommend using the World Bank classification of low- and middle-income countries. -Lines 86 – 89 “The second, non-exclusive, etiology…” This entire sentence is unproven speculation. Citations are inappropriately used and neither discusses oral taxa, taxa associated with SIBO, or SIBO histology. -Authors need to be clear in the introduction as to how this manuscript differs from reference 14 and adds something novel to the literature. -------------------- PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols 11 Jan 2022 Submitted filename: Responses to the reviewers.docx Click here for additional data file. 23 Feb 2022 Dear Dr Collard, Thank you very much for submitting your manuscript "High prevalence of small intestine bacteria overgrowth and asymptomatic carriage of enteric pathogens in stunted children in Antananarivo, Madagascar." for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. The reviewers appreciated the attention to an important topic. Based on the reviews, we are likely to accept this manuscript for publication, providing that you modify the manuscript according to the review recommendations. Please prepare and submit your revised manuscript within 30 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. When you are ready to resubmit, please upload the following: [1] A letter containing a detailed list of your responses to all review comments, and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out [2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file). Important additional instructions are given below your reviewer comments. Thank you again for your submission to our journal. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments. Sincerely, Andrew S. Azman Deputy Editor PLOS Neglected Tropical Diseases *********************** Reviewer's Responses to Questions Key Review Criteria Required for Acceptance? As you describe the new analyses required for acceptance, please consider the following: Methods -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? -Is the study design appropriate to address the stated objectives? -Is the population clearly described and appropriate for the hypothesis being tested? -Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? -Were correct statistical analysis used to support conclusions? -Are there concerns about ethical or regulatory requirements being met? Reviewer #1: yes Reviewer #2: -If the samples from ref 15 (153 fecal and 12 duodenal) were included in the data set used here then this needs to be explicitly stated so readers understand the duplication of published data. If there is overlap, I would add a sentence stating that “153 fecal sample and 12 duodenal samples utilized included in this analysis have been previously analyzed and published on”(with appropriate reference). -It is mentioned in the methods that time between defecation and freeing was tracked. I would report the average either in the methods or in the first paragraph of the results. -When authors state the first ml of aspirate was discarded for “flashing” out of possible contamination, do you mean ‘flushing’? -------------------- Results -Does the analysis presented match the analysis plan? -Are the results clearly and completely presented? -Are the figures (Tables, Images) of sufficient quality for clarity? Reviewer #1: Yes Reviewer #2: -All presented data and supplementary information (i.e. Supplementary tables S1 and S2) need to be in English as this is an English journal. Please translate. -The finding of SIBO’s association with Campylobacter potentially quite significant. Neither in the manuscript nor in table S4 is directionality shown. Would add average CFU/ml in Campy positive and negative subjects with SD to the body of the manuscript (line 347) so readers can understand this relationship. -------------------- Conclusions -Are the conclusions supported by the data presented? -Are the limitations of analysis clearly described? -Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? -Is public health relevance addressed? Reviewer #1: Yes Reviewer #2: -Line 435 – 437: This is the first mention of pH values being the same between stunted and control children. This, and the reference to S7 Table, should be moved to the results section as new results should not be first presented in the discussion. -------------------- Editorial and Data Presentation Modifications? Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”. Reviewer #1: the authors carefully responded to the reviewer's comments. Reviewer #2: -Issues with grammar and typos remain but much improved. -Abbreviations should be defined at their first use (see line 114: SARI/ILI). -------------------- Summary and General Comments Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed. Reviewer #1: This study includes a substantial amount of data regarding intestinal overgrowth and makes some interesting observations about relationship with oral organisms. The stool microbiology is interesting, but is largely confirmatory. It is interesting that the apparent "pathogens" did not significantly relate to the degree of malnutrition. Reviewer #2: Authors have adequately addressed concerns in the first manuscript with a few minor suggestions remaining. I continue to think that this is a unique and important analysis with potentially large impact on the field of environmental enteric dysfunction and malnutrition. -------------------- PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Figure Files: While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Data Requirements: Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5. Reproducibility: To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols References Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article's retracted status in the References list and also include a citation and full reference for the retraction notice. 10 Mar 2022 Submitted filename: 2022 03 Responses to the editor.pdf Click here for additional data file. 1 Apr 2022 Dear Dr Collard, We are pleased to inform you that your manuscript 'High prevalence of small intestine bacteria overgrowth and asymptomatic carriage of enteric pathogens in stunted children in Antananarivo, Madagascar.' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases. Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests. Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated. IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript. Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS. Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards, Andrew S. Azman Deputy Editor PLOS Neglected Tropical Diseases *********************************************************** 2 May 2022 Dear Dr Collard, We are delighted to inform you that your manuscript, "High prevalence of small intestine bacteria overgrowth and asymptomatic carriage of enteric pathogens in stunted children in Antananarivo, Madagascar.," has been formally accepted for publication in PLOS Neglected Tropical Diseases. We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly. Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases. Best regards, Shaden Kamhawi co-Editor-in-Chief PLOS Neglected Tropical Diseases Paul Brindley co-Editor-in-Chief PLOS Neglected Tropical Diseases
  47 in total

1.  SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing.

Authors:  Anton Bankevich; Sergey Nurk; Dmitry Antipov; Alexey A Gurevich; Mikhail Dvorkin; Alexander S Kulikov; Valery M Lesin; Sergey I Nikolenko; Son Pham; Andrey D Prjibelski; Alexey V Pyshkin; Alexander V Sirotkin; Nikolay Vyahhi; Glenn Tesler; Max A Alekseyev; Pavel A Pevzner
Journal:  J Comput Biol       Date:  2012-04-16       Impact factor: 1.479

2.  DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.

Authors:  Johan Goris; Konstantinos T Konstantinidis; Joel A Klappenbach; Tom Coenye; Peter Vandamme; James M Tiedje
Journal:  Int J Syst Evol Microbiol       Date:  2007-01       Impact factor: 2.747

Review 3.  Small Intestinal Bacterial Overgrowth: Nutritional Implications, Diagnosis, and Management.

Authors:  Abimbola Adike; John K DiBaise
Journal:  Gastroenterol Clin North Am       Date:  2017-12-07       Impact factor: 3.806

Review 4.  Environmental enteric dysfunction: pathogenesis, diagnosis, and clinical consequences.

Authors:  Gerald T Keusch; Donna M Denno; Robert E Black; Christopher Duggan; Richard L Guerrant; James V Lavery; James P Nataro; Irwin H Rosenberg; Edward T Ryan; Phillip I Tarr; Honorine Ward; Zulfiqar A Bhutta; Hoosen Coovadia; Aldo Lima; Balakrishnan Ramakrishna; Anita K M Zaidi; Deborah C Hay Burgess; Thomas Brewer
Journal:  Clin Infect Dis       Date:  2014-11-01       Impact factor: 9.079

Review 5.  Gut microbiota-mediated protection against diarrheal infections.

Authors:  Stefanie L Vogt; B Brett Finlay
Journal:  J Travel Med       Date:  2017-04-01       Impact factor: 8.490

Review 6.  Environmental enteric dysfunction: an overview.

Authors:  Rosie J Crane; Kelsey D J Jones; James A Berkley
Journal:  Food Nutr Bull       Date:  2015-03       Impact factor: 2.069

7.  Genome sequence-based species delimitation with confidence intervals and improved distance functions.

Authors:  Jan P Meier-Kolthoff; Alexander F Auch; Hans-Peter Klenk; Markus Göker
Journal:  BMC Bioinformatics       Date:  2013-02-21       Impact factor: 3.169

8.  Epidemiology of enteroaggregative Escherichia coli infections and associated outcomes in the MAL-ED birth cohort.

Authors:  Elizabeth T Rogawski; Richard L Guerrant; Alexandre Havt; Ila F N Lima; Pedro H Q S Medeiros; Jessica C Seidman; Benjamin J J McCormick; Sudhir Babji; Dinesh Hariraju; Ladaporn Bodhidatta; Jasmin Shrestha; Japhat Anania; Athanasia Maro; Amidou Samie; Pablo Peñataro Yori; Shahida Qureshi; Mustafa Mahfuz; Pascal O Bessong; Margaret N Kosek; Tahmeed Ahmed; Zulfiqar A Bhutta; Dennis R Lang; Michael Gottlieb; Eric R Houpt; Aldo A M Lima
Journal:  PLoS Negl Trop Dis       Date:  2017-07-24

9.  Phenotypic and molecular characterisations of carbapenem-resistant Acinetobacter baumannii strains isolated in Madagascar.

Authors:  Pierrette Landrie Simo Tchuinte; Mamitiana Alain Noah Rabenandrasana; Carole Kowalewicz; Volasoa Herilalaina Andrianoelina; Andriniaina Rakotondrasoa; Zafitsara Zo Andrianirina; Vincent Enouf; Elisoa Hariniaina Ratsima; Frédérique Randrianirina; Jean-Marc Collard
Journal:  Antimicrob Resist Infect Control       Date:  2019-02-11       Impact factor: 4.887

10.  High detection rates of enteropathogens in asymptomatic children attending day care.

Authors:  Remko Enserink; Rianne Scholts; Patricia Bruijning-Verhagen; Erwin Duizer; Harry Vennema; Richard de Boer; Titia Kortbeek; Jeroen Roelfsema; Henriette Smit; Mirjam Kooistra-Smid; Wilfrid van Pelt
Journal:  PLoS One       Date:  2014-02-24       Impact factor: 3.240

View more
  2 in total

1.  Stunted children display ectopic small intestinal colonization by oral bacteria, which cause lipid malabsorption in experimental models.

Authors:  Pascale Vonaesch; João R Araújo; Jean-Chrysostome Gody; Jean-Robert Mbecko; Hugues Sanke; Lova Andrianonimiadana; Tanteliniaina Naharimanananirina; Synthia Nazita Ningatoloum; Sonia Sandrine Vondo; Privat Bolmbaye Gondje; Andre Rodriguez-Pozo; Maheninasy Rakotondrainipiana; Kaleb Jephté Estimé Kandou; Alison Nestoret; Nathalie Kapel; Serge Ghislain Djorie; B Brett Finlay; Laura Wegener Parfrey; Jean-Marc Collard; Rindra Vatosoa Randremanana; Philippe J Sansonetti
Journal:  Proc Natl Acad Sci U S A       Date:  2022-10-05       Impact factor: 12.779

2.  Putative Biomarkers of Environmental Enteric Disease Fail to Correlate in a Cross-Sectional Study in Two Study Sites in Sub-Saharan Africa.

Authors:  Pascale Vonaesch; Munir Winkel; Nathalie Kapel; Alison Nestoret; Laurence Barbot-Trystram; Clément Pontoizeau; Robert Barouki; Maheninasy Rakotondrainipiana; Kaleb Kandou; Zo Andriamanantena; Lova Andrianonimiadana; Azimdine Habib; Andre Rodriguez-Pozo; Milena Hasan; Inès Vigan-Womas; Jean-Marc Collard; Jean-Chrysostome Gody; Serge Djorie; Philippe J Sansonetti; Rindra Vatosoa Randremanana
Journal:  Nutrients       Date:  2022-08-12       Impact factor: 6.706

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.